LookUp List Information

CEDEN LookUp List: AnalyteLookUp

AnalyteName	AnalyteDescr	CASNumber	Group1	Group2	Group3	Group4	Group5	Group6	Group7	AnalyteType1	AnalyteType2	LastUpdateDate
Chemical Group A	Total of (Aldrin,Dieldrin,Endrin,Heptachlor,Heptachlor Epoxide,Chlorine,HCH, Endosulfan,Toxaphene)	0	Organics	Pesticides								2016-05-20
[(Methylimino)dimethylidyne]di-2,4-xylidine, N,N'-	N,N'-[(Methylimino)dimethylidyne]di-2,4-xylidine (Amitraz)	0	Organics	Pesticides	Insecticides							2017-04-04
[DAsp3]Microcystin-RR	[Deaspartic acid3] Microcystin-RR	0										2019-05-17
1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane	1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (DBE-DBCH)	3322938	Organics	FlameRetardants					All			2014-03-13
18a-Oleanane	18a-Oleanane	30759923	Organics	Hopanes					All			2014-01-28
2,2-bis(chloromethyl)propane-1,3-diyltetrakis(2-chloroethyl) bisphosphate	2,2-bis(chloromethyl)propane-1,3-diyltetrakis(2-chloroethyl) bisphosphate (V6)	38051104	Organics	FlameRetardants					All			2014-03-13
2,4,6-tribromophenyl allyl ether	2,4,6-tribromophenyl allyl ether (ATE)	3278895	Organics	FlameRetardants					All			2014-03-13
2-ethyl-1-hexyl-2,3,4,5-tetrabromobenzoate	2-ethyl-1-hexyl-2,3,4,5-tetrabromobenzoate (EHTBB)	183658277	Organics	FlameRetardants					All			2014-03-13
2-Ethylhexyl-diphenyl phosphate	2-Ethylhexyl-diphenyl phosphate (EHDPP)	1241947	Organics	FlameRetardants					All			2014-03-13
4-Aminophenylsulfonylcarbamic acid methyl ester, N-	N-(4-Aminophenyl)sulfonylcarbamic acid methyl ester (Asulam)	0	Organics	Pesticides	Herbicides							2017-04-04
4-chloro-2-methylphenyl-N,N-dimethylmethanimidamide, N'-	N'-(4-chloro-2-methylphenyl)-N,N-dimethylmethanimidamide (Chlordimeform)	6164983	Organics	Pesticides								2017-05-24
6-Pack Ring	6-Pack Ring	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
6PPD-quinone	6PPD-quinone (N-(1,3-dimethylbutyl)-N'-phenyl-p-phenylenediamine-quinone)	2754428185	Organics	para-Phenylenediamine (PPD) Derivatives								2026-01-23
6PPD-quinone-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: 6PPD-quinone-13C6	0	Organics	para-Phenylenediamine (PPD) Derivatives								2026-01-23
6PPD-quinone-d5(IsoDilAnalogue)	Isotope Dilution Analogue: 6PPD-quinone-d5 (6PPDQ-d5)	2750119141	Organics	para-Phenylenediamine (PPD) Derivatives	IDA							2026-02-02
Abamectin	Abamectin	71751412	Organics	Pesticides								2019-06-13
Abnormality	Abnormality (%)	0	Toxicity						All			2007-07-27
Abundance	Abundance	0	Toxicity						All			2007-07-27
AccesstoWaterbody_BikePath	AccesstoWaterbody_BikePath	0	Habitat	Debris					All			2014-11-04
AccesstoWaterbody_Fence	AccesstoWaterbody_Fence	0	Habitat	Debris					All			2014-11-04
AccesstoWaterbody_HeavyVegetation	AccesstoWaterbody_HeavyVegetation	0	Habitat	Debris					All			2014-11-04
AccesstoWaterbody_ParkingLot	AccesstoWaterbody_ParkingLot	0	Habitat	Debris					All			2014-11-04
AccesstoWaterbody_PicnicArea	AccesstoWaterbody_PicnicArea	0	Habitat	Debris					All			2014-11-04
AccesstoWaterbody_RestrictedAccessMaintenanceRoad	AccesstoWaterbody_RestrictedAccessMaintenanceRoad	0	Habitat	Debris					All			2014-11-04
AccesstoWaterbody_Roadway	AccesstoWaterbody_Roadway	0	Habitat	Debris					All			2014-11-04
AccesstoWaterbody_Walkway	AccesstoWaterbody_Walkway	0	Habitat	Debris					All			2014-11-04
Accumulation	Accumulation using Trash Protocol	0	Trash						All			2011-05-04
Acenaphthene	Acenaphthene	83329	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors		All			2007-07-27
Acenaphthene-d10(Surrogate)	Surrogate: Acenaphthene-d10	15067262	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors		All			2016-03-02
Acenaphthenes, C1-	C1-Acenaphthenes	0	Organics	PAHs	LMW_PAH							2018-07-24
Acenaphthylene	Acenaphthylene	208968	Organics	PAHs	SVOCs	LMW_PAH			All			2007-07-27
Acenaphthylene-d10(Surrogate)	Surrogate: Acenaphthylene-d10	0										2019-04-23
Acenaphthylene-d8(IsoDilAnalogue)	Isotope Dilution Analogue: Acenaphthylene-d8	93951974	Organics	PAHs	IDA							2023-11-14
Acenaphthylene-d8(Surrogate)	Surrogate: Acenaphthylene-d8	93951974	Organics	PAHs								2025-09-04
Acesulfame potassium	Acesulfame potassium	55589623										2021-05-07
Acetaldehyde	Acetaldehyde (Ethanal)	75070	Organics	VOCs					All			2025-01-21
Acetaminophen	Acetaminophen	103902	Organics	PPCPs								2010-04-26
Acetaminophen(Surrogate)	Surrogate: Acetaminophen	0	Organics									2017-03-06
Acetamiprid	Acetamiprid	135410207	Organics	Pesticides	Insecticides							2016-03-10
Acetamiprid-13C6(Surrogate)	Surrogate: Acetamiprid-13C6	0	Organics	Pesticides								2018-08-07
Acetamiprid-d3(Surrogate)	Surrogate: Acetamiprid-d3	1353869358	Organics	Pesticides	Insecticides	Neonicotinoids			All			2025-12-15
Acetamiprid-N-Desmethyl	Acetamiprid-N-Desmethyl	190604923	Organics	Pesticides								2018-08-07
Acetone	Acetone	67641	Organics	VOCs					All			2007-07-27
Acetophenone	Acetophenone	98862	Organics									2018-07-16
Acibenzolar-S-methyl	Acibenzolar-S-methyl	135158542	Organics	Pesticides	Fungicides							2016-03-10
Acid Mine Drainage Extent	Acid Mine Drainage Extent	0	Habitat						All			2019-05-07
Acid Mine Drainage Intensity	Acid Mine Drainage Intensity	0	Habitat						All			2019-05-07
Acid Mine Drainage Proximity	Acid Mine Drainage Proximity	0	Habitat						All			2019-05-07
Acid Neutralizing Capacity	Acid Neutralizing Capacity (ANC)	0	Inorganics	Conventionals					All			2012-09-13
Acid Volatile Sulfides	Acid Volatile Sulfides (AVS)	0	Inorganics	Conventionals					All			2012-09-13
Acifluorfen	Acifluorfen	50594666	Organics	Herbicides								2016-05-20
Acifluorfen Sodium	Acifluorfen Sodium	62476599	Organics	Pesticides								2017-04-10
Acrinathrin	Acrinathrin	101007061	Organics	Pesticides	Pyrethroids	Insecticides						2026-05-08
Acrolein	Acrolein	107028	Organics	OrganochlorinePesticides								2008-11-07
Acrylic fiber	Acrylic fiber, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fiber						2018-04-26
Acrylic Fiber Bundle	Acrylic Fiber Bundle	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Acrylic Film	Acrylic Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Acrylic Foam	Acrylic Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Acrylic Fragment	Acrylic Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Acrylic Sphere	Acrylic Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Acrylonitrile	Acrylonitrile	107131	Organics	VOCs								2014-01-29
Acrylonitrile Butadiene Styrene Fiber	Acrylonitrile butadiene styrene Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Acrylonitrile Butadiene Styrene Film	Acrylonitrile butadiene styrene Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Acrylonitrile Butadiene Styrene Fragment	Acrylonitrile butadiene styrene Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Actinemys pallida (SWPT)	Actinemys pallida, Assay name: SWPT, 5’ CCATCCCTACTACTACTTCTAGC 3’, 5’ GGCTAAGTTTCCGGCTAATG 3’, 5FAM-TGCCCCTGCTTCGATTCCTGAT-3IABkFQ	0	Microbiological									2023-12-22
Adsorbable Organic Fluorine	Adsorbable Organic Fluorine (AOF) [detected as Fluoride]	0	Organics	PFAS					All			2025-11-21
Aesthetic Condition	Aesthetic Condition	0	Habitat	Debris					All			2014-11-04
AFDM_Algae	Ash Free Dry Mass primarily of Algae but other items may be weighed	0	Inorganics	Conventionals					All	Constituents		2011-10-26
Age	Age	0	Tissue						All			2009-08-20
Age Diversity and Natural Regeneration Metric	Metric assesses the age diversity and natural regeneration potential of woody species in the riparian and channel zones (excluding low-flow).	0	Habitat						All			2019-05-13
Age_Pond	Age (in years) of the pond if it is created	0	Habitat						All			2012-09-13
Agricultural Other Extent	Agricultural Other Extent	0	Habitat						All			2019-05-07
Agricultural Other Intensity	Agricultural Other Intensity	0	Habitat						All			2019-05-07
Agricultural Other Proximity	Agricultural Other Proximity	0	Habitat						All			2019-05-07
Agricultural Runoff Extent	Agricultural Runoff Extent	0	Habitat						All			2019-05-07
Agricultural Runoff Intensity	Agricultural Runoff Intensity	0	Habitat						All			2019-05-07
Agricultural Runoff Proximity	Agricultural Runoff Proximity	0	Habitat						All			2019-05-07
Air Traffic Extent	Air Traffic Extent	0	Habitat						All			2019-05-07
Air Traffic Intensity	Air Traffic Intensity	0	Habitat						All			2019-05-07
Air Traffic Proximity	Air Traffic Proximity	0	Habitat						All			2019-05-07
Alachlor	Alachlor (Lasso)	15972608	Organics	Herbicides	Endocrine Disruptors				All			2013-05-28
Alachlor ethanesulfonic acid	Alachlor ethanesulfonic acid (ESA)	142363539	Organics	Pesticides								2017-04-10
Alachlor oxanilic acid	Alachlor oxanilic acid (OXA)	0	Organics	Pesticides								2017-04-10
Albuterol	Albuterol	18559949	Organics	PPCPs								2010-04-26
Albuterol-d3(Surrogate)	Surrogate: Albuterol-d3	0	Organics	PPCPs								2016-03-02
Aldicarb	Aldicarb	116063	Organics	Pesticides	Pest-Carbamates	Insecticides			All			2007-07-27
Aldicarb Sulfone	Aldicarb Sulfone	1646884	Organics	Pesticides	Insecticides	Carbamates						2014-01-28
Aldicarb Sulfoxide	Aldicarb Sulfoxide	1646873	Organics	Pesticides	Insecticides	Carbamates						2014-01-28
Aldrin	Aldrin	309002	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors		All			2007-07-27
Aldrin(Surrogate)	Surrogate: Aldrin	309002	Organics	Pesticides								2016-03-02
Aldrin-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Aldrin-13C12	0	Organics	Pest-OCHs	IDA							2023-10-27
Aldrin-13C12(Surrogate)	Surrogate: Aldrin-13C12	309002	Organics	Pesticides								2016-03-02
Algae	Algae for benthics	0	Habitat						All	CollectionDevice		2008-12-04
Algae Cover	Percent of stream's water surface upstream of sample location estimated to be covered with algae	0	FieldObservations	Habitat					All	Constituents		2010-03-03
Algae-attached	Percent of substrate in wetted channel upstream of sample location estimated to be covered with Algae-attached	0	FieldObservations	Habitat					All	Constituents		2011-11-02
Algae-floating Mats	Percent of stream's water surface upstream of sample location estimated to be covered with Algae-floating Mats	0	FieldObservations	Habitat						Constituents		2013-06-02
Algal Growth Potential as Chlorophyll a	Algal Growth Potential as Chlorophyll a	0	WaterQualityMeasurements	Conventionals								2018-02-07
Algal/Surface Mats/Benthic Algal Growth Extent	Algal/Surface Mats/Benthic Algal Growth Extent	0	Habitat						All			2019-05-07
Algal/Surface Mats/Benthic Algal Growth Intensity	Algal/Surface Mats/Benthic Algal Growth Intensity	0	Habitat						All			2019-05-07
Algal/Surface Mats/Benthic Algal Growth Proximity	Algal/Surface Mats/Benthic Algal Growth Proximity	0	Habitat						All			2019-05-07
Alkalinity as CaCO3	Alkalinity as CaCO3	471341	Inorganics	Conventionals	WaterQualityMeasurements	Habitat			All			2009-08-20
Allethrin	Allethrin	584792	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Allyl Chloride	Allyl Chloride (3-Chloropropene)	107051	Organics	VOCs					All			2025-01-21
Alpha Linolenic Acid	Alpha Linolenic Acid	0	Organics	Omega Fatty Acid					All			2012-09-12
Alprazolam	Alprazolam	28981977	Organics	PPCPs								2010-04-26
Alprazolam-d5(Surrogate)	Surrogate: Alprazolam-d5	0	Organics	PPCPs								2010-04-26
Aluminum	Aluminum	7429905	Inorganics	TraceElements	Metals				All			2007-07-27
Aluminum Foil	Aluminum Foil	0	Debris	Trash	Non-Plastics	Metals			All			2014-11-04
Aluminum Phosphide	Aluminum Phosphide (Phostoxin or Fumitoxin)	0	Inorganics	Pesticides								2017-04-04
Aluminum, Organic Monomeric	Organic Monomeric Aluminum (Organic Reactive)	0	Inorganics	TraceElements	Metals							2013-05-21
Aluminum, Total Monomeric	Total Monomeric Aluminum (Organic + Inorganic Reactive)	0	Inorganics	TraceElements	Metals							2013-05-21
Aluminum/Steel Can	Aluminum/Steel Can	0	Debris	Trash	Non-Plastics	Metals			All			2014-11-04
Ametryn	Ametryn	834128	Organics	Pesticides	Pest-Triazines	Herbicides			All			2007-07-27
Amino-1,2,4-triazole, 3-	3-Amino-1,2,4-triazole (Amitrole)	0	Organics	Pesticides	Herbicides							2017-04-04
Amino-2-chloro-4(ethylamino)-s-triazine, 6-	6-Amino-2-chloro-4(ethylamino)-s-triazine (CEAT)	0	Organics	Pesticides								2017-04-04
Aminobenzothiazole, 2-	2-Aminobenzothiazole (ABT)	136958	Organics	Benzotriazoles and Benzothiazoles								2026-02-10
Aminocarb	Aminocarb	2032599	Organics	Pesticides	Pest-Carbamates	Insecticides			All			2007-07-27
Aminomethyl Phosphonic Acid	Aminomethyl Phosphonic Acid (AMPA)	1066519	Organics	Pesticides	Herbicides				All			2025-08-25
Aminopyralid	Aminopyralid	150114719	Organics	Herbicides								2016-05-20
Aminopyridine, 4-	4-Aminopyridine	504245	Organics	Pesticides								2017-04-20
Amitriptyline	Amitriptyline	50486	Organics	PPCPs								2010-04-26
Amitriptyline-d5(Surrogate)	Surrogate: Amitriptyline-d5	0	Organics	PPCPs								2016-03-02
Amitriptyline-d6(Surrogate)	Surrogate: Amitriptyline-d6	0	Organics	PPCPs								2018-01-18
Amlodipine	Amlodipine	88150429	Organics	PPCPs								2010-04-26
Ammonia as N	Ammonia as N	7664417	Inorganics	Conventionals	Nutrients				All			2007-07-27
Ammonia as N, Unionized	Unionized Ammonia as N	7664417	Inorganics	Conventionals	Nutrients				All			2012-06-22
Ammonia as NH3	Ammonia as NH3	7664417	Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			All			2007-07-27
Ammonia as NH3, Unionized	Unionized Ammonia as NH3	7664417	Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			All			2012-06-27
Ammonium as N	Ammonium as N (NH4)	0	Inorganics	Conventionals	Nutrients				All	Constituents		2010-04-21
Ammonium Chloride	Ammonium Chloride	0	Inorganics									2018-04-12
Amoxicillin	Amoxicillin	26787780										2018-08-20
AMPA(Surrogate)	Surrogate: Aminomethyl Phosphonic Acid (AMPA)	77521290	Organics	Pesticides								2016-05-20
Amphetamine	Amphetamine	300629	Organics	PPCPs								2010-04-26
Amphetamine-d5(Surrogate)	Surrogate: Amphetamine-d5	0	Organics	PPCPs								2016-03-02
AnalysisWeight	Analysis weight of sample	0	Laboratory	Ancillary								2014-02-05
Anatoxin-A	Anatoxin-A	64285069	Microbiological	Cyanotoxins					All			2012-05-22
Anatoxin-a gene, Prokaryotic DNA (anaC)	Anatoxin-a gene, Prokaryotic DNA, Target Gene: anaC, Proprietary primer sequences from Bend Genetics LLC	0	Microbiological	Cyanotoxins	Gene Marker				All			2026-05-27
Anaxyrus californicus (AroT)	Anaxyrus californicus, Assay name: AroT, 5’ CACCAAACTAACTAACTTCTTT 3’, 5’ CATTAGGTATTTCATCATTCCC 3’, 5FAM-AATTTATTGGAGCTATAATGATAGTACCGT-3IABkFQ	0	Microbiological									2023-12-22
Andorostenedione	Andorostenedione	63058										2021-05-07
Androstane, 5-alpha-	5-alpha-Androstane	438222	Organics	PPCPs					All			2014-01-28
Angling Pressure	Angling Pressure	0	Habitat						All			2009-08-20
Anilazine	Anilazine	101053	Organics	Pesticides	Fungicides							2016-10-25
Aniline	Aniline (Aminobenzene)(Phenylamine)	0	Organics	VOCs								2016-05-20
Animal Burrows Extent	Animal Burrows Extent	0	Habitat						All			2019-05-07
Animal Burrows Intensity	Animal Burrows Intensity	0	Habitat						All			2019-05-07
Animal Burrows Proximity	Animal Burrows Proximity	0	Habitat						All			2019-05-07
AnimalPresence	describes presence of animals which may include tracks, scat, sounds or physical presence	0	FieldObservations	Habitat					All			2013-04-01
Anion-Cation Balance	Anion-Cation Balance	0	Inorganics									2017-03-29
AnoxicTransitionDepth	Depth of the oxic-anoxic transition zone, also called redox potential discontinuity	0	FieldObservations	Habitat								2018-02-20
Antennal segment	Antennal segment (#)	0	Toxicity						All			2007-07-27
Anthracene	Anthracene	120127	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors		All			2007-07-27
Anthracene-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Anthracene-d10	1719068										2024-01-19
Anthracene-d10(Surrogate)	Surrogate: Anthracene-d10	0	Organics	PAHs								2016-03-02
Anthraquinone	Anthraquinone	84651	Organics									2018-07-16
Anthropogenic (cellulosic) fiber	Cellulosic fiber (Cotton, Rayon, Modal, or Lyocell), that can be grouped under cellulosic fiber and is dyed or dyed.	0	Microdebris	Anthropogenic	Natural Based	Fiber						2018-04-26
Anthropogenic (cellulosic) Fiber Bundle	Anthropogenic (cellulosic) Fiber Bundle	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Anthropogenic (cellulosic) Film	Anthropogenic (cellulosic) Film	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Anthropogenic (cellulosic) Foam	Anthropogenic (cellulosic) Foam	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Anthropogenic (cellulosic) Fragment	Anthropogenic (cellulosic) Fragment	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Anthropogenic (cellulosic) Sphere	Anthropogenic (cellulosic) Sphere	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Anthropogenic (non-plastic) fragment	Fragment that is anthropogenic, confirmed as non-plastic including asphalt	0	Microdebris	Anthropogenic		Fragment						2018-04-26
Anthropogenic (plastic) fragment	Fragment that is anthropogenic, confirmed as plastic based on dye spectroscopy, but polymer type could not be identified	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-04-26
Anthropogenic (protein base) Fiber	Anthropogenic (protein base) Fiber	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Anthropogenic (protein) fiber	Wool, hair, or silk fiber that can be grouped under protein fiber and is dyed or undyed	0	Microdebris	Anthropogenic	Natural Based	Fiber						2018-04-26
Anthropogenic (synthetic) fiber	Synthetic fiber that is dyed (e.g. monomers, polymer degradation products such as aromatic compounds and esters)	0	Microdebris	Anthropogenic		Fiber						2018-06-18
Anthropogenic (synthetic) Film	Anthropogenic (synthetic) Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Anthropogenic (synthetic) Foam	Anthropogenic (synthetic) Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Anthropogenic (synthetic) Fragment	Anthropogenic (synthetic) Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Anthropogenic (synthetic) Sphere	Anthropogenic (synthetic) Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Anthropogenic (unknown base) fiber	Fiber that is anthropogenic because it is DYED, but material type could not be identified as plastic or natural	0	Microdebris	Anthropogenic		Fiber						2018-06-18
Anthropogenic (unknown base) Fiber Bundle	Anthropogenic (unknown base) Fiber Bundle	0	Microdebris	Anthropogenic	Unknown							1900-01-01
Anthropogenic (unknown base) Film	Anthropogenic (unknown base) Film	0	Microdebris	Anthropogenic	Unknown							1900-01-01
Anthropogenic (unknown base) Foam	Anthropogenic (unknown base) Foam	0	Microdebris	Anthropogenic	Unknown							1900-01-01
Anthropogenic (unknown base) fragment	Fragment that is anthropogenic, confirmed as plastic , but polymer type could not be identified	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-04-26
Anthropogenic (unknown base) Sphere	Anthropogenic (unknown base) Sphere	0	Microdebris	Anthropogenic	Unknown							1900-01-01
Anthropogenic Alt Channel Modification SubMetric	Metric assesses the impact of anthropogenic alterations based on channel modification	0	Habitat						All			2019-05-13
Anthropogenic Alt Hydromodification SubMetric	Metric assesses the impact of anthropogenic alterations based on hydromodification and Channel Evolution Models (CEMS)	0	Habitat						All			2019-05-13
Anthropogenic Alterations to Channel Morph Metric	Metric assesses the impact of anthropogenic alterations to channel morphology through hydromodification and channel modification. Metric is an average of the two previous submetrics.	0	Habitat						All			2019-05-13
Antimony	Antimony	7440360	Inorganics	Metals	Metalloids				All			2007-07-27
Antipyrine	Antipyrine (Phenazone)	60800										2021-05-07
Appliance	Appliance	0	Debris	Trash	Non-Plastics	Large			All			2014-11-04
AquaticLife	AquaticLife using Trash Protocol	0	Trash						All			2011-05-04
Arachidonic	Arachidonic	0	Organics	Omega Fatty Acid					All			2012-09-12
Area	Area	0	Tissue	Habitat					All	CollectionDevice		2012-06-01
Arsenate	Arsenate	0	Inorganics	Metals								2014-01-29
Arsenic	Arsenic	7440382	Inorganics	TraceElements	Metals	Metalloids			All			2007-07-27
Arsenic, Inorganic	Inorganic Arsenic	7440382	Inorganics	TraceElements	Metals				All			2013-05-28
Arsenite	Arsenite	0	Inorganics	Metals								2014-01-29
Asbestos, Total	Total Asbestos	0	Inorganics	Conventionals					All			2012-09-13
ASCI_D	Score for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_cnt.spp.most.tol_pct_att	Percent of taxa attributed with tolerance value (QA metric) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_cnt.spp.most.tol_pred	Count of most tolerant algae taxa (predicted) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_cnt.spp.most.tol_raw	Count of most tolerant algae taxa (raw) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_cnt.spp.most.tol_scr	Count of most tolerant algae taxa (score) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_EpiRho.richness_pct_att	Percent of taxa attributed with genus (QA metric) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_EpiRho.richness_pred	Richness of Epithemia and Rhopalodia taxa (predicted) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_EpiRho.richness_raw	Richness of Epithemia and Rhopalodia taxa (raw) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_EpiRho.richness_scr	Richness of Epithemia and Rhopalodia taxa (score) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_NumberTaxa	Number of diatom taxa	0	Bioassessment						All			2021-01-28
ASCI_D_prop.spp.IndicatorClass_TN_low_pct_att	Percent of taxa attributed with nitrogen indicator value (QA metric) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_prop.spp.IndicatorClass_TN_low_pred	Proportion low total nitrogen indicator taxa (predicted) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_prop.spp.IndicatorClass_TN_low_raw	Proportion low total nitrogen indicator taxa (raw) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_prop.spp.IndicatorClass_TN_low_scr	Proportion low total nitrogen indicator taxa (score) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_prop.spp.Planktonic_pct_att	Percent of taxa attributed with habitat value (QA metric) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_prop.spp.Planktonic_pred	Proportion planktonic taxa (predicted) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_prop.spp.Planktonic_raw	Proportion planktonic taxa (raw) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_prop.spp.Planktonic_scr	Proportion planktonic taxa (score) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_prop.spp.Trophic.E_pct_att	Percent of taxa attributed with trophic indicator value (QA metric) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_prop.spp.Trophic.E_pred	Proportion eutrophic taxa (predicted) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_prop.spp.Trophic.E_raw	Proportion eutrophic taxa (raw) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_prop.spp.Trophic.E_scr	Proportion eutrophic taxa (score) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_Salinity.BF.richness_pct_att	Percent of taxa attributed with salinity value (QA metric) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_Salinity.BF.richness_pred	Richness of brackish/freshwater taxa (predicted) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_Salinity.BF.richness_raw	Richness of brackish/freshwater taxa (raw) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_Salinity.BF.richness_scr	Richness of brackish/freshwater taxa (score) for the Diatom Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_D_ValveCount	Total number of diatom valves reported in the input data (i.e., sum of BAResult)	0	Bioassessment						All			2021-01-28
ASCI_H	Score for the Hybrid (diatom and soft-bodied algae) Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_cnt.spp.IndicatorClass_TP_high_pct_att	Percent of taxa attributed phosphorus indicator value (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_cnt.spp.IndicatorClass_TP_high_pred	Count of high total phosphorus indicator taxa (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_cnt.spp.IndicatorClass_TP_high_raw	Count of high total phosphorus indicator taxa (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_cnt.spp.IndicatorClass_TP_high_scr	Count of high total phosphorus indicator taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_cnt.spp.most.tol_pct_att	Percent of taxa attributed with tolerance value (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_cnt.spp.most.tol_pred	Count of most tolerant algae taxa (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_cnt.spp.most.tol_raw	Count of most tolerant algae taxa (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_cnt.spp.most.tol_scr	Count of most tolerant algae taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_EpiRho.richness_pct_att	Percent of taxa attributed with genus (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_EpiRho.richness_pred	Richness of Epithemia and Rhopalodia taxa (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_EpiRho.richness_raw	Richness of Epithemia and Rhopalodia taxa (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_EpiRho.richness_scr	Richness of Epithemia and Rhopalodia taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_NumberTaxa	Number of diatom taxa + soft-bodied algae taxa in Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_OxyReD_DO_30.richness_pct_att	Percent of taxa attributed with oxygen tolerance value (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_OxyReD_DO_30.richness_pred	Richness of algae species with 30% oxygen tolerance (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_OxyReD_DO_30.richness_raw	Richness of algae species with 30% oxygen tolerance (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_OxyReD_DO_30.richness_scr	Richness of algae species with 30% oxygen tolerance (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_prop.spp.Planktonic_pct_att	Percent of taxa attributed with habitat value (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_prop.spp.Planktonic_pred	Proportion planktonic algae taxa (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_prop.spp.Planktonic_raw	Proportion planktonic algae taxa (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_prop.spp.Planktonic_scr	Proportion planktonic algae taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_prop.spp.Trophic.E_pct_att	Percent of taxa attributed with trophic indicator value (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_prop.spp.Trophic.E_pred	Proportion eutrophic algae taxa (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_prop.spp.Trophic.E_raw	Proportion eutrophic algae taxa (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_prop.spp.Trophic.E_scr	Proportion eutrophic algae taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_prop.spp.ZHR_pct_att	Proportion of taxa attributed for the Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa metric for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_prop.spp.ZHR_raw	Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (raw)	0	Bioassessment						All			2021-01-28
ASCI_H_prop.spp.ZHR_scr	Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_Salinity.BF.richness_pct_att	Percent of taxa attributed with salinity value (QA metric) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_Salinity.BF.richness_pred	Richness of brackish/freshwater algae taxa (predicted) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_Salinity.BF.richness_raw	Richness of brackish/freshwater algae taxa (raw) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_H_Salinity.BF.richness_scr	Richness of brackish/freshwater algae taxa (score) for the Hybrid Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_S	Score for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_S_Biovolume	Total soft-bodied algae biovolume reported in the input data (i.e., sum of Result)	0	Bioassessment						All			2021-01-28
ASCI_S_EntityCount	Total number of soft-bodied algae entities reported in the input data (i.e., sum of BAResult)	0	Bioassessment						All			2021-01-28
ASCI_S_NumberTaxa	Number of soft-bodied algae taxa	0	Bioassessment						All			2021-01-28
ASCI_S_prop.spp.IndicatorClass_DOC_high_pct_att	Percent of taxa attributed with dissolved organic carbon indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_S_prop.spp.IndicatorClass_DOC_high_raw	Proportion high dissolved organic carbon indicator Algal species (raw)	0	Bioassessment						All			2021-01-28
ASCI_S_prop.spp.IndicatorClass_DOC_high_scr	Proportion high dissolved organic carbon indicator Algal species (score) for the Soft-bodied Agae Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_S_prop.spp.IndicatorClass_NonRef_pct_att	Percent of taxa attributed with reference/non-reference indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_S_prop.spp.IndicatorClass_NonRef_raw	Proportion non-reference indicator algae species (raw) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_S_prop.spp.IndicatorClass_NonRef_scr	Proportion non-reference indicator algae species (score) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_S_prop.spp.IndicatorClass_TP_high_pct_att	Percent of taxa attributed phosphorus indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_S_prop.spp.IndicatorClass_TP_high_raw	Proportion high total phosphorus indicator algae taxa (raw) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_S_prop.spp.IndicatorClass_TP_high_scr	Proportion high total phosphorus indicator Algal taxa (score) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_S_prop.spp.ZHR_pct_att	Proportion of taxa attributed for the Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa metric for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_S_prop.spp.ZHR_raw	Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (raw) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
ASCI_S_prop.spp.ZHR_scr	Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (score) for the Soft-bodied Algal Stream Condition Index	0	Bioassessment						All			2021-01-28
Ash Free Dry Mass	Ash-Free Dry Mass (AFDM, AFDW)	0	Inorganics	Conventionals	Benthic				All	Constituents		2011-11-10
Asphalt Fragment	Asphalt Fragment	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Aspon	Aspon	3244904	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
AssemblageIDAlgaeSampleVolume	Volume of material and liquid to produce the soft algae assemblage (taxonomy) sample	0	Habitat						All			2009-10-29
AssemblageIDDiatomSampleVolume	Volume of material and liquid to produce the diatom assemblage (taxonomy) sample	0	Habitat						All			2009-10-29
Atenolol	Atenolol	29122687	Organics	PPCPs								2010-04-26
Atenolol-d7(Surrogate)	Surrogate: Atenolol-d7	0	Organics	PPCPs								2016-03-02
Atorvastatin	Atorvastatin	134523005	Organics	PPCPs								2010-04-26
Atraton	Atraton	1610179	Organics	Pesticides	Pest-Triazines	Herbicides			All			2007-07-27
Atrazine	Atrazine	1912249	Organics	Pesticides	Pest-Triazines	Herbicides	Endocrine Disruptors		All			2007-07-27
Atrazine dealkylated	Atrazine dealkylated	0	Organics	Pesticides								2017-04-10
Atrazine-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Atrazine-13C3	0	Organics	Pest-Triazines	IDA				All			2023-10-03
Atrazine-13C3(Surrogate)	Surrogate: Atrazine-13C3	0	Organics	Pesticides	Pest-Triazines				All			2016-03-02
Atrazine-d5(Surrogate)	Surrogate: Atrazine-d5	163165751	Organics	Pesticides	Pest-Triazines	Herbicides	Endocrine Disruptors		All			2016-03-02
Atrazine-Desisopropyl-2-Hydroxy	Atrazine-Desisopropyl-2-Hydroxy	7313544	Organics	Omega Fatty Acid					All			2012-09-12
ATVs Extent	ATVs Extent	0	Habitat						All			2019-05-07
ATVs Intensity	ATVs Intensity	0	Habitat						All			2019-05-07
ATVs Proximity	ATVs Proximity	0	Habitat						All			2019-05-07
Autopart	Autopart	0	Debris	Trash	Non-Plastics	Metals			All			2014-11-04
Avoidance	Avoidance (%)	0	Toxicity						All			2007-07-27
Azinphos Ethyl	Azinphos Ethyl	2642719	Organics	Pesticides	Pest-OPs	Insecticides			All			2013-05-28
Azinphos Methyl	Azinphos Methyl (Guthion)	86500	Organics	Pesticides	Pest-OPs	Insecticides			All			2013-05-28
Azinphos Methyl oxon	Azinphos Methyl oxon	0	Organics	Pesticides								2018-03-04
Azinphos Methyl(Surrogate)	Surrogate: Azinphos Methyl	0	Organics	Pesticides	OrganophosphatePest.	Insecticides						2016-03-02
Azinphos-methyl oxygen analog	Azinphos-methyl oxygen analog	0	Organics	Pesticides								2017-04-10
Azinphos-Methyl-d6(IsoDilAnalogue)	Isotope Dilution Analogue: Azinphos-Methyl-d6	0	Organics	Pest-OPs	IDA				All			2023-10-27
Azithromycin	Azithromycin	83905015	Organics	PPCPs								2010-04-26
Azobenzene	Azobenzene (Diphenyl Diimide)	103333	Organics	SVOCs								2014-01-29
Azoxystrobin	Azoxystrobin	131860338	Pesticides	Fungicides								2012-06-21
Back Water	Back Water present	0	Habitat						All			2009-08-20
Backscatter	Backscatter - CTD casts	0	WaterQualityMeasurements	Ancillary								2014-02-05
Bacteriophage MS2	Bacteriophage MS2	0	Microbiological	Pathogens								2020-09-03
Bacteroidales, Avian (LeeSeaGull)	Avian Bacteroidales, Assay name: LeeSeaGull, 5’ AGGTGCTAATACCGCATAATACAGAG 3’, 5’ GCCGTTACCTCACCGTCTA 3’	0	Microbiological	MST					All			2025-09-02
Bacteroidales, Canine (BacCan)	Canine Bacteroidales, Assay name: BacCan, 5' GGAGCGCAGACGGGTTTT 3', 5' CAATCGGAGTTCTTCGTGATATCTA 3'	0	Microbiological	MST								2025-01-10
Bacteroidales, Canine (DG3)	Canine Bacteroidales, Assay name: DG3, 5' TTTTCAGCCCCGTTGTTTCG 3' , 5' TGAGCGGGCATGGTCATATT 3'	0	Microbiological	MST								2026-01-21
Bacteroidales, Canine (DogBact)	Canine Bacteroidales, Assay Name: DogBact	0										2021-12-17
Bacteroidales, Cow (BacCow)	Cow Bacteroidales, Assay name: BacCow, 5' CCAACYTTCCCGWTACTC 3', 5' GGACCGTGTCTCAGTTCCAGTG 3'	0	Microbiological	MST								2025-01-10
Bacteroidales, Cow (CowM2)	Cow Bacteroidales, Assay name: CowM2, 5' CGGCCAAATACTCCTGATCGT 3', 5' GCTTGTTGCGTTCCTTGAGATAAT 3'	0	Microbiological	MST								2025-01-10
Bacteroidales, Horse (HoF597F)	Horse Bacteroidales, Assay name: HoF597F, 5' CCAGCCGTAAAATAGTCGG 3', 5' CAATCGGAGTTCTTCGTG 3'	0	Microbiological	MST								2025-01-10
Bacteroidales, Human (BacH)	Human Bacteroidales Marker BacH	0										2021-10-18
Bacteroidales, Human (HF183/BacR287)	Human Bacteroidales, Assay name: HF183/BacR287, 5'-ATCATGAGTTCACATGTCCG-3', 5'-CTTCCTCTCAGAACCCCTATCC-3'	0	Microbiological									2023-01-27
Bacteroidales, Human (HF183/BFDrev)	Human Bacteroidales, Assay name: HF183/BFDrev, 5' ATCATGAGTTCACATGTCCG 3', 5' CGTAGGAGTTTGGACCGTGT 3'	0										2022-09-14
Bacteroidales, Human (HF183TMCaMan)	Human Bacteroidales, Assay name: HF183TMCaMan, 5’ ATCATGAGTTCACATGTCCG 3’, 5’ CTTCCTCTCAGAACCCCTATCC 3’	0	Microbiological									2022-08-19
Bacteroidales, Human (HumM2)	Human Bacteroidales, Assay name: HumM2, 5'-CGTCAGGTTTGTTTCGGTATTG-3', 5'-TCATCACGTAACTTATTTATATGCATTAGC-3'	0	Microbiological									2023-01-27
Bacteroidales, Porcine (Pig2Bac)	Porcine Bacteroidales, Assay name: Pig2Bac	0	Microbiological									2022-02-11
Bacteroidales, Ruminant (Rum2Bac)	Ruminant Bacteroidales, Asssay name: Rum2Bac, 5' ACAGCCCGCGATTGATACTGGTAA 3', 5' CAATCGGAGTTCTTCGTGAT 3'	0	Microbiological	MST								2025-01-10
Bacteroidales, Universal (UniB)	Universal Bacteroidales, Assay name: UniB, 5' GGGGTTCTGAGAGGAAGGT 3', 5' CCGTCATCCTTCACGCTACT 3'	0	Microbiological	Pathogens	Conventional							2024-10-01
Bag, Large/Retail	Bag, Large/Retail	0	Debris	Trash	Plastics	Bags/Packaging			All			2014-11-04
Bag, Pet Waste	Bag, Pet Waste	0	Debris	Trash	Plastics	Bags/Packaging			All			2014-11-04
Bag, Single Use Plastic	Bag, Single Use Plastic	0	Debris	Trash	Plastics	Bags/Packaging			All			2014-11-04
Bag, Takeout	Bag, Takeout	0	Debris	Trash	Plastics	Bags/Packaging			All			2014-11-04
Bags/Packaging	Bags/Packaging	0	Debris	Trash	Plastics				All			2014-11-05
Balloon, Latex	Balloon, Latex	0	Debris	Trash	Plastics	Miscellaneous			All			2014-11-04
Balloon, Mylar	Balloon, Mylar	0	Debris	Trash	Plastics	Miscellaneous			All			2014-11-04
Bandage/Bandaid	Bandage/Bandaid	0	Debris	Trash	Plastics	Miscellaneous			All			2014-11-04
Bank Angle	Bank Angle	0	Habitat						All			2009-08-20
Bank Cover	Bank Cover	0	Habitat						All			2012-05-22
Bank Stability	Bank Stability (score zone 5m up and 5m downstream of transect between bankfull - wetted width)	0	Habitat						All			2009-08-20
Bankfull Height	Bankfull Height	0	Habitat						All			2009-08-20
Bankfull Width	Bankfull Width	0	Habitat						All			2009-08-20
Bankfull Width Reach	Visual estimate of the average bankfull width of the reach	0	Habitat						All			2009-08-20
Bar Present	Bar Present	0	Habitat						All			2009-08-20
Bar Width	Bar Width	0	Habitat						All			2009-08-20
Barban	Barban	101279	Organics	Pesticides	Pest-Carbamates	Herbicides			All			2007-07-27
Barban(Surrogate)	Surrogate: Barban	101279	Organics	Pesticides	Pest-Carbamates							2016-03-02
Barium	Barium	7440393	Inorganics	Metals					All			2007-07-27
Barometric Pressure	Barometric Pressure	0	Habitat									2011-11-01
Batteries, Large	Batteries, Large	0	Debris	Trash	Non-Plastics	Toxic			All			2014-11-04
Batteries, Small	Batteries, Small	0	Debris	Trash	Non-Plastics	Toxic			All			2014-11-04
Battery Voltage	Battery Voltage	0	FieldMeasure						All			2012-04-23
Bearing	Bearing	0	Habitat						All			2009-08-20
BeaufortScale	BeaufortScale	0	FieldObservations	Habitat					All			2009-08-20
Beaver Flow Modifications	Beaver Flow Modifications	0	Habitat						All			2009-08-20
Beaver Signs	Beaver Signs	0	Habitat						All			2009-08-20
Bendiocarb	Bendiocarb	22781233	Organics	Pesticides	Pest-Carbamates							2013-05-20
Bendroflumethiazide	Bendroflumethiazide	73483										2021-05-07
Benfluralin	Benfluralin	1861401	Organics	Pesticides	Herbicides							2016-03-10
Benomyl	Benomyl	17804352	Organics	Pesticides	Pest-Carbamates	Endocrine Disruptors	Fungicides	Nematocides	All			2007-07-27
Benomyl/Carbendazim	Benomyl/Carbendazim	0	Organics	Pesticides								2016-04-26
Bensulfuron Methyl	Bensulfuron Methyl	83055996	Organics	Pesticides	Pest-Carbamates							2013-05-20
Bensulide	Bensulide	741582	Organics	Herbicides								2016-05-20
Bentazon	Bentazon	25057890	Organics	Pesticides								2016-05-20
Benz(a)anthracene	Benz(a)anthracene	56553	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2007-07-27
Benz(a)anthracene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benz(a)anthracene-d12	1718532	Organics	PAH	IDA							2023-11-14
Benz(a)anthracene-d12(Surrogate)	Surrogate: Benz(a)anthracene-d12	1718532	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2016-03-02
Benz(a)anthracene-d12/Chrysene-d12(Surrogate)	Surrogate: Benz(a)anthracene-d12/Chrysene-d12	0	Organics	PAHs								2014-01-28
Benz(a)anthracenes/Chrysenes, C1-	C1-Benz(a)anthracenes/Chrysenes	0	Organics	PAHs								2014-01-28
Benz(a)anthracenes/Chrysenes, C2-	C2-Benz(a)anthracenes/Chrysenes	0	Organics	PAHs								2014-01-28
Benz(a)anthracenes/Chrysenes, C3-	C3-Benz(a)anthracenes/Chrysenes	0	Organics	PAHs								2014-01-28
Benz(a)anthracenes/Chrysenes, C4-	C4-Benz(a)anthracenes/Chrysenes	0	Organics	PAHs								2014-01-28
Benz(e)pyrene-d12(Surrogate)	Surrogate: Benz(e)pyrene-d12	205440820	Organics	PAHs	Semi-VOAs				All			2016-03-02
Benzaldehyde	Benzaldehyde	100527	Organics	VOCs								2014-01-29
Benzene	Benzene	71432	Organics	VOCs	MTBE_BTEX				All			2007-07-27
Benzidine	Benzidine	92875	Organics	SVOCs								2014-01-29
Benzo [a] Pyrene equivalents	Benzo [a] Pyrene equivalents	0	Organics	PAHs	SVOCs				All			2007-07-27
Benzo(a)fluoranthene	Benzo(a)fluoranthene	203338	Organics	PAHs	SVOCs				All			2012-05-22
Benzo(a)pyrene	Benzo(a)pyrene	50328	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2007-07-27
Benzo(a)pyrene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(a)pyrene-d12	63466717	Organics	PAHs	IDA							2023-11-14
Benzo(a)pyrene-d12(Surrogate)	Surrogate: Benzo(a)pyrene-d12	63466717	Organics	PAHs								2025-08-25
Benzo(b)fluoranthene	Benzo(b)fluoranthene	205992	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2007-07-27
Benzo(b)fluoranthene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(b)fluoranthene-d12	93951985	Organics	PAHs	IDA							2023-11-07
Benzo(b)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12	93951985	Organics	PAHs								2016-03-02
Benzo(b)fluorene, 11H-	11H-Benzo(b)fluorene	243174										2019-04-23
Benzo(b/j/k)fluoranthene	Benzo(b)fluoranthene/Benzo(j)fluoranthene/Benzo(k)fluoranthene	0	Organics	PAHs	Semi-VOAs	HMW_PAH	Endocrine Disruptors		All			2013-05-28
Benzo(b/j/k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12/Benzo(j)fluoranthene-d12/Benzo(k)fluoranthene-d12	0	Organics	PAHs								2013-05-28
Benzo(b/k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12/Benzo(k)fluoranthene-d12	0	Organics	PAHs								2013-05-28
Benzo(e)pyrene	Benzo(e)pyrene	192972	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2007-07-27
Benzo(e)pyrene-d12(Surrogate)	Surrogate: Benzo(e)pyrene-d12	205440820	Organics	PAHs	SVOCs				All			2016-03-02
Benzo(g,h,i)perylene	Benzo(g,h,i)perylene	191242	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2007-07-27
Benzo(g,h,i)perylene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(g,h,i)perylene-d12	93951667	Organics	PAHs	IDA							2023-11-07
Benzo(g,h,i)perylene-d12(Surrogate)	Surrogate: Benzo(g,h,i)perylene-d12	93951667	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2016-03-02
Benzo(j)fluoranthene	Benzo(j)fluoranthene	0	Organics	PAHs								2008-11-07
Benzo(j/k)fluoranthene	Benzo(j)fluoranthene/Benzo(k)fluoranthene	0	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2013-04-10
Benzo(j/k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(j)fluoranthene-d12/Benzo(k)fluoranthene-d12	0	Organics	PAHs								2014-01-28
Benzo(k)fluoranthene	Benzo(k)fluoranthene	207089	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2007-07-27
Benzo(k)fluoranthene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(k)fluoranthene-d12	93952013	Organics	PAHs	IDA							2023-11-14
Benzo(k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(k)fluoranthene-d12	0	Organics	PAHs								2014-01-28
Benzobicyclon	Benzobicyclon pesticide	156963665										2017-12-12
Benzofluoranthenes/Benzopyrenes, C1-	C1-Benzofluoranthenes/Benzopyrenes	0	Organics	PAHs	Alkylated PAHs							2018-07-24
Benzofluoranthenes/Benzopyrenes, C2-	C2-Benzofluoranthenes/Benzopyrenes	0	Organics	PAHs	Alkylated PAHs							2018-07-24
Benzoic Acid	Benzoic Acid	0	Organics	Herbicides								2016-05-20
Benzophenone	Benzophenone	119619	Organics									2018-07-16
Benzothiazole, 2-(4-Morpholinyl)	2-(4-Morpholinyl)Benzothiazole (2,4-MoBT)	4225267	Organics	Benzotriazoles and Benzothiazoles								2026-02-10
Benzothiazolone	Benzothiazolone (2-Benzothiazolinone) (2-Hydroxy-Benzothiazole)	934349	Organics	Benzotriazoles and Benzothiazoles								2026-02-10
Benzothiophene	Benzothiophene	95158	Organics	PAHs					All			2014-01-28
Benzothiophene, C1-	C1-Benzothiophene	0	Organics	PAHs					All			2014-01-28
Benzothiophene, C2-	C2-Benzothiophene	0	Organics	PAHs					All			2014-01-28
Benzothiophene, C3-	C3-Benzothiophene	0	Organics	PAHs					All			2014-01-28
Benzotriazole, 1H	1H-Benzotriazole	95147										2021-05-07
Benzovindiflupyr	Benzovindiflupyr	1072957711	Organics									2018-07-16
Benzoylecgonine	Benzoylecgonine	519095	Organics	PPCPs								2010-04-26
Benzoylecgonine-d8(Surrogate)	Surrogate: Benzoylecgonine-d8	0	Organics	PPCPs								2016-03-02
Benztropine	Benztropine	86135	Organics	PPCPs								2010-04-26
Benztropine-d3(Surrogate)	Surrogate: Benztropine-d3	0	Organics	PPCPs								2016-03-02
Benzyl Alcohol	Benzyl Alcohol	0	Organics	VOCs								2016-05-20
Beryllium	Beryllium	7440417	Inorganics	Metals					All			2007-07-27
Betamethasone	Betamethasone	378449	Organics	PPCPs								2010-04-26
Bezafibrate	Bezafibrate	41859670										2021-05-07
Bicarbonate	Bicarbonate	71523	Inorganics	Conventionals					All	Constituents		2012-09-13
Bicarbonate Alkalinity as CaCO3	Bicarbonate Alkalinity as CaCO3	471341	Inorganics	Conventionals	WaterQualityMeasurements							1900-01-01
Bifenox	Bifenox	42576023	Organics	Pesticides	Herbicides							2016-10-25
Bifenthrin	Bifenthrin	82657043	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Bifenthrin, Total(Surrogate)	Surrogate: Total Bifenthrin	0										2022-06-07
Bifenthrin-d5(Surrogate)	Surrogate: Bifenthrin-d5 ((rac-cis)-Z-Bifenthrin-d5)	2714484156	Organics	Pesticides	Pyrethroids	Insecticides						2026-05-08
Bifenthrin-d6(Surrogate)	Surrogate: Bifenthrin-d6	0	SVOC	Pesticides								2023-08-17
Biodegradable	Biodegradeable using Trash Protocol	0	Trash						All			2011-05-04
Biodegradable, Other	Biodegradable, Other	0	Debris	Natural	Non-Plastics	Biodegradable			All			2014-11-04
Biohazard	Biohazard using Trash Protocol	0	Trash						All			2011-05-04
Bioluminescence (EC50)	Bioluminescence (EC50)	0	Toxicity						All			2007-07-27
Biomass (wt/orig indiv)	Biomass (weight/original individual)	0	Toxicity						All			2007-07-27
BiomassSampleVolume	Volume of material and liquid filtered to produce the biomass (Ash Free Dry Mass-AFDM) sample	0	Habitat						All			2009-10-29
Biphenyl	Biphenyl	92524	Organics	PAHs	SVOCs	LMW_PAH			All			2007-07-27
Biphenyl-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Biphenyl-d10	1486017	Organics	PAHs	IDA							2023-11-07
Biphenyl-d10(Surrogate)	Surrogate: Biphenyl-d10	1486017	Organics	PAHs	SVOCs				All			2007-07-27
Biphenyls, C1-	C1-Biphenyls	0	Organics	PAHs	LMW_PAH							2018-07-24
Biphenyls, C2-	C2-Biphenyls	0	Organics	PAHs	LMW_PAH							2018-07-24
Bis(1,3-dichloro-2-propyl) phosphate	Bis(1,3-dichloro-2-propyl) phosphate (BDCPP)	72236727	Organics	FlameRetardants					All			2014-03-13
Bis(1H,1H,2H,2H-Perfluorodecyl) Phosphate-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Bis(1H,1H,2H,2H-Perfluorodecyl) Phosphate-13C4 (8:2 diPAP-13C4)	0	Organics	PFAS	IDA							2026-02-10
Bis(1H,1H,2H,2H-perfluorodecyl)phosphate	Bis(1H,1H,2H,2H-perfluorodecyl)phosphate (8:2 diPAP)	0	Organics	PFAS	PFC Precursor							2014-10-20
Bis(1H,1H,2H,2H-perfluorodecyl)phosphate-13C4(Surrogate)	Surrogate: Bis(1H,1H,2H,2H-perfluorodecyl)phosphate-13C4	0	Organics	PFAS	PFC Precursor							2014-10-30
Bis(1H,1H,2H,2H-Perfluorooctyl) Phosphate-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Bis(1H,1H,2H,2H-Perfluorooctyl) Phosphate-13C4 (6:2 diPAP-13C4)	2179232143	Organics	PFAS	IDA							2026-02-10
Bis(1H,1H,2H,2H-perfluorooctyl)phosphate	Bis(1H,1H,2H,2H-perfluorooctyl)phosphate (6:2 diPAP)	0	Organics	PFAS	PFC Precursor							2014-10-20
Bis(1H,1H,2H,2H-perfluorooctyl)phosphate-13C4(Surrogate)	Surrogate: Bis(1H,1H,2H,2H-perfluorooctyl)phosphate-13C4	0	Organics	PFAS	PFC Precursor							2014-11-03
Bis(2,4,6-tribromophenoxy)ethane-1,2	1,2-bis(2,4,6-tribromophenoxy)ethane (BTBPE)	37853591	Organics	FlameRetardants					All			2024-11-07
Bis(2,4,6-tribromophenoxy)ethane-1,2-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2-bis(2,4,6-tribromophenoxy)ethane-13C12 (BTBPE-13C12)	0	Organics	FlameRetardants	IDA							2024-10-31
Bis(2,4-Diisopropylphenyl) Phenyl Phosphate	Bis(2,4-Diisopropylphenyl) Phenyl Phosphate (B24DiPPP)	2190501290	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Bis(2-chloro-1-methylethyl) ether	Bis(2-chloro-1-methylethyl) ether	0	Organics	SVOCs								2014-01-29
Bis(2-chloroethoxy)methane	Bis(2-chloroethoxy)methane	111911	Organics	SVOCs					All			2007-07-27
Bis(2-chloroethyl) phosphate	Bis(2-chloroethyl) phosphate (BCEP)	0	Organics	FlameRetardants					All			2014-03-13
Bis(2-chloroethyl)ether	Bis(2-chloroethyl)ether	111444	Organics	SVOCs					All			2007-07-27
Bis(2-chloroisopropyl) ether	Bis(2-chloroisopropyl) ether	39638329	Organics	SVOCs					All			2016-08-26
Bis(2-chloroisopropyl) phosphate	Bis(2-chloroisopropyl) phosphate (BCPP)	0	Organics	FlameRetardants					All			2014-03-13
Bis(2-ethly-1-hexyl)tetrabromophthalate	Bis(2-ethly-1-hexyl)tetrabromophthalate (BEHTBP)	26040517	Organics	FlameRetardants					All			2014-03-13
Bis(2-ethylhexyl)adipate	Bis(2-ethylhexyl)adipate	103231	Organics	SVOCs								2016-05-20
Bis(2-ethylhexyl)phthalate	Bis(2-ethylhexyl)phthalate	117817	Organics	SVOCs	Endocrine Disruptors				All			2024-03-01
Bis(2-ethylhexyl)phthalate-d4(Surrogate)	Surrogate: Bis(2-ethylhexyl)phthalate-d4	0	Organics	SVOCs								2014-01-29
Bis(2-ethylhexyl)tetrabromophthalate	Bis(2-ethylhexyl)tetrabromophthalate	26040517	Organics	FlameRetardants								2010-01-04
Bis(2-Isopropylphenyl) Phenyl Phosphate	Bis(2-Isopropylphenyl) Phenyl Phosphate (B2IPPP)	69500294	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Bis(2-tert-Butylphenyl) Phenyl Phosphate	Bis(2-tert-Butylphenyl) Phenyl Phosphate (B2tBPPP)	261948883	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Bis(4-Isopropylphenyl) Phenyl Phosphate	Bis(4-Isopropylphenyl) Phenyl Phosphate (B4IPPP)	55864078	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Bis(4-tert-Butylphenyl) Phenyl Phosphate	Bis(4-tert-Butylphenyl) Phenyl Phosphate (B4tBPPP)	115877	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Bis(alpha,alpha-Dimethylbenzyl)Diphenylamine, 4,4-	4,4-Bis(alpha,alpha-Dimethylbenzyl)Diphenylamine (SDPA-diAMS)	10081671	Organics	Substituted Diphenylamines (SDPAs)								2026-02-10
Bis(chloromethyl) Ether	Bis(chloromethyl) Ether (Dichlorodimethyl Ether)	542881	Organics	VOCs					All			2025-01-21
Bis(Chloromethyl)Propane-1,3-Diyltetrakis(2-Chloroethyl) Bisphosphate-d16, 2,2-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,2-bis(Chloromethyl)Propane-1,3-Diyltetrakis(2-Chloroethyl) Bisphosphate-d16 (V6-d16)	0	Organics	FlameRetardants	PhosphateFlameRetardants	IDA						2026-02-10
Bis(perfluorohexyl)phosphinate	Bis(perfluorohexyl)phosphinate (6:6 PFPi)	0	Organics	PFAS	PFC Precursor							2014-10-20
Bis(perfluorohexyl)phosphinate-d5(Surrogate)	Surrogate: Bis(perfluorohexyl)phosphinate-d5	0	Organics	PFAS								2014-10-02
Bis(perfluorooctyl)phosphinate	Bis(perfluorooctyl)phosphinate (8:8 PFPi)	0	Organics	PFAS	PFC Precursor							2014-10-20
Bis(perfluorooctyl)phosphinate-d3(Surrogate)	Surrogate: Bis(perfluorooctyl)phosphinate-d3	0	Organics	PFAS								2014-10-02
Bismuth	Bismuth	7440699	Inorganics									2013-05-20
Bisphenol A	Bisphenol A	80057	Organics	PPCPs								2010-04-26
Bisphenol A bis(diphenyl phosphate)	Bisphenol A bis(diphenyl phosphate)	5945335	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol A diglycidyl ether	Bisphenol A diglycidyl ether (BPA-DGE)	16755423	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol A-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol A-13C12	263261650	Organics	PPCPs	Bisphenols							2026-05-27
Bisphenol A-13C12(Surrogate)	Surrogate: Bisphenol A-13C12	263261650	Organics	PPCPs	Bisphenols							2025-06-30
Bisphenol A-d14(Surrogate)	Surrogate: Bisphenol A-d14	0	Organics	PPCPs	Bisphenols							2018-04-18
Bisphenol A-d16(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol A-d16	96210876	Organics									2022-07-22
Bisphenol A-d16(Surrogate)	Surrogate: Bisphenol A-d16	96210876	Organics	PPCPs	Bisphenols							2026-06-12
Bisphenol A-d6(Surrogate)	Surrogate: Bisphenol A-d6	0	Organics	PPCPs								2016-03-02
Bisphenol AF	Bisphenol AF	1478611	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol AF-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol AF-13C12	0	Organics	PPCPs	Bisphenols							2026-05-27
Bisphenol AF-13C12(Surrogate)	Surrogate: Bisphenol AF-13C12	0	Organics	PPCPs	Bisphenols							2025-06-30
Bisphenol AP	Bisphenol AP	1571751	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol B	Bisphenol B	77407	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol B-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol B-13C12	0	Organics	PPCPs	Bisphenols							2026-05-27
Bisphenol B-13C12(Surrogate)	Surrogate: Bisphenol B-13C12	0	Organics	PPCPs	Bisphenols							2025-06-30
Bisphenol BP	Bisphenol BP	1844015	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol C	Bisphenol C	79970	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol C-dichloride	Bisphenol C-dichloride	14868032	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol E	Bisphenol E	2081085	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol F	Bisphenol F	620928	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol F-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol F-13C12	0	Organics	PPCPs	Bisphenols							2026-05-27
Bisphenol F-13C12(Surrogate)	Surrogate: Bisphenol F-13C12	0	Organics	PPCPs	Bisphenols							2025-06-30
Bisphenol G	Bisphenol G	127548	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol M	Bisphenol M	13595250	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol P	Bisphenol P	2167513	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol PH	Bisphenol PH	24038684	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol S	Bisphenol S	80091	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol S-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol S-13C12	0	Organics	PPCPs	Bisphenols							2026-05-27
Bisphenol S-13C12(Surrogate)	Surrogate: Bisphenol S-13C12	0	Organics	PPCPs	Bisphenols							2025-06-30
Bisphenol TMC	Bisphenol TMC	129188994	Organics	PPCPs	Bisphenols							2017-09-19
Bisphenol Z	Bisphenol Z	843550	Organics	PPCPs	Bisphenols							2017-09-19
Bispyribac Sodium	Bispyribac Sodium	125401925	Organics	Pesticides	Herbicides							2016-10-25
Bivalve CI Mean	Bivalve Condition Index Mean	0	Organics	Inorganics	Metals	Conventionals	Semi-VOAs	VOAs	All			2012-10-30
Bivalve CI SE	Bivalve Condition Index Standard Error	0	Organics	Inorganics	Metals	Conventionals	Semi-VOAs	VOAs	All			2012-10-30
Blue-Green Algae Phycocyanin	Blue-Green Algae Phycocyanin (BGA-PC)	0	WaterQualityMeasurements						All			2014-05-07
BOD	Biochemical Oxygen Demand (BOD) - 5 day test	0	Inorganics	Conventionals					All			2007-07-27
BOD10day	Biochemical Oxygen Demand (BOD) - 10 day test	0	Inorganics	Conventionals					All			2007-07-27
Bolstar	Bolstar (Sulprofos)	35400432	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Boron	Boron	7440428	Inorganics	Conventionals	Metals	Metalloids			All			2007-07-27
Boscalid	Boscalid	188425856	Organics	Fungicides								2016-05-20
Boscalid-5-hydroxy	5-Hydroxy-Boscalid	661463872	Organics						All			2022-12-22
Bottle Cap, Metal	Bottle Cap, Metal	0	Debris	Trash	Non-Plastics	Metals			All			2014-11-04
Bottle Cap, Plastic	Bottle Cap, Plastic	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
Bottle, Beach	Bottle, Beach	0	Debris	Trash	Plastics	Toxic			All			2014-11-04
Bottle, Cleaning	Bottle, Cleaning	0	Debris	Trash	Plastics	Toxic			All			2014-11-04
Bottle, Glass	Bottle, Glass	0	Debris	Trash	Non-Plastics	Household			All			2014-11-04
Bottle, Plastic	Bottle, Plastic Beverage	0	Debris	Trash	Plastics							2022-11-02
Bottle, Shampoo	Bottle, Shampoo	0	Debris	Trash	Plastics	Household			All			2014-11-04
Bottle, Soda	Bottle, Soda	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
Bottle, Sport	Bottle, Sport	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
Bottle, Water	Bottle, Water	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
Boulder	Boulder	0	Inorganics	Conventionals	GrainSize				All			2011-09-08
BRI	Score for the Benthic Response Index (BRI)	0	Sediment Quality Objectives	Index/Metric								2022-03-18
Brick	Brick	0	Debris	Trash	Non-Plastics	Construction			All			2014-11-04
Bridge	Bridge	0	Habitat	Debris					All			2014-11-04
Bridge Fence	Bridge Fence	0	Habitat	Debris					All			2014-11-04
Bridge Fence Height	Bridge Fence Height	0	Habitat	Debris					All			2014-11-04
Bridges, Culverts	Bridges, Culverts	0	Habitat						All			2009-08-20
Broflanilide	Broflanilide	1207727045	Organics	PFAS					All			2022-11-03
Bromacil	Bromacil	314409	Organics	Pesticides	Pest-Carbamates	Herbicides			All			2007-07-27
Bromate	Bromate	15541454	Inorganics	Conventionals	Nutrients				All			2013-05-28
Bromide	Bromide	24959679	Inorganics	Conventionals	Nutrients				All			2013-05-28
Bromo-2-Nitrobenzene, 1-	1-Bromo-2-Nitrobenzene	577195	Organics	VOCs								2019-07-09
Bromo-2-Nitrobenzene, 1-(Surrogate)	Surrogate: 1-Bromo-2-Nitrobenzene	0	Organics	VOCs								2019-07-24
Bromo-3,5-dimethylphenyl-N-methylcarbamate, 4-(Surrogate)	Surrogate: 4-Bromo-3,5-dimethylphenyl-N-methylcarbamate (BDMC)	672991	Organics	OrganochlorinePesticides								2016-03-02
Bromoacetic Acid	Bromoacetic Acid (Monobromoacetic Acid)(MBAA)	79083	Organics	Haloacetic acids (HAAs)								2025-11-05
Bromobenzene	Bromobenzene (Phenyl Bromide)	108861	Organics	VOCs					All			2013-05-28
Bromochloromethane	Bromochloromethane	74975	Organics	VOCs					All			2007-07-27
Bromodichloromethane	Bromodichloromethane (Dichlorobromomethane)	75274	Organics	VOCs					All			2011-05-03
Bromofluorobenzene, 4-	4-Bromofluorobenzene	460004	Organics	VOCs								2016-05-20
Bromofluorobenzene, 4-(Surrogate)	Surrogate: 4-Bromofluorobenzene	460004	Organics	VOCs					All			2016-03-02
Bromoform	Bromoform (Tribromomethane)	75252	Organics	VOCs					All			2007-07-27
Bromomethane	Bromomethane (Methyl Bromide)	74839	Organics	VOCs					All			2013-05-28
Bromophenyl Phenyl Ether, 4-	4-Bromophenyl Phenyl Ether	101553	Organics	SVOCs					All			2013-05-28
Bromophenyl Phenyl Ether, 4-(Surrogate)	Surrogate: 4-Bromophenyl Phenyl Ether	0	Organics	SVOCs								2016-05-20
Bromuconazole	Bromuconazole (Bromoconazole)	116255482	Organics	Pesticides	Fungicides							2023-02-02
Bufencarb	Bufencarb	0	Organics	Pesticides	Insecticides							2017-04-04
Bulk Density	Bulk Density	0	WaterQualityMeasurements	Ancillary								2014-02-05
Bumetrizole	Bumetrizole (UV-326) (2-tert-butyl-6-(5-Chloro-2H-1,2,3-Benzotriazol-2-yl)-4-Methylphenol)	3896115	Organics	Benzotriazoles and Benzothiazoles								2026-02-10
Burial	Burial	0	Toxicity						All			2007-07-27
Burns Extent	Burns Extent	0	Habitat						All			2019-05-07
Burns Intensity	Burns Intensity	0	Habitat						All			2019-05-07
Burns Proximity	Burns Proximity	0	Habitat						All			2019-05-07
Butachlor	Butachlor	23184669	Organics	Herbicides					All			2007-07-27
Butalbital	Butalbital	77269										2021-05-07
Butanone, 2-	2-Butanone (Methyl Ethyl Ketone)	78933	Organics	VOCs					All			2013-05-28
Butralin	Butralin	33629479	Organics	Pesticides	Herbicides							2016-03-10
Butyl Benzyl Phthalate	Butyl Benzyl Phthalate	85687	Organics	SVOCs	Endocrine Disruptors				All			2013-05-28
Butyl Benzyl Phthalate-d4(Surrogate)	Surrogate: Butyl Benzyl Phthalate-d4	0	Organics	SVOCs								2014-01-29
Butylate	Butylate	2008415	Organics	Pesticides	Pest-Carbamates				All			2007-07-27
Butylbenzene, n-	n-Butylbenzene	104518	Organics	VOCs					All			2007-07-27
Butylbenzene, sec-	sec-Butylbenzene	135988	Organics	VOCs					All			2007-07-27
Butylbenzene, tert-	tert-Butylbenzene	98066	Organics	VOCs					All			2007-07-27
Butylhydroxytoluene-d21(Surrogate)	Surrogate: Butylhydroxytoluene-d21 (BHT-d21)	64502994										2022-05-24
Butylparaben	Butylparaben	94268										2021-05-07
Butylphenyl Diphenyl Phosphate, 2-tert-	2-tert-Butylphenyl Diphenyl Phosphate (2TBPDPP)	83242233	Organics	PFAS								2026-02-10
Butylphenyl Diphenyl Phosphate, p-tert-	p-tert-Butylphenyl Diphenyl Phosphate (4-tert-Butylphenyl Diphenyl Phosphate) (4tBPDPP)	981408	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Butylphenyl Diphenyl Phosphate-d10, p-tert-(IsoDilAnalogue)	Isotope Dilution Analogue: p-tert-Butylphenyl Diphenyl Phosphate-d10 (4-tert-Butylphenyl Diphenyl Phosphate-d10) (4tBPDPP-d10)	0	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Butyltin as Sn	Butyltin as Sn	0	Organics	Organotins								2016-05-20
C. coli		0										2018-02-13
C. jejuni		0										2018-02-13
CA_LRM	Score for the California Logistic Regression Model (CA LRM)	0	Sediment Quality Objectives	Index/Metric								2022-03-18
Cadmium	Cadmium	7440439	Inorganics	TraceElements	Metals				All			2007-07-27
Caffeine	Caffeine	58082	Organics	PPCPs					All			2009-09-29
Caffeine-13C3(Surrogate)	Surrogate: Caffeine-13C3	0	Organics	PPCPs								2010-04-26
CAFOs Extent	CAFOs Extent	0	Habitat						All			2019-05-07
CAFOs Intensity	CAFOs Intensity	0	Habitat						All			2019-05-07
CAFOs Proximity	CAFOs Proximity	0	Habitat						All			2019-05-07
Calcium	Calcium	7440702	Inorganics	Conventionals	Metals				All	Constituents		2007-07-27
Calcium bis(methylarsonate)	Calcium bis(methylarsonate)	5902954	Organics	Pesticides								2017-04-20
Calcium Bound Phosphorus	Calcium Bound Phosphorus	0	Inorganics	Conventional	Nutrients							2022-03-01
Camphor	Camphor	76222	Organics									2018-07-16
Campylobacter	Campylobacter	0	Microbiological	Pathogens								2016-05-20
Canopy Cover	Canopy Cover	0	Habitat						All			2016-09-06
Caprolactam	Caprolactam (Azepan-2-one)	105602	Organics	PPCPs								2026-02-10
Captafol	Captafol	2425061	Organics	Pesticides	Fungicides							2016-10-25
Captan	Captan	133062	Organics	Pesticides	Pest-Carbamates	Insecticides			All			2007-07-27
Carbadox	Carbadox	6804075	Organics	PPCPs					All			2012-05-22
Carbamazepine	Carbamazepine	298464	Organics	PPCPs					All			2012-05-22
Carbamazepine(Surrogate)	Surrogate: Carbamazepine	0	Organics									2017-03-06
Carbamazepine-d10(Surrogate)	Surrogate: Carbamazepine-d10	0	Organics	PPCPs								2018-01-18
Carbaryl	Carbaryl	63252	Organics	Pesticides	Pest-Carbamates	Insecticides	Endocrine Disruptors		All			2007-07-27
Carbaryl-D7(Surrogate)	Surrogate: Carbaryl-D7	362049567	Organics	Pesticides	Pest-Carbamates	Insecticides			All			2024-07-22
Carbazole	Carbazole	86748	Organics	SVOCs					All			2007-07-27
Carbazole(Surrogate)	Surrogate: Carbazole	86748	Organics	Semi-VOAs								2011-10-13
Carbendazim	Carbendazim	10605217	Organics	Pesticides	Fungicides							2016-03-10
Carbofuran	Carbofuran	1563662	Organics	Pesticides	Pest-Carbamates	Insecticides	Nematocides		All			2007-07-27
Carbofuran Phenol	Carbofuran Phenol	0	Organics	Pesticides								2017-04-04
Carbon Dioxide, Daily Mean	Daily Mean Carbon Dioxide (Calculated)	124389	WaterQualityMeasurements	Conventionals					All			2024-09-06
Carbon dioxide, free	Carbon dioxide, free	124389										2017-04-28
Carbon Dioxide, total	Carbon Dioxide, total	124389										2017-04-28
Carbon Disulfide	Carbon Disulfide	0	Inorganics	Conventionals								2016-05-20
Carbon Tetrachloride	Carbon Tetrachloride	56235	Organics	VOCs					All			2013-05-28
Carbon, Total	Total Carbon	7440440	Inorganics	Conventionals								2013-05-20
Carbon-13	Carbon-13	14762744	Organics	Radiochemistry								2014-11-05
Carbon-13/Carbon-12 Ratio	Carbon-13/Carbon-12 Ratio	14762744	Radiochemistry									2013-06-03
Carbon-14	Carbon-14	14762755	Radiochemistry									2013-06-06
Carbon-14 Counting Error	Carbon-14 Counting Error	0	Inorganics									2013-06-06
Carbonate	Carbonate	3812326	Inorganics	Conventionals					All			2012-09-13
Carbonate Alkalinity as CaCO3	Carbonate Alkalinity as CaCO3	471341	Inorganics	Conventionals	WaterQualityMeasurements							1900-01-01
Carbophenothion	Carbophenothion (Trithion)	786196	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Carbophenothion-Methyl	Carbophenothion-Methyl	0	Organics	Pesticides	Insecticides							2017-04-04
Carboxin	Carboxin (6-methyl-N-phenyl-2,3-dihydro-1,4-oxathiine-5-carboxamide)	0										2017-01-12
Carfentrazone Ethyl	Carfentrazone Ethyl	128639021	Organics	Pesticides								2013-06-27
Carisoprodol	Carisoprodol	78444										2021-05-07
Cascade/Falls	Cascade/Falls	0	Habitat						All			2009-08-20
Catellicoccus, Gull (Gull2)	Gull Catellicoccus marimammalium, Assay name: Gull2, 5'-TGCATCGACCTAAAGTTTTGAG-3', 5'-GTCAAAGAGCGAGCAGTTACTA-3'	0	Microbiological									2023-01-27
Cattle Grazing Intensity	Cattle Grazing Intensity	0	Habitat						All			2019-05-07
Cattle GrazingExtent	Cattle GrazingExtent	0	Habitat						All			2019-05-07
Cattle GrazingProximity	Cattle GrazingProximity	0	Habitat						All			2019-05-07
CBOD5	Carbonaceous Biological Oxygen Demand (CBOD) - 5 day test	0	WaterQualityMeasurements	Conventionals								2018-01-18
CD/DVD	CD/DVD	0	Debris	Trash	Plastics	Household			All			2014-11-04
CDOM	Colored Dissolved Organic Matter	0	Habitat									2013-12-18
Cefotaxime	Cefotaxime	63527526	Organics	PPCPs								2010-04-26
Celestolide	Celestolide	0	Organics	Pesticides								2008-06-27
Cellulose Acetate Fiber	Cellulose acetate Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Cellulose Acetate Fiber Bundle	Cellulose acetate Fiber Bundle	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Cellulose Acetate Film	Cellulose acetate Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Cellulose Acetate Fragment	Cellulose acetate Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Cellulose Acetate Sphere	Cellulose acetate Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Cellulosic Fiber	Cellulosic Fiber	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Cellulosic Fiber Bundle	Cellulosic Fiber Bundle	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Cellulosic Film	Cellulosic Film	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Cellulosic Foam	Cellulosic Foam	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Cellulosic Fragment	Cellulosic Fragment	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Ceramic Pot/Shard	Ceramic Pot/Shard	0	Debris	Trash	Non-Plastics	Household			All			2014-11-04
Cerium	Cerium	7440451	Inorganics									2013-05-20
Cesium	Cesium	7440462	Inorganics	Metals								2009-08-05
Cetirizine	Cetirizine	83881510	Organics	PPCPs								2026-02-10
Chamber biomass	Chamber biomass	0	Toxicity						All			2007-07-27
Channel Constraining Feature	Channel Constraining Feature	0	Habitat						All			2009-08-20
Channel Constraint	Channel Constraint	0	Habitat						All			2009-08-20
Channel Engineered	Channel has been modified/engineered	0	Habitat	FieldObservations								2016-03-02
Channel Grasses	Channel Grasses	0	Habitat						All			2019-05-07
Channel Margin in Contact	Channel Margin in Contact	0	Habitat						All			2009-08-20
Channel NonWoody Veg	Channel NonWoody Veg	0	Habitat						All			2019-05-07
Channel Pattern	Channel Pattern	0	Habitat						All			2009-08-20
Channel Unit	Channel Unit	0	Habitat						All			2009-08-20
Channel Width Reach	Channel width used to define reach	0	Habitat						All			2009-10-29
Channel Woody Veg	Channel Woody Veg	0	Habitat						All			2019-05-07
Channelization	Channelization	0	Habitat						All			2009-08-20
Chemical Concentration	Chemical Concentration	0	Toxicity						All			2013-05-28
Chemical Group A	Total of (Aldrin,Dieldrin,Endrin,Heptachlor,Heptachlor Epoxide,Chlorine,HCH, Endosulfan,Toxaphene)	0	Organics	Pesticides								2014-01-28
Chemical Group B	Total of (1,2-Dichloropropane, 1,3-Dichloropropene and related C3 Compounds)	0	Organics	Pesticides								2017-04-20
Chemical Treatment	Chemical Treatment	0	Habitat						All			2009-08-20
Chicken/Duck, Mitochondrial DNA (cytb)	Chicken/Duck Mitochondrial DNA, Target gene: Cytochrome b, 5′-AAATCCCACCCCCTACTAAAAATAAT-3′, 5′-CAGATGAAGAAGAATGAGGCG-3′, 5′-FAM-ACAACTCCCTAATCGACCT-NFQ-MGB-3′	0	Microbiological	MST								2025-10-02
Chloramben	Chloramben	133904	Organics	Herbicides								2016-05-20
Chloramben, ammonium salt	Chloramben, ammonium salt	1076466	Organics	Pesticides								2017-04-10
Chloramphenicol	Chloramphenicol	56757										2021-05-07
Chlorantraniliprole	Chlorantraniliprole	500008457	Organics	Pesticides	Insecticides							2016-03-10
Chlorate	Chlorate	14866683	Inorganics	Conventionals	Nutrients				All			2013-05-28
Chlorbenside	Chlorbenside	0	Organics	Pesticides								2008-11-07
Chlordane	Chlordane, not otherwise specified	57749	Organics	Pesticides	Pest-OCHs				All			2007-12-14
Chlordane, cis-	cis-Chlordane (alpha-Chlordane)	5103719	Organics	Pesticides	Pest-OCHs	Insecticides	Chlordanes		All			2013-05-28
Chlordane, cis-(Surrogate)	Surrogate: cis-Chlordane (alpha-Chlordane)	5103719	Organics	Pesticides								2013-05-27
Chlordane, Technical	Chlordane, mixture of many related chemicals, of which 10 are major components	12789036	Organics	Pesticides	Pest-OCHs				All			2007-07-27
Chlordane, Total	Total Chlordane, sum of cis-chlordane and trans-chlordane	0										2019-06-11
Chlordane, trans-	trans-Chlordane (gamma-Chlordane)	5103742	Organics	Pesticides	Pest-OCHs	Insecticides	Chlordanes		All			2013-05-28
Chlordane, trans-(Surrogate)	Surrogate: trans-Chlordane (gamma-Chlordane)	0	Organics	Pesticides								2013-05-27
Chlordane-13C10, trans-(IsoDilAnalogue)	Isotope Dilution Analogue: trans-Chlordane-13C10 (gamma-Chlordane)	0	Organics	Pest-OCHs	IDA							2023-10-27
Chlordene	Chlordene	3734483	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			All			2007-07-27
Chlordene Plus	Chlordene Plus (CP)	0	Organics	FlameRetardants					All			2014-03-13
Chlordene, cis-	cis-Chlordene (alpha-Chlordene)	56534022	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			All			2013-05-28
Chlordene, trans-	trans-Chlordene (gamma-Chlordene)	56641384	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			All			2013-05-28
Chlorfenac	Chlorfenac (Fenac)	85347	Organics	Pesticides	Herbicides							2017-04-20
Chlorfenapyr	Chlorfenapyr	122453730	Organics	Pesticides								2016-10-25
Chlorfenvinphos	Chlorfenvinphos	470906	Organics	Pesticides	Pest-OPs				All			2007-07-27
Chloride	Chloride	16887006	Inorganics	Conventionals	Nutrients				All	Constituents		2007-07-27
Chlorimuron Ethyl	Chlorimuron Ethyl	90982324	Organics	SVOCs								2013-05-20
Chlorine, Free	Free Chlorine	0	WaterQualityMeasurements	Ancillary								2014-02-05
Chlorine, Total Residual	Total Residual Chlorine	0	WaterQualityMeasurements						All			2007-07-27
Chlorite	Chlorite	14998277	Inorganics	Conventionals	Nutrients				All			2013-05-28
Chlormefos	Chlormefos	0										2019-12-28
Chloro-2-methylphenol, 4-	4-Chloro-2-methylphenol	1570645	Organics	Pesticides								2017-04-20
Chloro-2-methylphenoxy) Butanoic Acid Sodium Salt, 4-(4-	4-(4-Chloro-2-methylphenoxy) Butanoic Acid sodium salt (MCPB, sodium salt)	6062266	Organics	Pesticides								2017-04-10
Chloro-2-methylphenoxy) Butanoic Acid, 4-(4-	4-(4-Chloro-2-methylphenoxy) Butanoic Acid (MCPB)	94815	Organics	SVOCs								2013-05-20
Chloro-3-methylphenol, 4-	4-Chloro-3-methylphenol	59507	Organics	SVOCs	Phenols	Chlorinated Phenols	Germicides		All			2007-07-27
Chloro-3-methylphenol, 4-(Surrogate)	Surrogate: 4-Chloro-3-methylphenol	0	Organics	SVOCs								2016-05-20
Chloro-4-isopropylamine-6-amino-s-triazine, 2-	2-Chloro-4-isopropylamine-6-amino-s-triazine (CIAT)	0	Organics	Pesticides								2017-04-04
Chloroacetic Acid	Chloroacetic Acid (Monochloracetic Acid)(MCAA)	79118	Organics	Haloacetic acids (HAAs)								2025-11-05
Chloroallyl alcohol, total	Total Chloroallyl alcohol	0	Organics	Pesticides								2017-04-10
Chloroaniline, 4-	4-Chloroaniline	106478	Organics	SVOCs					All			2007-07-27
Chlorobenzene	Chlorobenzene	108907	Organics	VOCs					All			2007-07-27
Chlorobenzene-d5(Surrogate)	Surrogate: Chlorobenzene-d5	3114554	Organics	VOCs					All			2016-03-02
Chlorobenzilate	Chlorobenzilate	510156	Organics	Pesticides								2016-10-25
Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid, 11-	11-Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid (11Cl-PF3OUdS)	763051929	Organics	PFAS								2025-04-04
Chloroethane	Chlorethane (Ethyl Chloride)	75003	Organics	VOCs					All			2013-05-28
Chloroethyl Vinyl Ether, 2	2-Chloroethyl Vinyl Ether	0	Organics	SVOCs								2016-05-20
Chloroethyl Vinyl Ether, 2-	2-Chloroethyl Vinyl Ether	110758	Organics	VOCs					All			2013-05-28
Chloroethyl Vinyl Ether, 2-(Surrogate)	Surrogate: 2-Chloroethyl Vinyl Ether	0	Organics	SVOCs								2016-05-20
Chloroform	Chloroform	67663	Organics	VOCs	Insecticides				All			2007-07-27
Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid, 9-	9-Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid (9Cl-PF3ONS)	756426581	Organics	PFAS								2025-04-04
Chloromethane	Chloromethane (Methyl Chloride)	74873	Organics	VOCs					All			2013-05-28
Chloro-N-(2,6-diethylphenyl) acetamide, 2-	2-chloro-N-(2,6-diethylphenyl) acetamide	6967299	Organics	Pesticides								2017-04-10
Chloro-N-(ethoxymethyl)-N-(2-ethyl-6-methylphenyl)acetamide, 2-	2-Chloro-N-(ethoxymethyl)-N-(2-ethyl-6-methylphenyl)acetamide (Acetochlor)	34256821	Organics	Pesticides	Herbicides							2017-04-04
Chloronaphthalene, 2-	2-Chloronaphthalene	91587	Organics	SVOCs					All			2007-07-27
Chloronaphthalene, 2-(Surrogate)	Surrogate: 2-Chloronaphthalene	0	Organics	SVOCs								2016-05-20
Chloroneb	Chloroneb	0	Organics	Pesticides	Fungicides							2017-04-04
Chloroneb(Surrogate)	Surrogate: Chloroneb	2675776	Organics	Pesticides	Pest-OCHs	Fungicides			All			2010-05-02
Chloronicotinic acid, 6-	6-Chloronicotinic acid	5326238	Organics	Pesticides	Insecticides	Neonics						2017-10-05
Chlorophenol, 2-	2-Chlorophenol	95578	Organics	SVOCs	Phenols	Chlorinated Phenols			All			2007-07-27
Chlorophenol, 2-(Surrogate)	Surrogate: 2-Chlorophenol	0	Organics	SVOCs								2016-05-20
Chlorophenol-d4, 2- (Surrogate)	2-Chlorophenol-d4 (Surrogate)	93951736										2017-01-12
Chlorophenyl Phenyl Ether, 4-	4-Chlorophenyl Phenyl Ether	7005723	Organics	SVOCs					All			2013-05-28
Chlorophenyl Phenyl Ether, 4-(Surrogate)	Surrogate: 4-Chlorophenyl Phenyl Ether	0	Organics	SVOCs								2016-05-20
Chlorophenyl)-N'-methylurea, N-(4-	N-(4-Chlorophenyl)-N'-methylurea	5352885	Organics	Herbicides								2013-05-20
Chlorophyll a	Chlorophyll a	479618	Inorganics	Conventionals	Benthic	WaterQualityMeasurements			All			2011-11-10
Chlorophyll a & b	Chlorophyll a & b	0	Inorganics	Conventionals					All			2016-05-20
Chlorophyll b	Chlorophyll b	0	Inorganics	Conventionals					All			2016-05-20
Chlorophyll c	Chlorophyll c	0	WaterQualityMeasurements									2018-01-16
Chlorophyll, Total	Total Chlorophyll	0	WaterQualityMeasurements						All			2011-05-03
ChlorophyllSampleVolume	Volume of material and liquid filtered to produce the chlorophyll a sample	0	Habitat						All			2009-10-29
Chloropicrin	Chloropicrin	0	Organics	Pesticides								2017-04-04
Chloroprene	Chloroprene (Chlorobutadiene)	126998	Organics	VOCs					All			2025-01-21
Chloropropylate	Chloropropylate	0	Organics	Pesticides	Insecticides							2017-04-04
Chloro-p-toluidine hydrochloride, 3-	3-chloro-p-toluidine hydrochloride	7745893	Organics	Pesticides								2017-04-10
Chlorothalonil	Chlorothalonil	1897456	Organics	Pesticides	Pest-OCHs	Algaecides	Fungicides	Nematocides	All			2007-07-27
Chlorotoluene, 2-	2-Chlorotoluene	95498	Organics	VOCs					All			2007-07-27
Chlorotoluene, 4-	4-Chlorotoluene	106434	Organics	VOCs					All			2007-07-27
Chlorotoluron	Chlorotoluron	15545489										2021-05-07
Chloroxuron	Chloroxuron (Chloroxyfenidim) (Norex)	1982474	Organics	Herbicides					All			2013-05-28
Chloroxuron(Surrogate)	Surrogate: Chloroxuron (Chloroxyfenidim) (Norex)	0	Organics	Pesticides	Herbicides							2017-02-27
Chlorpropham	Chlorpropham	101213	Organics	Pesticides	Pest-Carbamates	Herbicides			All			2007-07-27
Chlorpyrifos	Chlorpyrifos	2921882	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Chlorpyrifos Methyl	Chlorpyrifos Methyl	5598130	Organics	Pesticides	Pest-OPs	Insecticides			All			2013-05-28
Chlorpyrifos Methyl(Surrogate)	Surrogate: Chlorpyrifos Methyl	5598130	Organics	Pesticides	Pest-OPs	Insecticides			All			2016-03-02
Chlorpyrifos Methyl/Fenchlorphos	Chlorpyrifos Methyl/Fenchlorphos	0	Organics	Pesticides								2016-05-20
Chlorpyrifos Oxon	Chlorpyrifos Oxon	5598152	Organics	Pesticides	OrganophosphatePest.	Insecticides			All			2013-05-29
Chlorpyrifos(Surrogate)	Surrogate: Chlorpyrifos	2921882	Organics	Pesticides	OrganophosphatePest.	Insecticides						2013-06-17
Chlorsulfuron	Chlorsulfuron	0	Organics	Pesticides	Herbicides							2017-04-04
Chlortetracycline	Chlortetracycline	57625	Organics	PPCPs					All			2012-05-22
Chlorthal-Dimethyl, Total	Total Chlorthal-Dimethyl	0	Organics	Pesticides	Herbicides							2017-04-04
Chlorzoxazone	Chlorzoxazone	95250										2021-03-15
Cholesterol	Cholesterol	57885	Organics									2018-07-16
Chromium	Chromium	7440473	Inorganics	TraceElements	Metals				All			2007-07-27
Chromium III	Chromium III (Trivalent Chromium)	16065831	Metals									2025-08-25
Chromium VI	Chromium VI	18540299	Metals									2011-10-25
Chrysene	Chrysene	218019	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2007-07-27
Chrysene/Triphenylene	Chrysene/Triphenylene (CAS #EDF-359)	0	Organics	PAHs					All			2012-05-22
Chrysene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Chrysene-d12	1719035	Organics	PAHs	IDA							2023-11-07
Chrysene-d12(Surrogate)	Surrogate: Chrysene-d12	1719035	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2007-07-27
Chrysenes, C1-	C1-Chrysenes	0	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2010-06-21
Chrysenes, C2-	C2-Chrysenes	0	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2010-06-21
Chrysenes, C3-	C3-Chrysenes	0	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2010-06-21
Chrysenes, C4-	C4-Chrysenes	0	Organics	PAHs								2012-04-04
Cigarette Box/Wrapper	Cigarette Box/Wrapper	0	Debris	Trash	Plastics	Miscellaneous			All			2014-11-04
Cigarette Butt	Cigarette Butt	0	Debris	Trash	Plastics	Toxic			All			2014-11-04
Cimetidine	Cimetidine	51481619	Organics	PPCPs								2010-04-26
Cimetidine-d3(Surrogate)	Surrogate: Cimetidine-d3	0	Organics	PPCPs								2016-03-02
Cinerin-1	Cinerin-1	25402066	Organics	Pesticides	Pyrethrins	Insecticides						2026-05-08
Cinerin-2	Cinerin-2 (Cinerin II)	121200	Organics	Pesticides	Pyrethrins	Insecticides						2026-05-08
Ciodrin	Ciodrin (Crotoxyphos)	7700176	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Ciprofloxacin	Ciprofloxacin	85721331	Organics	PPCPs								2010-04-26
Ciprofloxacin-13C3-N15(Surrogate)	Surrogate: Ciprofloxacin-13C3-N15	0	Organics	PPCPs								2010-04-26
Circumference	Circumference	0	Habitat						All			2012-09-13
Clarithromycin	Clarithromycin	81103119	Organics	PPCPs								2010-04-26
Clay	Clay	0	Inorganics	Conventionals	GrainSize				All			2011-09-08
Clay, Coarse_WS (0.00195 to <0.0039 mm_Phi 9 to >8)	Coarse Clay_Wentworth Scale (0.00195 to <0.0039 mm_Phi 9 to >8)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Clay, Fine_WS (<0.00098 mm_Phi >10)	Fine Clay_Wentworth Scale (<0.00098 mm_Phi >10)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Clay, Medium_WS (0.00098 to <0.00195 mm_Phi 10 to >9)	Medium Clay_Wentworth Scale (0.00098 to <0.00195 mm_Phi 10 to >9)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Clay, Very Fine_WS (0.0005 to <0.00098 mm_Phi >10)	Very Fine Clay_Wentworth Scale (0.0005 to <0.00098 mm_Phi >10)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Clay, Very Very Fine_WS (<0.0005 mm_Phi >10)	Very Very Fine Clay_Wentworth Scale (<0.0005 mm_Phi >10)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Clay_AS (<0.005 mm)	Clay_ASTM Scale (<0.005 mm)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Clay_WS (<0.0039 mm_Phi >8)	Clay_Wentworth Scale (<0.0039 mm_Phi >8)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Clinafloxacin	Clinafloxacin	105956998	Organics	PPCPs								2010-04-26
Clofibric acid	Clofibric acid	882097										2021-05-07
Clomazone	Clomazone (Dimethazone)	81777891	Organics	Pesticides	Herbicides							2013-05-30
Clonidine	Clonidine	4205907	Organics	PPCPs								2010-04-26
Clonidine-d4(Surrogate)	Surrogate: Clonidine-d4	0	Organics	PPCPs								2010-04-26
Clostridiales, Human (LACHNO3)	Human Clostridiales, Assay Name: LACHNO3	0										2021-12-14
Clothianidin	Clothianidin	210880925	Pesticides									2012-06-21
Clothianidin-d3(Surrogate)	Surrogate: Clothianidin-d3	0	Organics	Pesticides								2018-08-07
Clothianidin-Desmethyl	Clothianidin-Desmethyl	135018154	Organics						All			2022-10-28
Clothing, synthetic fabric	Clothing, synthetic fabric	0	Debris	Trash	Plastics	Household			All			2014-11-04
CloudCover	Cloud cover at the time of sampling	0	Habitat						All			2012-09-13
Cloxacillin	Cloxacillin	61723	Organics	PPCPs								2010-04-26
Cobalt	Cobalt	7440484	Inorganics	Metals					All			2007-07-27
Cobble	Cobble	0	Inorganics	Conventionals	GrainSize				All			2011-09-08
Cocaine	Cocaine	50362	Organics	PPCPs								2010-04-26
Cocaine-d3(Surrogate)	Surrogate: Cocaine-d3	0	Organics	PPCPs								2010-04-26
Cocoons	Cocoons (#)	0	Toxicity						All			2007-07-27
COD	Chemical Oxygen Demand (COD)	0	Inorganics	Conventionals					All			2007-07-27
Codeine	Codeine	76573	Organics	PPCPs								2010-04-26
Codeine-d6(Surrogate)	Surrogate: Codeine-d6	0	Organics	PPCPs								2010-04-26
Coliform Ratio	The ratio of fecal/total coliform bacteria exceeds 0.1 and the total coliform bacteria exceeds 1000	0	Microbiological	NULL								2016-05-20
Coliform, Fecal	Fecal Coliform	0	Microbiological	Pathogens	Conventionals				All			2010-09-29
Coliform, Total	Total Coliform	0	Microbiological	Pathogens	Conventionals				All			2010-09-29
CollectionDepth	Depth at which sample was collected	0	WaterQualityMeasurements						All			2013-05-28
Colloid	Colloid	0										2020-03-13
CollSub_PlantDead	Algae collected from dead plant (including wood) substratum	0	Habitat						All			2012-09-13
CollSub_PlantLive	Algae collected from live plant (including wood) substratum	0	Habitat						All			2012-09-13
CollSub_Rock	Algae collected from rock (including concrete and consolidated sediment) substratum	0	Habitat						All			2012-09-13
CollSub_SedSoft	Algae collected from soft sediment substratum	0	Habitat						All			2012-09-13
Color	Color	0	FieldObservations	Habitat					All			2009-08-20
Color, True	Color of water from which turbidity has been removed	0	Inorganics	Conventionals					All			2012-09-13
Commercial	Commercial	0	Habitat						All			2009-08-20
CompositeVolume	Volume of material and liquid in Composite sample	0	Habitat						All			2009-10-29
Composition	Composition	0	FieldObservations	Habitat					All			2009-08-20
Computer	Computer	0	Debris	Trash	Plastics	Non-Plastics	Toxic	Large	All			2014-11-04
Concrete/Asphalt	Concrete/Asphalt	0	Debris	Trash	Non-Plastics	Construction			All			2014-11-04
Condom	Condom	0	Debris	Trash	Plastics							2022-11-02
Construction	Construction	0	Habitat						All			2008-04-02
Construction Debris	Construction debris such as brick, wood, sheetrock using Trash Protocol	0	Trash						All			2011-05-04
Construction Other	Construction Other	0	Debris	Trash	Non-Plastics	Construction			All			2014-11-04
Construction Wood/Pellets	Construction Wood/Pellets	0	Debris	Trash	Non-Plastics	Large			All			2014-11-04
Container, Chemical	Container, Chemical	0	Debris	Trash	Plastics	Toxic			All			2014-11-04
Container, Juice	Container, Juice	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
Container, Plastic	Container, Plastic	0	Debris	Trash	Plastics							2022-11-02
Container, Storage	Container, Storage	0	Debris	Trash	Plastics	Household			All			2014-11-04
Container, Styrofoam	Container, Styrofoam	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
Copper	Copper	7440508	Inorganics	TraceElements	Metals				All			2007-07-27
Coprostanol, beta-3-	3-beta-Coprostanol	360689	Organics									2018-07-18
Coronene	Coronene	0	Organics	PAHs								2014-01-28
Cotinine	Cotinine	486566	Organics	PPCPs								2010-04-26
Cotinine-d3(Surrogate)	Surrogate: Cotinine-d3	0	Organics	PPCPs								2010-04-26
Cotton fiber	When cotton is obviously the top hit and cellulose is several hits down. Then we can say it is specifically Cotton. For DYED or CLEAR anthropogenic cotton only and should just be called cotton.	0	Microdebris	Anthropogenic	Natural Based	Fiber						2018-04-26
Cotton Fiber Bundle	Cotton Fiber Bundle	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Cotton Film	Cotton Film	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Cotton Foam	Cotton Foam	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Cotton Fragment	Cotton Fragment	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Coumaphos	Coumaphos	56724	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
CPOM	Coarse particulate organic matter	0	Habitat						All			2009-08-20
Cresyl Diphenyl Phosphate	Cresyl Diphenyl Phosphate	26444495	Organics	FlameRetardants	PhosphateFlameRetardants							2017-09-19
Cropland	Cropland	0	Habitat						All			2009-08-20
Crops Irrigated Extent	Crops Irrigated Extent	0	Habitat						All			2019-05-07
Crops Irrigated Intensity	Crops Irrigated Intensity	0	Habitat						All			2019-05-07
Crops Irrigated Proximity	Crops Irrigated Proximity	0	Habitat						All			2019-05-07
Crops NonIrrigated Extent	Crops NonIrrigated Extent	0	Habitat						All			2019-05-07
Crops NonIrrigated Intensity	Crops NonIrrigated Intensity	0	Habitat						All			2019-05-07
Crops NonIrrigated Proximity	Crops NonIrrigated Proximity	0	Habitat						All			2019-05-07
Crutomate	Crutomate	0	Organics	Pesticides								2017-04-04
Cryptosporidium	Cryptosporidium	0	Microbiological	Pathogens	Conventionals				All			2013-05-28
Cryptosporidium Oocysts Fluorescence	Cryptosporidium Oocysts Fluorescence	0	Microbiological	Pathogens								2017-03-27
Cryptosporidium Oocysts/Amorphous Structure	Cryptosporidium Oocysts/Amorphous Structure	0	Microbiological	Pathogens								2017-03-27
Cryptosporidium Oocysts/DAPI & DIC Positive	Cryptosporidium Oocysts/DAPI & DIC Positive	0	Microbiological	Pathogens								2017-03-27
Cryptosporidium Oocysts/Empty	Cryptosporidium Oocysts/Empty	0	Microbiological	Pathogens								2017-03-27
Cryptosporidium Oocysts/Flourescence Antibody	Cryptosporidium Oocysts/Flourescence Antibody	0	Microbiological	Pathogens								2017-03-27
Cryptosporidium Oocysts/Internal Structure	Cryptosporidium Oocysts/Internal Structure	0	Microbiological	Pathogens								2017-03-27
Cryptosporidium Oocysts/Internal Structure (One)	Cryptosporidium Oocysts/Internal Structure (One)	0	Microbiological	Pathogens								2017-03-27
Cryptosporidium Oocysts/Negative	Cryptosporidium Oocysts/Negative	0	Microbiological	Pathogens								2017-03-27
Cryptosporidium Oocysts/Positive	Cryptosporidium Oocysts/Positive	0	Microbiological	Pathogens								2017-03-27
Cryptosporidium Oocysts/Positive (Internal Staining)	Cryptosporidium Oocysts/Positive (Internal Staining)	0	Microbiological	Pathogens								2017-03-27
Cryptosporidium Oocysts/Positive (Stained Nuclei)	Cryptosporidium Oocysts/Positive (Stained Nuclei)	0	Microbiological	Pathogens								2017-03-27
Cryptosporidium Oocysts/Total IFA Count	Cryptosporidium Oocysts/Total IFA Count	0	Microbiological	Pathogens								2017-03-27
CSCI	California Stream Condition Index score, calculated as the average of the O/E and pMMI	0	Habitat									2016-06-21
CSCI_CaptureProb_Abedus	Probability of capturing Abedus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Acari	Probability of capturing Acari calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Acentrella	Probability of capturing Acentrella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Acneus	Probability of capturing Acneus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Aeshna_Rhionaeshna	Probability of capturing Aeshna or Rhionaeshna calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Agabinus	Probability of capturing Agabinus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Agabus	Probability of capturing Agabus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Agapetus	Probability of capturing Agapetus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Allocosmoecus	Probability of capturing Allocosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ambrysus	Probability of capturing Ambrysus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ameletus	Probability of capturing Ameletus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ametor	Probability of capturing Ametor calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Amiocentrus	Probability of capturing Amiocentrus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Amphicosmoecus	Probability of capturing Amphicosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ampumixis	Probability of capturing Ampumixis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Anacaena	Probability of capturing Anacaena calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Anagapetus	Probability of capturing Anagapetus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Anax	Probability of capturing Anax calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Anchycteis	Probability of capturing Anchycteis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Antocha	Probability of capturing Antocha calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Apatania	Probability of capturing Apatania calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Archilestes	Probability of capturing Archilestes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Arctopsyche	Probability of capturing Arctopsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Argia	Probability of capturing Argia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Asellidae	Probability of capturing Asellidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Asioplax	Probability of capturing Asioplax calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Astacidae	Probability of capturing Astacidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Atherix	Probability of capturing Atherix calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Atractelmis	Probability of capturing Atractelmis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Atrichopogon	Probability of capturing Atrichopogon calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Attenella	Probability of capturing Attenella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Baetis	Probability of capturing Baetis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Berosus	Probability of capturing Berosus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Bezzia_Palpomyia	Probability of capturing Bezzia or Palpomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Blephariceridae	Probability of capturing Blephariceridae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Brachycentrus	Probability of capturing Brachycentrus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Brechmorhoga	Probability of capturing Brechmorhoga calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Caenis	Probability of capturing Caenis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Calineuria	Probability of capturing Calineuria calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Callibaetis	Probability of capturing Callibaetis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Callicorixa	Probability of capturing Callicorixa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Calliperla	Probability of capturing Calliperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Caloparyphus_Euparyphus	Probability of capturing Caloparyphus or Euparyphus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Calopterygidae	Probability of capturing Calopterygidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Camelobaetidius	Probability of capturing Camelobaetidius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Capniidae	Probability of capturing Capniidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Caudatella	Probability of capturing Caudatella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Centroptilum	Probability of capturing Centroptilum calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ceraclea	Probability of capturing Ceraclea calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ceratopogon	Probability of capturing Ceratopogon calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ceratopsyche_Hydropsyche	Probability of capturing Ceratopsyche or Hydropsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Chelifera_Metachela	Probability of capturing Chelifera or Metachela calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Cheumatopsyche	Probability of capturing Cheumatopsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Chimarra	Probability of capturing Chimarra calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Chironominae	Probability of capturing Chironominae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Choroterpes	Probability of capturing Choroterpes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Chrysops	Probability of capturing Chrysops calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Chyranda	Probability of capturing Chyranda calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Cinygma	Probability of capturing Cinygma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Cinygmula	Probability of capturing Cinygmula calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Claassenia	Probability of capturing Claassenia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Cleptelmis	Probability of capturing Cleptelmis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Clinocera	Probability of capturing Clinocera calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Cloeodes	Probability of capturing Cloeodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Clostoeca	Probability of capturing Clostoeca calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Cordulegaster	Probability of capturing Cordulegaster calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Corduliidae	Probability of capturing Corduliidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Corydalus	Probability of capturing Corydalus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Crangonyx	Probability of capturing Crangonyx calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Cryptochia	Probability of capturing Cryptochia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Cryptolabis	Probability of capturing Cryptolabis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Culicidae	Probability of capturing Culicidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Culicoides	Probability of capturing Culicoides calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Cultus	Probability of capturing Cultus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Cymbiodyta	Probability of capturing Cymbiodyta calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Dasyhelea	Probability of capturing Dasyhelea calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Desmona	Probability of capturing Desmona calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Despaxia	Probability of capturing Despaxia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Deuterophlebia	Probability of capturing Deuterophlebia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Diamesinae	Probability of capturing Diamesinae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Dicosmoecus	Probability of capturing Dicosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Dicranota	Probability of capturing Dicranota calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Diphetor	Probability of capturing Diphetor calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Diplectrona	Probability of capturing Diplectrona calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Diura	Probability of capturing Diura calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Dixa	Probability of capturing Dixa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Dixella	Probability of capturing Dixella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Dolichopodidae	Probability of capturing Dolichopodidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Dolophilodes	Probability of capturing Dolophilodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Doroneuria	Probability of capturing Doroneuria calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Drunella	Probability of capturing Drunella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Dubiraphia	Probability of capturing Dubiraphia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Dysmicohermes	Probability of capturing Dysmicohermes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ecclisomyia	Probability of capturing Ecclisomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ecdyonurus	Probability of capturing Ecdyonurus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Enallagma	Probability of capturing Enallagma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Enochrus	Probability of capturing Enochrus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Epeorus	Probability of capturing Epeorus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ephemerella	Probability of capturing Ephemerella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ephydridae	Probability of capturing Ephydridae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Eubrianax	Probability of capturing Eubrianax calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Eurylophella	Probability of capturing Eurylophella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Fallceon	Probability of capturing Fallceon calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Farula	Probability of capturing Farula calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ferrissia	Probability of capturing Ferrissia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Forcipomyia	Probability of capturing Forcipomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Fossaria	Probability of capturing Fossaria calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Frisonia	Probability of capturing Frisonia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Gammarus	Probability of capturing Gammarus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Glossiphoniidae	Probability of capturing Glossiphoniidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Glossosoma	Probability of capturing Glossosoma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Glutops	Probability of capturing Glutops calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Goera	Probability of capturing Goera calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Gomphus	Probability of capturing Gomphus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Gonomyia	Probability of capturing Gonomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Graptocorixa	Probability of capturing Graptocorixa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Gumaga	Probability of capturing Gumaga calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Gyraulus	Probability of capturing Gyraulus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Gyrinus	Probability of capturing Gyrinus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Haliplus	Probability of capturing Haliplus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Haploperla	Probability of capturing Haploperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hedriodiscus_Odontomyia	Probability of capturing Hedriodiscus or Odontomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Helichus	Probability of capturing Helichus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Helicopsyche	Probability of capturing Helicopsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Helisoma	Probability of capturing Helisoma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Helodon_Prosimulium	Probability of capturing Helodon or Prosimulium calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Helophorus	Probability of capturing Helophorus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hemerodromia	Probability of capturing Hemerodromia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Heptagenia	Probability of capturing Heptagenia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hesperoconopa	Probability of capturing Hesperoconopa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hesperoperla	Probability of capturing Hesperoperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hesperophylax	Probability of capturing Hesperophylax calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Heterelmis	Probability of capturing Heterelmis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Heterlimnius	Probability of capturing Heterlimnius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Heteroplectron	Probability of capturing Heteroplectron calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hexatoma	Probability of capturing Hexatoma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Himalopsyche	Probability of capturing Himalopsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Homoleptohyphes	Probability of capturing Homoleptohyphes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hyalella	Probability of capturing Hyalella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hydatophylax	Probability of capturing Hydatophylax calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hydra	Probability of capturing Hydra calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hydraena	Probability of capturing Hydraena calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hydrobiidae	Probability of capturing Hydrobiidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hydrobius	Probability of capturing Hydrobius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hydrochus	Probability of capturing Hydrochus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hydroporus	Probability of capturing Hydroporus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hydroptila	Probability of capturing Hydroptila calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Hydrotrupes	Probability of capturing Hydrotrupes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ilybius	Probability of capturing Ilybius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ironodes	Probability of capturing Ironodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ischnura	Probability of capturing Ischnura calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Isogenoides	Probability of capturing Isogenoides calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Isonychia	Probability of capturing Isonychia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Isoperla	Probability of capturing Isoperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Juga	Probability of capturing Juga calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Kathroperla	Probability of capturing Kathroperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Kogotus	Probability of capturing Kogotus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Laccobius	Probability of capturing Laccobius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Lara	Probability of capturing Lara calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Lepidostoma	Probability of capturing Lepidostoma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Lestes	Probability of capturing Lestes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Lethocerus	Probability of capturing Lethocerus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Leucotrichia	Probability of capturing Leucotrichia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Leucrocuta	Probability of capturing Leucrocuta calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Libellula	Probability of capturing Libellula calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Limnophila	Probability of capturing Limnophila calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Limonia	Probability of capturing Limonia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Liodessus	Probability of capturing Liodessus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Lymnaea	Probability of capturing Lymnaea calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Malenka	Probability of capturing Malenka calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Marilia	Probability of capturing Marilia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Maruina	Probability of capturing Maruina calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Matriella_Serratella	Probability of capturing Matriella or Serratella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Megarcys	Probability of capturing Megarcys calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Menetus	Probability of capturing Menetus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Meringodixa	Probability of capturing Meringodixa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Micrasema	Probability of capturing Micrasema calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Microcylloepus	Probability of capturing Microcylloepus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Molophilus	Probability of capturing Molophilus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Moselia	Probability of capturing Moselia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Muscidae	Probability of capturing Muscidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Mystacides	Probability of capturing Mystacides calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Namamyia	Probability of capturing Namamyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Narpus	Probability of capturing Narpus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Nectopsyche	Probability of capturing Nectopsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Nematoda	Probability of capturing Nematoda calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Nematomorpha	Probability of capturing Nematomorpha calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Nemotelus	Probability of capturing Nemotelus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Nemoura	Probability of capturing Nemoura calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Neohermes	Probability of capturing Neohermes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Neophylax	Probability of capturing Neophylax calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Neoplasta	Probability of capturing Neoplasta calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Neothremma	Probability of capturing Neothremma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Neotrichia	Probability of capturing Neotrichia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Nerophilus	Probability of capturing Nerophilus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Nixe	Probability of capturing Nixe calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Nothotrichia	Probability of capturing Nothotrichia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ochrotrichia	Probability of capturing Ochrotrichia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ochthebius	Probability of capturing Ochthebius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Octogomphus_specularis	Probability of capturing Octogomphus or specularis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Oecetis	Probability of capturing Oecetis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Oemopteryx	Probability of capturing Oemopteryx calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Oligochaeta	Probability of capturing Oligochaeta calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Oligophlebodes	Probability of capturing Oligophlebodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Onocosmoecus	Probability of capturing Onocosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ophiogomphus	Probability of capturing Ophiogomphus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Optioservus	Probability of capturing Optioservus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ordobrevia	Probability of capturing Ordobrevia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Oreodytes	Probability of capturing Oreodytes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Oreogeton	Probability of capturing Oreogeton calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ormosia	Probability of capturing Ormosia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Orohermes	Probability of capturing Orohermes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Oroperla	Probability of capturing Oroperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Orthocladiinae	Probability of capturing Orthocladiinae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Osobenus	Probability of capturing Osobenus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ostracoda	Probability of capturing Ostracoda calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ostrocada	Probability of capturing Ostrocada calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Oxyethira	Probability of capturing Oxyethira calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Palaeagapetus	Probability of capturing Palaeagapetus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Paltothemis	Probability of capturing Paltothemis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Paraleptophlebia	Probability of capturing Paraleptophlebia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Paraleuctra	Probability of capturing Paraleuctra calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Paraperla	Probability of capturing Paraperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Parapsyche	Probability of capturing Parapsyche calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Parthina	Probability of capturing Parthina calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Pedicia	Probability of capturing Pedicia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Pedomoecus	Probability of capturing Pedomoecus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Peltodytes	Probability of capturing Peltodytes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Pericoma_Telmatoscopus	Probability of capturing Pericoma or Telmatoscopus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Perlinodes	Probability of capturing Perlinodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Perlomyia	Probability of capturing Perlomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Petrophila	Probability of capturing Petrophila calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Physa_Physella	Probability of capturing Physa or Physella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Plumiperla	Probability of capturing Plumiperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Podmosta	Probability of capturing Podmosta calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Podonominae	Probability of capturing Podonominae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Polycentropus	Probability of capturing Polycentropus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Postelichus	Probability of capturing Postelichus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Probezzia	Probability of capturing Probezzia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Procloeon	Probability of capturing Procloeon calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Prodiamesinae	Probability of capturing Prodiamesinae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Progomphus	Probability of capturing Progomphus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Prostoia	Probability of capturing Prostoia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Prostoma	Probability of capturing Prostoma calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Protoptila	Probability of capturing Protoptila calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Psephenus	Probability of capturing Psephenus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Pseudolimnophila	Probability of capturing Pseudolimnophila calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Psychoda	Probability of capturing Psychoda calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Psychoglypha	Probability of capturing Psychoglypha calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Psychomyia	Probability of capturing Psychomyia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Pteronarcella	Probability of capturing Pteronarcella calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Pteronarcys	Probability of capturing Pteronarcys calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Ptychopteridae	Probability of capturing Ptychopteridae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Rhabdomastix	Probability of capturing Rhabdomastix calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Rhithrogena	Probability of capturing Rhithrogena calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Rhizelmis	Probability of capturing Rhizelmis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Rhyacophila	Probability of capturing Rhyacophila calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Rickera	Probability of capturing Rickera calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Sanfilippodytes	Probability of capturing Sanfilippodytes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Sciomyzidae	Probability of capturing Sciomyzidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment									2024-01-25
CSCI_CaptureProb_Scirtidae	Probability of capturing Scirtidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Sialis	Probability of capturing Sialis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Sierraperla	Probability of capturing Sierraperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Sigara	Probability of capturing Sigara calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Silvius	Probability of capturing Silvius calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Simulium	Probability of capturing Simulium calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Siphlonurus	Probability of capturing Siphlonurus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Skwala	Probability of capturing Skwala calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Soliperla	Probability of capturing Soliperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Soyedina	Probability of capturing Soyedina calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Sphaeriidae	Probability of capturing Sphaeriidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Sphaeromatidae	Probability of capturing Sphaeromatidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Sphaeromias	Probability of capturing Sphaeromias calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Staphylinidae	Probability of capturing Staphylinidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Stenocolus	Probability of capturing Stenocolus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Stictotarsus	Probability of capturing Stictotarsus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Stilobezzia	Probability of capturing Stilobezzia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Stratiomys	Probability of capturing Stratiomys calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Stygobromus	Probability of capturing Stygobromus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Suwallia	Probability of capturing Suwallia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Sweltsa	Probability of capturing Sweltsa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Sympetrum	Probability of capturing Sympetrum calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment									2024-01-25
CSCI_CaptureProb_Syrphidae	Probability of capturing Syrphidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Tabanus_Atylotus	Probability of capturing Tabanus or Atylotus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Taenionema	Probability of capturing Taenionema calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Tanypodinae	Probability of capturing Tanypodinae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Thaumaleidae	Probability of capturing Thaumaleidae calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Timpanoga	Probability of capturing Timpanoga calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Tinodes	Probability of capturing Tinodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Tipula	Probability of capturing Tipula calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Triaenodes	Probability of capturing Triaenodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Trichoclinocera	Probability of capturing Trichoclinocera calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Trichocorixa	Probability of capturing Trichocorixa calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment									2024-01-25
CSCI_CaptureProb_Tricoryhyphes	Probability of capturing Tricoryhyphes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Tricorythodes	Probability of capturing Tricorythodes calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Triznaka	Probability of capturing Triznaka calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Tropisternus	Probability of capturing Tropisternus calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Turbellaria	Probability of capturing Turbellaria calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Uvarus_subtilis	Probability of capturing Uvarus or subtilis calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Visoka	Probability of capturing Visoka calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Wiedemannia	Probability of capturing Wiedemannia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Wormaldia	Probability of capturing Wormaldia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Yoraperla	Probability of capturing Yoraperla calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Yphria	Probability of capturing Yphria calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Zaitzevia	Probability of capturing Zaitzevia calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Zapada	Probability of capturing Zapada calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_CaptureProb_Zoniagrion	Probability of capturing Zoniagrion calculated by the California Stream Condition Index (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_Clinger_PercentTaxa	Observed percent clinger taxa	0	Bioassessment						All			2021-01-28
CSCI_Clinger_PercentTaxa_predicted	Predicted percent clinger taxa	0	Bioassessment						All			2021-01-28
CSCI_Clinger_PercentTaxa_score	Score for percent clinger taxa metric	0	Bioassessment						All			2021-01-28
CSCI_Coleoptera_PercentTaxa	Observed percent Coleoptera taxa	0	Bioassessment						All			2021-01-28
CSCI_Coleoptera_PercentTaxa_predicted	Predicted percent Coleoptera taxa	0	Bioassessment						All			2021-01-28
CSCI_Coleoptera_PercentTaxa_score	Score for percent Coleoptera taxa metric	0	Bioassessment						All			2021-01-28
CSCI_Count	Total number of organisms in the sample. If purge=T, the post-purge number is shown. A minimum number has not been established, but samples with low values should be evaluated with caution.	0	Bioassessment						All			2017-05-08
CSCI_E	The sum of all capture probabilities greater than 0.5 at a site. Interpreted as the total number of common taxa expected at a site.	0	Bioassessment						All			2017-05-08
CSCI_EPT_PercentTaxa	Observed percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa	0	Bioassessment						All			2021-01-28
CSCI_EPT_PercentTaxa_predicted	Predicted percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa	0	Bioassessment						All			2021-01-28
CSCI_EPT_PercentTaxa_score	Scored percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa	0	Bioassessment						All			2021-01-28
CSCI_Intolerant_Percent	Observed percent intolerant individuals (CTV<3)	0	Bioassessment						All			2021-01-28
CSCI_Intolerant_Percent_predicted	Predicted percent intolerant individuals	0	Bioassessment						All			2021-01-28
CSCI_Intolerant_Percent_score	Score for percent intolerant individuals metric	0	Bioassessment						All			2021-01-28
CSCI_Mean_O	The number of common taxa (i.e., capture probability greater than 0.5) observed at a site, averaged across iterations.	0	Bioassessment						All			2017-05-08
CSCI_MMI	The pMMI score, averaged across 20 iterations. A minimum threshold has not been established, but low values should be considered indicative of degradation.	0	Bioassessment						All			2017-05-08
CSCI_MMI_Percentile	The percentile of the pMMI score, relative to the reference distribution. A minimum threshold has not been established, but low values should be considered indicative of degradation.	0	Bioassessment						All			2017-05-08
CSCI_Number_of_MMI_Iterations	Number of subsamples used to calculate the pMMI. If the count is less than 500, no subsampling is performed, and this field will show 1. Otherwise, 20 subsamples are performed.	0	Bioassessment						All			2017-05-08
CSCI_Number_of_OE_Iterations	Number of subsamples used to calculate the O/E. If the total number of unambiguous taxa is less than 500, no subsampling is performed, and this field will show 1. Otherwise, 20 subsamples are performed.	0	Bioassessment						All			2017-05-08
CSCI_OoverE	O/E, calculated as Mean_O divided by E.	0	Bioassessment						All			2017-05-08
CSCI_OoverE_Percentile	The percentile of the O/E score, relative to the reference distribution. A minimum threshold has not been established, but low values should be considered indicative of degradation.	0	Bioassessment						All			2017-05-08
CSCI_Pcnt_Ambiguous_Individuals	Percent of the total number of individuals excluded from O/E calculation. A maximum number has not been established, but samples with high values should be evaluated with caution.	0	Bioassessment						All			2017-05-08
CSCI_Pcnt_Ambiguous_Taxa	Percent of the total number of FinalIDs excluded from O/E calculation. A maximum number has not been established, but samples with high values should be evaluated with caution.	0	Bioassessment						All			2017-05-08
CSCI_Percentile	The percentile of CSCI score, relative to the reference distribution	0	Habitat									2016-06-21
CSCI_ProbGroup1	Probability of membership in Group 1 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_ProbGroup10	Probability of membership in Group 10 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_ProbGroup11	Probability of membership in Group 11 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_ProbGroup2	Probability of membership in Group 2 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_ProbGroup3	Probability of membership in Group 3 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_ProbGroup4	Probability of membership in Group 4 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_ProbGroup5	Probability of membership in Group 5 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_ProbGroup6	Probability of membership in Group 6 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_ProbGroup7	Probability of membership in Group 7 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_ProbGroup8	Probability of membership in Group 8 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_ProbGroup9	Probability of membership in Group 9 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016)	0	Bioassessment						All			2021-01-28
CSCI_Shredder_Taxa	Observed number of shredder taxa	0	Bioassessment						All			2021-01-28
CSCI_Shredder_Taxa_predicted	Predicted number of shredder taxa	0	Bioassessment						All			2021-01-28
CSCI_Shredder_Taxa_score	Score for shredder taxa metric	0	Bioassessment						All			2021-01-28
CSCI_Taxonomic_Richness	Observed taxonomic richness	0	Bioassessment						All			2021-01-28
CSCI_Taxonomic_Richness_predicted	Predicted taxonomic richness	0	Bioassessment						All			2021-01-28
CSCI_Taxonomic_Richness_score	Score for taxonomic richness metric	0	Bioassessment						All			2021-01-28
Cumylphenol, 4-	4-Cumylphenol	599644	Organics	Phenols								2018-07-16
Cup	Cup	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
Cup, Styrofoam	Cup, Styrofoam	0	Debris	Trash	Plastics	Bags/Packaging			All			2014-11-04
Cup, Waxed Paper	Cup, Waxed Paper	0	Debris	Trash	Plastics	Non-Plastics	FoodService		All			2014-11-04
Cup/Plate, Plastic	Cups/plates, Plastic	0	Debris	Trash	Plastics							2022-11-02
Cup/Plate, Polystryene Foam	Cup/plate, Polystyrene Foam, e.g., Styrofoam	0	Debris	Trash	Plastics							2022-11-02
Cup/Plate, Waxed Paper	Cup/plate, Waxed Paper	0	Debris	Trash	Non-Plastics							2022-11-02
Cyanazine	Cyanazine	21725462	Organics	Pesticides	Pest-Triazines	Herbicides			All			2007-07-27
Cyanide	Cyanide	57125	Inorganics	Conventionals					All			2007-07-27
Cyanobacteria	Potentially toxigenic (PTOX) genera of cyanobacteria	0										2018-12-05
Cyanobacteria, Prokaryotic DNA (16S)	Total Cyanobacteria, Prokaryotic DNA, Target gene: 16S, Proprietary primer sequences from Bend Genetics LLC	0	Microbiological	Cyanotoxins	Gene Marker				All			2026-05-27
CyanotoxinSampleVolume	Volume of material and liquid in Cyanotoxin sample	0	Habitat						All			2012-09-13
Cyantraniliprole	Cyantraniliprole	736994631	Organics	Pesticides	Insecticides							2016-03-10
Cyazofamid	Cyazofamid	120116883	Organics	Pesticides	Fungicides							2016-03-10
Cybutryne	Cybutryne	0	Organics	Pesticides	Herbicides							2017-04-04
Cyclaniliprole	Cyclaniliprole	1031756985	Organics						All			2022-10-28
Cycloate	Cycloate	1134232	Organics	Pesticides	Pest-Carbamates				All			2013-07-01
Cyclohexyl-2-Benzothiazol-Amine, N-	N-Cyclohexyl-2-Benzothiazol-Amine (N-Cyclohexyl-1,3-Benzothiazol-2-Amine) (NCBA)	28291750	Organics	Benzotriazoles and Benzothiazoles								2026-02-10
Cyfluthrin, beta-	beta-Cyfluthrin	1820573270	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyfluthrin, gamma-	gamma-Cyfluthrin	76703623	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyfluthrin, total	Total Cyfluthrin	68359375	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyfluthrin-1	Cyfluthrin peak 1	68359375	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyfluthrin-2	Cyfluthrin peak 2	68359375	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyfluthrin-2/Cyflurthrin-4	Cyfluthrin-2/Cyflurthrin-4	0	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyfluthrin-3	Cyfluthrin peak 3	68359375	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyfluthrin-4	Cyfluthrin peak 4	68359375	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyhalofop-butyl	Cyhalofop-butyl	122008859	Organics	Pesticides	Herbicides							2016-03-10
Cyhalothrin, gamma-	gamma-Cyhalothrin	76703623	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyhalothrin, lambda-1	lambda-Cyhalothrin, peak 1 or Warrior-1	91465086	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyhalothrin, lambda-2	lambda-Cyhalothrin, peak 2 or Warrior-2	91465086	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyhalothrin, Total	Total Cyhalothrin	68085858										2022-02-11
Cyhalothrin, Total lambda-	Total lambda-Cyhalothrin, sum peaks 1 & 2	91465086	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyhalothrin-d6, Total lambda-(Surrogate)	Surrogate: Total lambda-Cyhalothrin-d6	0	Organics	Pesticides								2018-03-21
Cylindrospermopsin	Cylindrospermopsin	0	Microbiological	Cyanotoxins					All			2012-05-22
Cylindrospermopsin gene, Prokaryotic DNA (cyrA)	Cylindrospermopsin gene, Prokaryotic DNA, Target Gene: cyrA, Proprietary primer sequences from Bend Genetics LLC	0	Microbiological	Cyanotoxins	Gene Marker				All			2026-05-27
Cymene, p-	p-Cymene	0	Organics	VOCs								2014-01-28
Cymoxanil	Cymoxanil	57966957	Organics	Pesticides	Fungicides							2016-03-10
Cypermethrin, Total	Total Cypermethrin, sum peaks 1,2,3 & 4	52315078	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cypermethrin-1	Cypermethrin peak 1	67375308	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cypermethrin-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Cypermethrin-13C6	0	Organics	Pesticides	Instecticides	Pyrethroids	IDA		All			2023-10-25
Cypermethrin-13C6(Surrogate)	Surrogate: Cypermethrin-13C6	0	Organics	Pesticides	Insecticides	Pyrethroids						2014-01-29
Cypermethrin-2	Cypermethrin peak 2	65731842	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cypermethrin-2/Cypermethrin-4	Cypermethrin-2/Cypermethrin-4	0	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cypermethrin-3	Cypermethrin peak 3	67375308	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cypermethrin-4	Cypermethrin peak 4	52315078	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Cyprazine	Cyprazine	0	Organics	Pesticides	Herbicides							2017-04-04
Cyproconazole	Cyproconazole	94361065	Organics	Pesticides	Fungicides							2016-03-10
Cyprodinil	Cyprodinil	121552612	Organics	Pesticides	Fungicides							2016-03-10
d13C_VPDB	Delta 13C, relative to Vienna Pee Dee Belemnite	0	Organics	IsotopicSignature								2015-05-07
d15N_Air-N2	Delta 15N, relative to Atmospheric Nitrogen	0	Organics	IsotopicSignature								2015-05-07
d34S_VCDT	Delta 34S, relative to Vienna Canyon Diablo Troilite	0	Organics	IsotopicSignature								2015-05-07
Dacthal	Dacthal	1861321	Organics	Pesticides	Pest-OCHs				All			2007-07-27
Dacthal acid metabolites	Dacthal acid metabolites	0	Organics	Pesticides								2017-04-10
Dacthal Monoacid	Dacthal Monoacid	887547	Organics	Pesticides								2017-04-10
Dairies Extent	Dairies Extent	0	Habitat						All			2019-05-07
Dairies Intensity	Dairies Intensity	0	Habitat						All			2019-05-07
Dairies Proximity	Dairies Proximity	0	Habitat						All			2019-05-07
Dam Extent	Dam Extent	0	Habitat						All			2019-05-07
Dam Intensity	Dam Intensity	0	Habitat						All			2019-05-07
Dam Proximity	Dam Proximity	0	Habitat						All			2019-05-07
Dams	Dams	0	Habitat						All			2009-08-20
Dazomet	Dazomet	0	Organics	Pesticides	Herbicides							2017-04-04
DBCE(Surrogate)	Surrogate: Dibutylchlorendate	1770805	Organics	Pesticides	Pest-OCHs				All			2007-07-27
DCBP(p,p')	p,p'-Dichlorobenzophenone (DCBP)	90982	Organics	Pesticides	Pest-OCHs				All			2007-07-27
DDD(o,p')	o,p'-DDD	53190	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		All			2007-07-27
DDD(o,p')(Surrogate)	Surrogate: o,p'-DDD	53190	Organics	Pesticides	OrganochlorinePesticides	Semi-VOAs	Insecticides	DDTs	All			2016-03-02
DDD(o,p')/PCB 118	o,p'-DDD/PCB 118	0	Organics	Pesticides/PCBs								2014-01-28
DDD(p,p')	p,p'-DDD	72548	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		All			2007-07-27
DDD(p,p')(Surrogate)	Surrogate: p,p'-DDD	72548	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		All			2016-03-02
DDD-13C12(o,p')(IsoDilAnalogue)	Isotope Dilution Analogue: o,p'-DDD-13C12	0	Organics	Pest-OCHs	IDA							2023-10-26
DDD-13C12(p,p')(IsoDilAnalogue)	Isotope Dilution Analogue: p,p'-DDD-13C12	0	Organics	Pest-OCHs	IDA							2023-10-27
DDD-d8(p,p')(Surrogate)	Surrogate: p,p'-DDD-d8	0	Organics	Pesticides								2013-05-29
DDE(o,p')	o,p'-DDE	3424826	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		All			2007-07-27
DDE(o,p')(Surrogate)	Surrogate: o,p'-DDE	0	Organics	Pesticides								2010-07-14
DDE(p,p')	p,p'-DDE	72559	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		All			2007-07-27
DDE(p,p')(Surrogate)	Surrogate: p,p'-DDE	0	Organics	Pesticides								2010-07-14
DDE(p,p')/PCB 087	p,p'-DDE/PCB 087	0	Organics	Pesticides/PCBs								2014-01-28
DDE-13C12(o,p')(IsoDilAnalogue)	Isotope Dilution Analogue: o,p'-DDE-13C12	0	Organics	Pest-OCHs	IDA							2023-10-27
DDE-13C12(p,p')(IsoDilAnalogue)	Isotope Dilution Analogue: p,p'-DDE-13C12	201612502	Organics	Pest-OCHs	IDA							2023-10-27
DDE-13C12(p,p')(Surrogate)	Surrogate: DDE-13C12(p,p')	201612502	Organics						All			2022-10-27
DDMS(p,p')	p,p'-DDMS	0	Organics	Pesticides								2011-08-22
DDMU(p,p')	p,p'-DDMU	1022226	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		All			2011-11-28
DDT(o,p')	o,p'-DDT	789026	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		All			2007-07-27
DDT(o,p')(Surrogate)	Surrogate: o,p'-DDT	0	Organics	Pesticides								2010-07-14
DDT(p,p')	p,p'-DDT	50293	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		All			2007-07-27
DDT(p,p')(Surrogate)	Surrogate: p,p'-DDT	0	Organics	Pesticides								2010-07-14
DDT(p,p')/PCB 187	p,p'-DDT/PCB 187	0	Organics	Pesticides/PCBs								2014-01-28
DDT-13C12(o,p')(IsoDilAnalogue)	Isotope Dilution Analogue: o,p'-DDT-13C12	0	Organics	Pest-OCHs	IDA							2023-10-27
DDT-13C12(p,p')(IsoDilAnalogue)	Isotope Dilution Analogue: p,p'-DDT-13C12	104215841	Organics	Pest-OCHs	IDA							2023-10-27
Dead Domestic Animals	Dead Domestic Animals	0	Debris	Trash	Non-Plastics	Marine Origin			All			2014-11-04
Deaminated metribuzin (DA)	Deaminated metribuzin (DA)	0	Organics	Pesticides								2017-04-20
Debris Lines/Silt-Laden Vegetation Extent	Debris Lines/Silt-Laden Vegetation Extent	0	Habitat						All			2019-05-07
Debris Lines/Silt-Laden Vegetation Intensity	Debris Lines/Silt-Laden Vegetation Intensity	0	Habitat						All			2019-05-07
Debris Lines/Silt-Laden Vegetation Proximity	Debris Lines/Silt-Laden Vegetation Proximity	0	Habitat						All			2019-05-07
DebrisLandUse_Commercial	DebrisLandUse_Commercial	0	Habitat	Debris					All			2014-11-04
DebrisLandUse_Industrial	DebrisLandUse_Industrial	0	Habitat	Debris					All			2014-11-04
DebrisLandUse_LimitedTimeParking	DebrisLandUse_LimitedTimeParking	0	Habitat	Debris					All			2014-11-04
DebrisLandUse_OpenSpace	DebrisLandUse_OpenSpace	0	Habitat	Debris					All			2014-11-04
DebrisLandUse_Park	DebrisLandUse_Park	0	Habitat	Debris					All			2014-11-04
DebrisLandUse_ParkingLot	DebrisLandUse_ParkingLot	0	Habitat	Debris					All			2014-11-04
DebrisLandUse_Residential	DebrisLandUse_Residential	0	Habitat	Debris					All			2014-11-04
Decabromodiphenyl Ethane	Decabromodiphenyl Ethane	84852539	Organics	FlameRetardants								2013-05-29
Decabromodiphenylethane	Decabromodiphenylethane (DBDPE)	84852539	Organics	FlameRetardants					All			2014-03-13
Decabromodiphenylethane-13C14(IsoDilAnalogue)	Isotope Dilution Analogue: Decabromodiphenylethane-13C14 (DBDPE-13C14)	0	Organics	FlameRetardants	IDA							2024-10-31
Decafluorobiphenyl(Surrogate)	Surrogate: Decafluorobiphenyl	434902	Organics	PAHs	SVOCs				All			2016-03-02
Decalin	Decalin	91178	Organics	VOCs					All			2014-01-28
Decalin, C1-	C1-Decalin	0	Organics	VOCs					All			2014-01-28
Decalin, C2-	C2-Decalin	0	Organics	VOCs					All			2014-01-28
Decalin, C3-	C3-Decalin	0	Organics	VOCs					All			2014-01-28
Decalin, C4-	C4-Decalin	0	Organics	VOCs					All			2014-01-28
Decamethylcyclopentasiloxane	Decamethylcyclopentasiloxane	541026										2021-05-19
Decane, 2-phenyl-	2-Phenyl-decane	0	Organics	VOCs								2016-05-20
Decane, 3-phenyl-	3-Phenyl-decane	0	Organics	VOCs								2016-05-20
Decane, 4-phenyl-	4-Phenyl-decane	0	Organics	VOCs								2016-05-20
Decane, 5-phenyl-	5-Phenyl-decane	0	Organics	VOCs								2016-05-20
Decane, n-	n-Decane	0	Organics	Alkanes								2014-01-28
Dechlorane 601	Dechlorane 601	0	Organics	FlameRetardants					All			2014-03-13
Dechlorane 602	Dechlorane 602	31107445	Organics	FlameRetardants					All			2014-03-13
Dechlorane 603	Dechlorane 603	0	Organics	FlameRetardants					All			2014-03-13
Dechlorane 604	Dechlorane 604	0	Organics	FlameRetardants					All			2014-03-13
Dechlorane 604 Component B	Dechlorane 604 Component B	0	Organics	FlameRetardants					All			2014-03-13
Dechlorane Plus Mono Adduct	Dechlorane Plus Mono Adduct (DPMA)	0	Organics	FlameRetardants					All			2014-03-13
Dechlorane Plus, anti-	anti-Dechlorane Plus (anti-DP)	135821748	Organics	FlameRetardants								2025-08-25
Dechlorane Plus, syn-	syn-Dechlorane Plus (syn-DP)	135821033	Organics	FlameRetardants								2025-08-25
Dechlorane Plus, Total	Total Dechlorane Plus (DP)	13560899	Organics	FlameRetardants					All			2014-03-13
Dehydronifedipine	Dehydronifedipine	0	Organics	PPCPs								2010-04-26
Delta 13C	Delta 13C	0	Organics	Statistic								2014-01-28
Delta 15N	Delta 15N	0	Organics	Statistic								2014-01-28
Delta 15N - baseline corrected	Delta 15N - baseline corrected	0	Organics	Statistic								2014-01-28
Deltamethrin	Deltamethrin	52918635	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Deltamethrin/Tralomethrin	Deltamethrin/Tralomethrin	0	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Deltamethrin-d6, Total(Surrogate)	Surrogate: Total Deltamethrin-d6	0										2021-08-20
Demeton, Total	Total Demeton	0	Organics	Pesticides	Pest-Ops				All			2010-05-18
Demeton-O	Demeton-O	298033	Organics	Pesticides								2016-05-20
Demeton-s	Demeton-s	126750	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Density	Density of Sample	0	Habitat						All			2007-07-27
Deposits	Deposits	0	Habitat									2014-04-17
Desethyl-Atrazine	Desethyl-Atrazine	6190654	Organics	Pesticides	Pest-Triazines				All			2009-01-12
Desethyl-desisopropyl-atrazine	Desethyl-desisopropyl-atrazine	3397624	Organics	Pesticides	Pest-Triazines							2013-05-20
Desisopropyl-Atrazine	Desisopropyl-Atrazine	1007289	Organics	Pesticides	Pest-Triazines				All			2009-01-12
Desmedipham	Desmedipham	0	Organics	Pesticides	Herbicides							2017-04-04
Desmethyldiltiazem	Desmethyldiltiazem	0	Organics	PPCPs								2010-04-26
Desmethyl-LR	Desmethyl-LR	120011667	Microbiological	Cyanotoxins					All			2012-05-22
Desmethyl-RR	Desmethyl-RR	0	Microbiological	Cyanotoxins					All			2012-05-22
Desmetryn	Desmetryn	1014693	Organics	Pesticides	Pest-Triazines				All			2009-01-12
Desnitro-imidacloprid	Desnitro-imidacloprid	115970177	Organics	Pesticides	Insecticides	Neonics						2017-10-05
Desthio-prothioconazole	Desthio-prothioconazole	120983644	Organics	Pesticides	Fungicides							2016-03-10
Detergent	Detergent	0	FieldObservations									2015-06-26
Deuterium/Hydrogen Ratio	Deuterium/Hydrogen Ratio	7782390	Isotopes									2013-05-20
Di(2-ethylhexyl) phosphate	Di(2-ethylhexyl) phosphate (DEHP)	298077	Organics	FlameRetardants					All			2014-03-13
Diallate	Diallate (Avadex)	0	Organics	Pesticides	Herbicides							2017-04-04
Diaminochlorotriazine (DACT)	Diaminochlorotriazine (DACT)	0	Organics	Pesticides								2017-04-20
Diazepam	Diazepam	439145	Organics	PPCPs								2010-04-26
Diazepam-d5(Surrogate)	Surrogate: Diazepam-d5	0	Organics	PPCPs								2010-04-26
Diazinon	Diazinon	333415	Organics	Pesticides	Pest-OPs				All			2007-07-27
Diazinon(Surrogate)	Surrogate: Diazinon	0	Organics	Pesticides	OrganophosphatePest.	OrganochlorinePesticides			All			2011-04-07
Diazinon-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Diazinon-d10	100155473	Organics	Pest-OPs	IDA				All			2023-10-27
Diazinon-d10(Surrogate)	Surrogate: Diazinon-d10	100155473	Organics	SVOC	Insecticide							2023-08-17
Diazoxon	Diazoxon	962583	Organics	Pesticides	OrganophosphatePest.	OrganochlorinePesticides						2011-07-15
Dibenz(a,h)anthracene	Dibenz(a,h)anthracene	53703	Organics	PAHs	SVOCs	HMW_PAH			All			2013-05-28
Dibenz(a,h)anthracene, C1-	C1-Dibenz(a,h)anthracene	0	Organics	PAHs					All			2014-01-28
Dibenz(a,h)anthracene, C2-	C2-Dibenz(a,h)anthracene	0	Organics	PAHs					All			2014-01-28
Dibenz(a,h)anthracene, C3-	C3-Dibenz(a,h)anthracene	0	Organics	PAHs					All			2014-01-28
Dibenz(a,h)anthracene-d14(IsoDilAnalogue)	Isotope Dilution Analogue: Dibenz(a,h)anthracene-d14	13250981	Organics	PAHs	IDA							2023-11-14
Dibenz(a,h)anthracene-d14(Surrogate)	Surrogate: Dibenz(a,h)anthracene-d14	13250981	Organics	PAHs								2025-09-04
Dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene	Dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene	0										2019-04-23
Dibenzofuran	Dibenzofuran	132649	Organics	SVOCs	Insecticides				All			2007-07-27
Dibenzothiophene	Dibenzothiophene	132650	Organics	PAHs	SVOCs				All			2007-07-27
Dibenzothiophene-d8(IsoDilAnalogue)	Isotope Dilution Analogue: Dibenzothiophene-d8	33262292	Organics	PAHs	IDA							2023-11-07
Dibenzothiophene-d8(Surrogate)	Surrogate: Dibenzothiophene-d8	33262292	Organics	PAHs	SVOCs				All			2007-07-27
Dibenzothiophenes, C1-	C1-Dibenzothiophenes	0	Organics	PAHs	SVOCs				All			2010-06-21
Dibenzothiophenes, C2-	C2-Dibenzothiophenes	0	Organics	PAHs	SVOCs				All			2010-06-21
Dibenzothiophenes, C3-	C3-Dibenzothiophenes	0	Organics	PAHs	SVOCs				All			2010-06-21
Dibenzothiophenes, C4-	C4-Dibenzothiophenes	0	Organics	PAHs	Alkylated PAHs							2018-07-24
Dibromo-2,3-dichlorophenyl-hexachloro-norbornene, 4,6-	4,6-Dibromo-2,3-dichlorophenyl-hexachloro-norbornene (Br2Cl2-DEC604)	0	Organics	FlameRetardants								2015-07-16
Dibromo-3-Chloropropane, 1,2-	1,2-Dibromo-3-Chloropropane (DBCP)	96128	Organics	VOCs					All			2013-05-28
Dibromo-4-(1,2-dibromoethyl)cyclohexane, alpha-1,2-	alpha-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (alpha-DBE-DBCH)	3322938	Organics	FlameRetardants								2015-07-16
Dibromo-4-(1,2-dibromoethyl)cyclohexane, beta-1,2-	beta-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (beta-DBE-DBCH)	3322938	Organics	FlameRetardants								2015-07-16
Dibromo-4-(1,2-dibromoethyl)cyclohexane, gamma-1,2-	gamma-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (gamma-DBE-DBCH)	3322938	Organics	FlameRetardants								2015-07-16
Dibromo-4-Cyanophenyl Octanoate, 2,6-	2,6-Dibromo-4-Cyanophenyl Octanoate	0	Organics	Pesticides	Herbicides							2017-04-04
Dibromo-4-hydroxybenzonitrile, 3,5-	3,5-Dibromo-4-hydroxybenzonitrile (Bromoxynil)	1689845	Organics	SVOCs								2013-05-20
Dibromoacetic Acid	Dibromoacetic Acid (DBAA)	631641	Organics	Haloacetic acids (HAAs)								2025-11-05
Dibromoaldrin	Dibromoaldrin (DBALD)	0	Organics	FlameRetardants								2015-07-16
Dibromochloromethane	Dibromochloromethane	124481	Organics	VOCs					All			2007-07-27
Dibromodichloromethane	Dibromodichloromethane	594183	Organics	VOCs					All			2025-01-21
Dibromoethane, 1,2-	1,2-Dibromoethane	106934	Organics	VOCs	Insecticides				All			2007-07-27
Dibromofluoromethane	Dibromofluoromethane	1868537	Organics	VOCs								2025-08-25
Dibromofluoromethane(Surrogate)	Surrogate: Dibromofluoromethane	186857	Organics	VOCs					All			2007-07-27
Dibromomethane	Dibromomethane	74953	Organics	VOCs					All			2007-07-27
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)	Surrogate: 4,4'-Dibromooctafluorobiphenyl (DBOFB)	10386842	Organics	Pesticides	Pest-OCHs				All			2016-03-02
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)DB-608	Surrogate: 4,4’-Dibromooctafluorobiphenyl run on column DB-608	10386842	Organics	Pesticides	Pest-OCHs				All			2016-03-02
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)HP-5	Surrogate: 4,4’-Dibromooctafluorobiphenyl run on column HP-5	10386842	Organics	Pesticides	Pest-OCHs				All			2016-03-02
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)	Surrogate: 4-4' Dibromooctafluorobiphenyl (DBOFB)	10386800	Organics	Pesticides	Pest-OCHs				All			2013-05-28
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)DB-608	Surrogate: 4,4’-dibromooctafluorobiphenyl run on column DB-608	10386800	Organics	Pesticides	Pest-OCHs				All			2013-05-28
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)HP-5	Surrogate: 4,4’-dibromooctafluorobiphenyl run on column HP-5	10386800	Organics	Pesticides	Pest-OCHs				All			2013-05-28
Dibromophenyl-hexachloro-norbornene	Dibromophenyl-hexachloro-norbornene (Br2-DEC604)	0	Organics	FlameRetardants								2015-07-16
Dibromopropane, 1,2-(Surrogate)	Surrogate: 1,2-Dibromopropane	78751	Organics									2021-10-19
Dibutyl phosphate	Dibutyl phosphate (DBP)	107664	Organics	FlameRetardants					All			2014-03-13
Dibutylchlorendate	Dibutylchlorendate	0	Organics	Pesticides								2011-05-11
Dibutylchlorendate(Surrogate)	Surrogate: Dibutylchlorendate (DBCE)	1770805	Organics	FlameRetardants					All			2026-05-08
Dibutyltin as Sn	Dibutyltin as Sn (DBT)	1191486	Organics	Organotins	Biocide				All			2025-08-25
Dicamba	Dicamba (2,5-Dichloro-6-methoxybenzoic Acid)	1918009	Organics	Herbicides					All			2013-05-28
Dicamba, diethanolamine salt	Dicamba, diethanolamine salt	25059783	Organics	Pesticides								2017-04-20
Dicamba, dimethylamine salt	Dicamba, dimethylamine salt	2300665	Organics	Pesticides								2017-04-20
Dichlofenthion	Dichlofenthion	97176	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides		All			2007-07-27
Dichlofenthion(Surrogate)	Surrogate: Dichlofenthion	97176	Organics	Pesticides					All			2015-08-21
Dichlone	Dichlone	117806	Organics	Pesticides	Fungicides							2016-10-25
Dichloran	Dichloran (Botran) (Benzenamine, 2,6-dichloro-4-nitro-)	99309	Pyrethroid Pesticides									2015-07-02
Dichloro-2 butene, cis 1,4-	Cis-1,4-dichloro-2 butene	0	Organics									2018-02-13
Dichloro-2 butene, trans 1,4-	Trans-1,4-dichloro-2 butene	110576								Organics		2016-07-29
Dichloroacetate(Surrogate)	Surrogate: Dichloroacetate	13425804	Organics	Acids					All			2025-08-25
Dichloroacetic Acid	Dichloroacetic Acid (DCAA)	79436	Organics	Haloacetic acids (HAAs)								2025-11-05
Dichloroaniline, 3,4-	3,4-Dichloroaniline	0										2019-01-23
Dichloroaniline, 3,5-	3,5-Dichloroaniline	626437	Organics	Pesticides								2016-03-10
Dichlorobenzenamine, 3,4-	3,4-Dichlorobenzenamine (3,4-DCA)	95761	Pesticides									2013-05-31
Dichlorobenzene, 1,2-	1,2-Dichlorobenzene	95501	Organics	VOCs	SVOCs	Herbicides			All			2007-07-27
Dichlorobenzene, 1,2-(Surrogate)	Surrogate: 1,2-Dichlorobenzene	0	Organics	VOCs								2016-05-20
Dichlorobenzene, 1,3-	1,3-Dichlorobenzene	541731	Organics	VOCs	SVOCs	Insecticides			All			2007-07-27
Dichlorobenzene, 1,3-(Surrogate)	Surrogate: 1,3-Dichlorobenzene	0	Organics	VOCs								2016-05-20
Dichlorobenzene, 1,4-	1,4-Dichlorobenzene	106467	Organics	VOCs	SVOCs	Insecticides			All			2007-07-27
Dichlorobenzene, 1,4-(Surrogate)	Surrogate: 1,4-Dichlorobenzene	0	Organics	VOCs								2016-05-20
Dichlorobenzene-13C6,1,4-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,4-Dichlorobenzene-13C6	201595597										2024-01-19
Dichlorobenzene-d4, 1,2-	1,2-Dichlorobenzene-d4	2199691	Organics	VOCs								2016-05-20
Dichlorobenzene-d4, 1,2-(Surrogate)	Surrogate: 1,2-Dichlorobenzene-d4	2199691	Organics	VOCs								2016-05-20
Dichlorobenzene-d4, 1,4-(Surrogate)	Surrogate: 1,4-Dichlorobenzene-d4	3855821	Organics	VOCs	SVOCs	Insecticides			All			2013-05-28
Dichlorobenzidine, 3,3'-	3,3'-Dichlorobenzidine	91941	Organics	Semi-VOAs								2011-05-11
Dichlorobenzidine, 3,3'-(Surrogate)	Surrogate: 3,3'-Dichlorobenzidine	0	Organics	VOCs								2016-05-20
Dichlorobenzoic Acid, 3,5-	3,5-Dichlorobenzoic Acid	51365	Organics	VOCs								2016-05-20
Dichlorobenzoic Acid, 3,5-(Surrogate)	Surrogate: 3,5-Dichlorobenzoic Acid	0	Organics	VOCs								2016-05-20
Dichlorobenzonitrile, 2,6-	2,6-Dichlorobenzonitrile (Dichlobenil)	1194656	Organics	Pesticides	Herbicides							2016-10-25
Dichlorobenzophenone(p,p')	p,p'-Dichlorobenzophenone	0	Organics	Pesticides								2014-01-28
Dichlorodifluoromethane	Dichlorodifluoromethane	75718	Organics	VOCs					All			2007-07-27
Dichloroethane, 1,1-	1,1-Dichloroethane	75343	Organics	VOCs					All			2007-07-27
Dichloroethane, 1,2-	1,2-Dichloroethane	107062	Organics	VOCs		Insecticides			All			2007-07-27
Dichloroethane-d4, 1,2-(Surrogate)	Surrogate: 1,2-Dichloroethane-d4	17060070	Organics	VOCs					All			2007-07-27
Dichloroethylene, 1,1-	1,1-Dichloroethylene (1,1-Dichloroethene)	75354	Organics	VOCs					All			2013-05-28
Dichloroethylene, cis 1,2-	cis-1,2-Dichloroethylene (cis-1,2-Dichloroethene)	156592	Organics	VOCs					All			2013-05-28
Dichloroethylene, Total 1,2-	Total 1,2-Dichloroethylene	0	Organics	VOCs								2017-03-29
Dichloroethylene, trans 1,2-	trans-1,2-Dichloroethylene (trans-1,2-Dichloroethene)	156605	Organics	VOCs					All			2013-05-28
Dichlorophenol, 2,4-	2,4-Dichlorophenol	120832	Organics	SVOCs	Phenols	Chlorinated Phenols			All			2007-07-27
Dichlorophenol, 2,4-(Surrogate)	Surrogate: 2,4-Dichlorophenol	0	Organics	VOCs								2016-05-20
Dichlorophenol, 2,6-	2,6-Dichlorophenol	87650	Organics	SVOCs	Phenols	Chlorinated Phenols						2016-08-19
Dichlorophenoxy)propionic acid isooctyl ester, 2-(2,4-	2-(2,4-dichlorophenoxy)propionic acid isooctyl ester	28631358	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid 2-ethylhexyl ester, 2,4-	2,4-Dichlorophenoxyacetic acid 2-ethylhexyl ester (2,4-D 2-ethylexyl ester)	1928434	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid alkanolamine salts, 2,4-	2,4-Dichlorophenoxyaceticc Acid alkanolamine salts (2,4-D alkanolamine salts)	0	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid butoxyethanol ester, 2,4-	2,4-Dichlorophenoxyaceticc Acid butoxyethanol ester (2,4-D Butoxyethyl ester)	1929733	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid butyl ester, 2,4-	2,4-Dichlorophenoxyaceticc Acid butyl ester (2,4-D butyl ester)	94804	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid diethanolamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid diethanolamine salt (2,4-D diethanolamine salt)	5742198	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid diethylamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid diethylamine salt (2,4-D diethylamine salt)	20940378	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid dimethylamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid dimethylamine salt (2,4-D dimethylamine salt)	2008391	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid dodecylamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid dodecylamine salt (2,4-D dodecylamine salt)	2212546	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid isooctyl ester, 2,4-	2,4-Dichlorophenoxyaceticc Acid isooctyl ester (2,4-D isooctyl ester)	25168267	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid Methyl Ester, 2,4-	2,4-Dichlorophenoxyacetic acid Methyl ester (2,4-D 2-Methyl ester)	1928387	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid n,n-dimethyloleyl-linoleyamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid n,n-dimethyloleyl-linoleyamine salt (2,4-D n,n-dimethyloleyl-linoleyamine salt)	55256321	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid n-oleyl-1, 2,4-3-propylenediamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid n-oleyl-1,3-propylenediamine salt (2,4-D n-oleyl-1,3-propylenediamine salt)	2212591	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid octyl ester, 2,4-	2,4-Dichlorophenoxyaceticc Acid octyl ester (2,4-D octyl ester)	1917971	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid propyl ester, 2,4-	2,4-Dichlorophenoxyaceticc Acid propyl ester (2,4-D propyl ester)	1928616	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid propyleneglycolbutylether ester, 2,4-	2,4-Dichlorophenoxyacetic Acid propylene glycol butyl ether ester (2,4-D propylene glycol butyl ether ester)	1320189	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid tetradecylamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid tetradecylamine salt (2,4-D tetradecylamine salt)	28685189	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid triethylamine salt, 2,4-	2,4-Dichlorophenoxyaceticc Acid triethylamine salt (2,4-D triethylamine salt)	2646788	Organics	Pesticides								2017-04-10
Dichlorophenoxyacetic Acid, 2,3-(Surrogate)	Surrogate: 2,3-Dichlorophenoxyacetic Acid (2,3-D)	2976741	Organics	VOCs								2016-05-20
Dichlorophenoxyacetic Acid, 2,4-	2,4-Dichlorophenoxyacetic Acid (2,4-D)	94757	Organics	Herbicides					All			2013-05-28
Dichlorophenoxyacetic Acid, 2,4-(Surrogate)	Surrogate: 2,4-Dichlorophenoxyacetic Acid (2,4-D)	94757	Organics	VOCs								2016-05-20
Dichlorophenoxybutyric Acid dimethylamine salt, 4-(2,4-	4-2,4-Dichlorophenoxybutyric Acid dimethylamine salt	2758421	Organics	Pesticides								2017-04-10
Dichlorophenoxybutyric Acid isooctyl ester, 4-(2,4-	4-2,4-Dichlorophenoxybutyric Acid isooctyl ester	1320156	Organics	Pesticides								2017-04-10
Dichlorophenoxybutyric Acid Methyl Ester, 2,4-	2,4-Dichlorophenoxybutyric Acid Methyl Ester (2,4-DB Methyl Ester)	0	Organics	Herbicides								2013-05-20
Dichlorophenoxybutyric Acid, 2,4-	2,4-Dichlorophenoxybutyric Acid (2,4-DB)	94826	Organics	Herbicides					All			2013-05-28
Dichlorophenoxybutyric Acid, 2,4-(Surrogate)	Surrogate: 2,4-Dichlorophenoxybutyric Acid (2,4-DB)	0	Organics	VOCs								2016-05-20
Dichlorophenyl isocyanate, 3,4-	3,4-Dichlorophenyl isocyanate	102363	Organics									2018-07-16
Dichlorophenyl Urea, 3,4-	3,4-Dichlorophenyl Urea (DCPU)	2327028	Pesticides									2013-05-31
Dichlorophenyl-3-methyl Urea, 3,4-	3,4-Dichlorophenyl-3-methyl Urea (DCPMU)	3567622	Pesticides									2013-05-31
Dichlorophenylacetic Acid, 2,4-	2,4-Dichlorophenylacetic Acid	19719289	Organics	Herbicides								2016-05-20
Dichlorophenylacetic Acid, 2,4- (Surrogate)	Surrogate: 2,4-Dichlorophenylacetic Acid	19719289	Organics	Herbicides					All			2013-05-28
Dichloroprop	Dichlorprop (2-(2,4-Dichlorophenoxy)propanoic Acid)	120365	Organics	Herbicides					All			2013-05-28
Dichloroprop, dimethylamine salt	Dichloroprop, dimethylamine salt	53404323	Organics	Pesticides								2025-08-25
Dichloropropane, 1,2-	1,2-Dichloropropane	78875	Organics	VOCs	Insecticides	Nematocides			All			2007-07-27
Dichloropropane, 1,3-	1,3-Dichloropropane	142289	Organics	VOCs					All			2007-07-27
Dichloropropane, 2,2-	2,2-Dichloropropane	594207	Organics	VOCs					All			2007-07-27
Dichloropropene, 1,1-	1,1-Dichloropropene	563586	Organics	VOCs					All			2007-07-27
Dichloropropene, 1,3-	1,3-Dichloropropene	0										2016-12-23
Dichloropropene, cis 1,3-	cis-1,3-Dichloropropene	10061015	Organics	VOCs					All			2007-07-27
Dichloropropene, Total 1,3-	Total 1,3-Dichloropropene	0	Organics	VOCs								2016-05-20
Dichloropropene, trans 1,3-	trans-1,3-Dichloropropene	10061026	Organics	VOCs					All			2007-07-27
Dichloropropionic Acid, 2,2-	2,2-Dichloropropionic Acid (Dalapon)	75990	Organics	Herbicides					All			2013-05-28
Dichloro-pyridine-2-carboxylic Acid, 3,6-	3,6-Dichloro-pyridine-2-carboxylic Acid (Clopyralid)	1702176	Organics	Herbicides								2013-05-28
Dichlorotrifluoroethane	Dichlorotrifluoroethane (Freon 123)	306832	Organics	VOCs								2017-04-12
Dichlorotrifluoromethane	Dichlorotrifluoromethane	0	Organics	VOCs					All			2016-01-26
Dichlorprop, butoxyethyl ester	Dichlorprop, butoxyethyl ester	53404312	Organics	Pesticides								2017-04-10
Dichlorvos	Dichlorvos	62737	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Dichrotophos	Dichrotophos	0	Organics	Pesticides								2016-05-20
Diclofenac	Diclofenac (2-(2-(2,6-Dichlorophenylamino)phenyl)acetic Acid)	15307865	Organics	PPCPs					All			2013-05-27
Diclofop-Methyl	Diclofop-Methyl	0	Organics	Pesticides	Herbicides							2017-04-04
Dicofol	Dicofol	115322	Organics	Pesticides	Pest-OCHs				All			2007-07-27
Dicrotophos	Dicrotophos	141662	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Dicyclohexylurea, 1,3-	1,3-Dicyclohexylurea (N,N'-Dicyclohexylurea)	2387237	Organics	Tire- and Vehicle-derived Contaminants								2026-02-10
Di-dechlorinated Dechlorane Plus	Di-dechlorinated Dechlorane Plus (C10-DP)	0	Organics	FlameRetardants					All			2014-03-13
Dieldrin	Dieldrin	60571	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors		All			2007-07-27
Dieldrin(Surrogate)	Surrogate: Dieldrin	0	Organics	Pesticides								2008-11-17
Dieldrin-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Dieldrin-13C12	0	Organics	Pest-OCHs	IDA				All			2023-10-03
Dienochlor	Dienochlor	0	Organics	Pesticides	Insecticides							2017-04-04
Diesel Fuel	Diesel Fuel	0	Organics									2015-06-25
Diethatyl-Ethyl	Diethatyl-Ethyl	38727558	Organics	Pesticides	Herbicides				All			2007-07-27
Diethyl Phosphate	Diethyl Phosphate (DEP)	598027	Organics	FlameRetardants								2015-07-16
Diethyl phthalate	Diethyl phthalate	84662	Organics	SVOCs					All			2007-07-27
Diethyl-3-methyl-benzamide, N,N-	N,N-Diethyl-3-methyl-benzamide	134623	Organics	PPCPs								2010-04-26
Diethyl-3-methyl-benzamide-d7, N,N-(Surrogate)	Surrogate: N,N-Diethyl-3-methyl-benzamide-d7	0	Organics	PPCPs								2016-10-31
Diethylaniline, 2,6-	2,6-Diethylaniline	579668	Organics	Pesticides								2017-04-10
Diethylstilbestrol	Diethylstilbestrol	0	Organics	PPCPs								2014-01-28
Difenoconazole	Difenoconazole	119446683	Organics	Pesticides	Fungicides							2016-03-10
Difenzoquat Methylsulfate	Difenzoquat Methylsulfate	0	Organics	Pesticides	Herbicides							2017-04-04
Diflubenzuron	Diflubenzuron (Difluron)	35367385	Organics	Pesticides								2013-06-27
Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether, 5,6-(Surrogate)	Surrogate: 5,6-Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether	886748330	Organics	PBDEs					All			2013-05-28
Difluoro-2,2’,3,3’,4,5,5’,6’-Octabromodiphenyl Ether 4’,6-(Surrogate)	Surrogate: 4’,6-Difluoro-2,2’,3,3’,4,5,5’,6’-Octabromodiphenyl Ether	0	Organics	PBDEs								2013-05-28
Difluorobenzene, 1,4-	1,4-Difluorobenzene	0	Organics	VOCs								2016-05-20
Difluorobenzene, 1,4-(Surrogate)	Surrogate: 1,4-Difluorobenzene	540363	Organics	VOCs	Semi-VOAs				All			2014-01-29
Digoxigenin	Digoxigenin	1672464	Organics	PPCPs								2010-04-26
Digoxin	Digoxin	20830755	Organics	PPCPs								2010-04-26
Diisopropyl Ether	Diisopropyl Ether	108203	Organics	SVOCs								2013-05-20
Diisopropylphenyl Diphenyl Phosphate, 2,4-	2,4-Diisopropylphenyl Diphenyl Phosphate (2,4-Di(Propan-2-yl)Phenyl Diphenyl Phosphate) (24DIPPDPP)	96107550	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Dike/Levee Extent	Dike/Levee Extent	0	Habitat						All			2019-05-07
Dike/Levee Intensity	Dike/Levee Intensity	0	Habitat						All			2019-05-07
Dike/Levee Proximity	Dike/Levee Proximity	0	Habitat						All			2019-05-07
Diltiazem	Diltiazem	42399417	Organics	PPCPs								2010-04-26
Dimethipin	Dimethipin	55290647								Organics		2023-08-15
Dimethoate	Dimethoate	60515	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides		All			2007-07-27
Dimethomorph	Dimethomorph	110488705	Organics	Pesticides	Fungicides							2016-03-10
Dimethyl phosphate	Dimethyl Phosphate (DMP)	813785	Organics	FlameRetardants								2015-07-16
Dimethyl phthalate	Dimethyl phthalate	131113	Organics	SVOCs					All			2007-07-27
Dimethyl-2-nitrobenzene, 1,3-	1,3-Dimethyl-2-nitrobenzene	81209	Organics									2011-10-25
Dimethyl-2-nitrobenzene, 1,3-(Surrogate)	Surrogate: 1,3-Dimethyl-2-nitrobenzene (2,6-Dimethylnitrobenzene)	81209	Organics	VOCs					All			2016-03-02
Dimethylarsinic Acid	Dimethylarsinic Acid	0	Organics	Herbicides								2014-01-28
Dimethylchrysene, 5,9-	5,9-Dimethylchrysene	0	Organics	PAHs								2014-01-28
Dimethyldibenzothiophene, 2,4-	2,4-Dimethyldibenzothiophene	0	Organics	PAHs								2014-01-28
Dimethyldibenzothiophene, 4,6-	4,6-Dimethyldibenzothiophene	1207121	Organics	PAHs								2024-03-13
Dimethylfluorene, 1,7-	1,7-Dimethylfluorene	442660	Organics	PAHs	Semi-VOAs				All			2010-07-08
Dimethylnaphthalene, 1,2-	1,2-Dimethylnaphthalene	573988	Organics	PAHs	Semi-VOAs				All			2010-07-08
Dimethylnaphthalene, 1,2,6-	1,2,6-Dimethylnaphthalene	0	Organics	VOCs								2016-05-20
Dimethylnaphthalene, 2,6-	2,6-Dimethylnaphthalene	581420	Organics	PAHs	SVOCs	LMW_PAH			All			2007-07-27
Dimethylnaphthalene, 2,6-(Surrogate)	Surrogate: 2,6-Dimethylnaphthalene	0	Organics	PAHs								2014-01-28
Dimethylnaphthalene-d12, 2,6-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,6-Dimethylnaphthalene-d12	350820121	Organics	PAHs	IDA							2023-11-14
Dimethylnaphthalene-d12, 2,6-(Surrogate)	Surrogate: 2,6-Dimethylnaphthalene-d12	350820121	Organics	PAHs								2025-08-25
Dimethylphenanthrene, 1,5/1,7-	1,5-Dimethylphenanthrene/1,7-Dimethylphenanthrene	0	Organics	PAHs								2014-01-28
Dimethylphenanthrene, 1,7-	1,7-Dimethylphenanthrene	483874	Organics	PAHs								2010-09-23
Dimethylphenanthrene, 1,8-	1,8-Dimethylphenanthrene	0	Organics	PAHs	LMW_PAH							2018-07-24
Dimethylphenanthrene, 2,6-	2,6-Dimethylphenanthrene	0	Organics	PAHs	LMW_PAH							2018-07-24
Dimethylphenanthrene, 3,6-	3,6-Dimethylphenanthrene	1576676	Organics	PAHs	SVOCs	LMW_PAH			All			2007-07-27
Dimethylphenol, 2,4-	2,4-Dimethylphenol	105679	Organics	SVOCs	Phenols	non-Chlorinated Phenols			All			2007-07-27
Dimethylphenol, 2,4-(Surrogate)	Surrogate: 2,4-Dimethylphenol	0	Organics	SVOCs								2016-05-20
Dimethylxanthine, 1,7-	1,7-Dimethylxanthine	611596	Organics	PPCPs								2010-04-26
Di-n-butyl Phthalate	Di-n-butyl Phthalate	84742	Organics	SVOCs	Endocrine Disruptors				All			2013-05-28
Di-n-butyl Phthalate-d4(Surrogate)	Surrogate: Di-n-butyl Phthalate-d4	0	Organics	SVOCs								2014-01-29
Dinitro-2-methylphenol, 4,6-	4,6-Dinitro-2-methylphenol	534521	Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols		All			2007-07-27
Dinitro-2-methylphenol, 4,6-(Surrogate)	Surrogate: 4,6-Dinitro-2-methylphenol	0	Organics	SVOCs								2016-05-20
Dinitrophenol, 2,4-	2,4-Dinitrophenol	51285	Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols		All			2007-07-27
Dinitrophenol, 2,4-(Surrogate)	Surrogate: 2,4-Dinitrophenol	0	Organics	SVOCs								2016-05-20
Dinitrotoluene, 2,4-	2,4-Dinitrotoluene	121142	Organics	SVOCs					All			2007-07-27
Dinitrotoluene, 2,4-(Surrogate)	Surrogate: 2,4-Dinitrotoluene	0	Organics	SVOCs								2016-05-20
Dinitrotoluene, 2,6-	2,6-Dinitrotoluene	606202	Organics	SVOCs					All			2007-07-27
Dinitrotoluene, 2,6-(Surrogate)	Surrogate: 2,6-Dinitrotoluene	0	Organics	SVOCs								2016-05-20
Di-n-octyl Phthalate	Di-n-octyl Phthalate	117840	Organics	SVOCs					All			2013-05-28
Dinonyl-Diphenylamine	Dinonyl-Diphenylamine (ar-Nonyl-N-(Nonylphenyl)-Benzenamine) (SDPA-C9C9)	36878203	Organics	Substituted Diphenylamines (SDPAs)								2026-02-10
Dinoseb	Dinoseb (2,4-Dinitro-6-sec-butylphenol)	88857	Organics	Herbicides					All			2013-07-01
Dinotefuran	Dinotefuran	165252700	Organics	Pesticides	Insecticides							2016-03-10
Dinotefuran-13C5(Surrogate)	Surrogate: Dinotefuran-13C5	0	Organics	Pesticides								2018-08-07
Dinotefuran-d3(Surrogate)	Surrogate: Dinotefuran-d3	0	Organics	Pesticides	Insecticides	Neonicotinoids			All			2025-12-15
Di-n-propylnitrosamine	Di-n-propylnitrosamine	0	Organics	SVOCs								2014-01-29
Dioctyl-Diphenylamine, 4,4'-	4,4'-Dioctyl-Diphenylamine (SDPA-C8C8)	101677	Organics	Substituted Diphenylamines (SDPAs)								2026-02-10
Dioxa-3H-Perfluorononanoic Acid, 4,8-	4,8-Dioxa-3H-Perfluorononanoic Acid (ADONA)	919005144	Organics	PFAS								2025-04-04
Dioxacarb	Dioxacarb (2-(1,3-Dioxolan-2-yl)phenyl Methylcarbamate)	6988212	Organics	Pesticides	Pest-Carbamates	Insecticides			All			2013-07-01
Dioxane, 1,4-	1,4-Dioxane	0										2016-12-23
Dioxathion	Dioxathion	78342	Organics	Pesticides	Pest-OPs	Insecticides			All			2025-08-25
Diphenamid	Diphenamid	957517	Organics	Pesticides	Herbicides				All			2007-07-27
Diphenamid(Surrogate)	Surrogate: Diphenamid	957517	Organics	Pesticides								2016-03-02
Diphenhydramine	Diphenhydramine	58731	Organics	PPCPs								2010-04-26
Diphenyl 4-Isopropylphenyl Phosphate	Diphenyl 4-Isopropylphenyl Phosphate (4-Isopropylphenyl Diphenyl Phosphate) (4IPPDPP)	55864045	Organics	PFAS								2026-02-10
Diphenyl Ether	Diphenyl Ether	0	Organics	VOCs								2014-02-05
Diphenyl phosphate	Diphenyl phosphate (DPP)	838857	Organics	FlameRetardants					All			2014-03-13
Diphenylamine	Diphenylamine	122394	Organics	Pesticides								2014-01-28
Diphenylanthracene, 9,10-	9,10-Diphenylanthracene	0										2019-06-11
Diphenylguanidine,1,3-	1,3-diphenylguanidine	102067	Organics	Amidines					All			2019-12-11
Diphenylhydrazine, 1,2-	1,2-Diphenylhydrazine	0	Organics	PPCPs								2014-01-28
Diphenylhydrazine, 1,2-(Surrogate)	Surrogate: 1,2-Diphenylhydrazine	0	Organics	VOCs								2016-05-20
Diphenylphthalate(Surrogate)	Surrogate: Diphenylphthalate	0	Organics	VOCs								2014-02-05
Dipropetryn	Dipropetryn	4147517	Organics	Pesticides	Pest-Triazines				All			2009-01-12
Diquat	Diquat	85007	Organics	Pesticides								2008-11-17
Direct Septic/Sewage Discharge Extent	Direct Septic/Sewage Discharge Extent	0	Habitat						All			2019-05-07
Direct Septic/Sewage Discharge Intensity	Direct Septic/Sewage Discharge Intensity	0	Habitat						All			2019-05-07
Direct Septic/Sewage Discharge Proximity	Direct Septic/Sewage Discharge Proximity	0	Habitat						All			2019-05-07
Discharge	Discharge from a calculation	0	WaterQualityMeasurements						All			2007-07-27
Discharge Direct Measurement	Discharge Direct Measurement	0	WaterQualityMeasurements	Ancillary								2014-02-05
DischargeMeasurementMethod	Method used to collect discharge (velocity) measurement	0	WaterQualityMeasurements						All			2012-05-22
DischargeMeasurementRating	Code qualifying the stream discharge measurement quality in relation to the actual flow	0	WaterQualityMeasurements						All			2012-05-22
Disodium methylarsonate	Disodium methylarsonate	144218	Organics	Pesticides								2017-04-20
Dissolved Inorganic Carbon	Dissolved Inorganic Carbon (DIC)	7440440	Inorganics	Conventionals					All			2016-05-20
Dissolved Organic Carbon	Dissolved Organic Carbon (DOC)	0	Inorganics	Conventionals					All			2007-07-27
Distance from Bank	Distance from Bank	0	Habitat						All			2009-08-20
Distance to Bankfull	Distance from the wetted edge to the Bankfull mark	0	Habitat						All			2012-09-13
Distance, Float	Float distance of observed object	0	Habitat						All			2009-08-20
Distance, Sampled	Distance sampled within a given waterbody	0	Habitat						All			2012-09-13
Disulfoton	Disulfoton	298044	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Disulfoton Sulfone	Disulfoton Sulfone	0	Organics	Pesticides								2014-01-28
Ditches/Canals Extent	Ditches/Canals Extent	0	Habitat						All			2019-05-07
Ditches/Canals Intensity	Ditches/Canals Intensity	0	Habitat						All			2019-05-07
Ditches/Canals Proximity	Ditches/Canals Proximity	0	Habitat						All			2019-05-07
Dithiopyr	Dithiopyr	97886458	Organics	Pesticides	Herbicides							2016-03-10
Diuron	Diuron	330541	Organics	Pesticides	Pest-Carbamates	Herbicides			All			2007-07-27
Diuron-d6(Surrogate)	Surrogate: Diuron-d6	1007536675	Organics	Pesticides	Pest-Carbamates	Herbicides						2021-10-19
DNOC, sodium salt	DNOC, Sodium salt (4,6-Dinitro-2-methylphenol sodium salt)	2312767	Organics	Pesticides								2017-04-10
Docohexaenoic Acid	Docohexaenoic Acid	0	Organics	Omega Fatty Acid					All			2016-05-20
Docosahexaenoic Acid	Docosahexaenoic Acid	6217545	Organics	Omega Fatty Acid					All			2012-09-12
Docosane, n-	n-Docosane	0	Organics	Alkanes								2014-01-28
Docosapentaenoic Acid	Docosapentaenoic Acid	0	Organics	Omega Fatty Acid					All			2013-05-28
Dodecamethylcyclohexasiloxane	Dodecamethylcyclohexasiloxane	540976										2021-05-19
Dodecane, 2-phenyl-	2-Phenyl-dodecane	0	Organics	VOCs								2016-05-20
Dodecane, 3-phenyl-	3-Phenyl-dodecane	0	Organics	VOCs								2016-05-20
Dodecane, 4-phenyl-	4-Phenyl-dodecane	0	Organics	VOCs								2016-05-20
Dodecane, 5-phenyl-	5-Phenyl-dodecane	0	Organics	VOCs								2016-05-20
Dodecane, 6-phenyl-	6-Phenyl-dodecane	0	Organics	VOCs								2016-05-20
Dodecane, n-	n-Dodecane	0	Organics	Alkanes								2014-01-28
Dodecylammonium Methanearsonate	Dodecylammonium Methanearsonate	0	Organics	Pesticides	Herbicides							2017-04-04
Dodemorph	Dodemorph	0	Organics	Pesticides	Fungicides							2017-04-04
Dodine	Dodine	0	Organics	Pesticides	Fungicides							2017-04-04
Dominant Benthic Substrate	Dominant Benthic Substrate - Specific to EMAP BA	0	Habitat						All			2009-08-20
Dominant Land Use	Dominant Land Use	0	Habitat						All			2009-08-20
DominantSubstrate	DominantSubstrate	0	FieldObservations	Habitat					All			2009-08-20
Domoic Acid	Domoic Acid	14277975	Microbiological	Cyanotoxins					All			2013-05-28
Dotriacontane, n-	n-Dotriacontane	544854	Organics	Alkanes								2013-05-01
Doxycycline	Doxycycline	564250	Organics	PPCPs					All			2012-05-22
Dredging	Dredging	0	Habitat						All			2009-08-20
Dry	Dry	0	Habitat						All			2009-08-20
Dry Weight	Dry Weight	0	Tissue	Ancillary								2014-02-05
Dry Weight Standard Error	Dry Weight Standard Error	0	Tissue	Ancillary								2014-02-05
Dumping	Dumping using Trash Protocol	0	Trash						All			2011-05-04
DW_Algae	Total Dry Weight primarily of Algae but other items may be weighed	0										2020-01-14
E. coli	Escherichia coli	0	Microbiological	Pathogens	Conventionals				All			2007-07-27
E. Coli O157:H7	Escherichia Coli O157:H7 strain	0	Microbiological	Pathogens	Conventionals				All			2013-05-28
Eicosane, n-	n-Eicosane	0	Organics	Alkanes								2014-01-28
Eicosapentaenoate	Eicosapentaenoate	0	Organics	Omega Fatty Acid					All			2012-09-12
ElectricalConductivity	Electrical Conductivity	0	WaterQualityMeasurements	Conventionals					All			2007-07-27
Elevation Difference	Elevation Difference	0	Habitat						All			2009-08-20
Embeddedness	Embeddedness	0	Habitat						All			2009-08-20
Emergent	Emergent (%)	0	Toxicity						All			2007-07-27
Emergent juvenile	Emergent juvenile (#)	0	Toxicity						All			2007-07-27
Enalapril	Enalapril	75847733	Organics	PPCPs								2010-04-26
Enalapril-d5(Surrogate)	Surrogate: Enalapril-d5	0	Organics	PPCPs								2010-04-26
End Time	Time (hh:mm) when a given event ended	0	Habitat						All			2012-09-13
Endosulfan I	Endosulfan I (alpha-Endosulfan)	959988	Organics	Pesticides	Pest-OCHs	Insecticides	Endosulfans		All			2013-05-28
Endosulfan I(Surrogate)	Surrogate: Endosulfan I (alpha-Endosulfan)	0	Organics	Pesticides								2014-01-28
Endosulfan I-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Endosulfan I-13C9	0	Organics	Pest-OCHs	IDA				All			2023-10-03
Endosulfan I-d4(Surrogate)	Surrogate: Endosulfan I-d4 (alpha-Endosuflan-d4)	0	Organics	Pesticides								2013-05-27
Endosulfan II	Endosulfan II (beta-Endosulfan)	33213659	Organics	Pesticides	Pest-OCHs	Insecticides	Endosulfans		All			2013-05-28
Endosulfan II(Surrogate)	Surrogate: Endosulfan II (beta-Endosulfan)	0	Organics	Pesticides								2014-01-28
Endosulfan II-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Endosulfan I-13C9	0	Organics	Pest-OCHs	IDA				All			2023-10-03
Endosulfan II-d4(Surrogate)	Surrogate: Endosulfan II-d4	0	Organics									2017-03-06
Endosulfan Sulfate	Endosulfan Sulfate	1031078	Organics	Pesticides	Pest-OCHs	Insecticides	Endosulfans		All			2013-05-28
Endosulfan Sulfate-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Endosulfan Sulfate-13C9	0	Organics	Pest-OCHs	IDA				All			2023-11-27
Endosulfan Sulfate-13C9(Surrogate)	Surrogate: Endosulfan Sulfate-13C9	0	Organics	VOCs								2016-05-20
Endothall	Endothall	0	Organics	Pesticides	Herbicides							2017-04-04
Endothall, dipotassium salt	Endothall, dipotassium salt	2164070	Organics	Pesticides								2017-04-10
Endothall, mono (N,N-diethyl alkylamine) salt	Endothall, mono (N,N-diethyl alkylamine) salt	0	Organics	Pesticides								2017-04-10
Endothall, mono (N,N-dimethyl alkylamine) salt	Endothall, mono (N,N-dimethyl alkylamine) salt	0	Organics	Pesticides								2017-04-10
Endrin	Endrin	72208	Organics	Pesticides	Pest-OCHs	Insecticides	Endrins		All			2007-07-27
Endrin Aldehyde	Endrin Aldehyde	7421934	Organics	Pesticides	Pest-OCHs	Insecticides	Endrins		All			2007-07-27
Endrin Aldehyde(Surrogate)	Surrogate: Endrin Aldehyde	0	Organics	Pesticides	OrganochlorinePesticides	Semi-VOAs	Insecticides	Endrins	All			2012-09-07
Endrin Aldehyde-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Endrin Aldehyde-13C12	0	Organics	Pest-OCHs	IDA				All			2023-10-03
Endrin Ketone	Endrin Ketone	53494705	Organics	Pesticides	Pest-OCHs	Insecticides	Endrins		All			2007-07-27
Endrin Ketone-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Endrin Ketone-13C12	2483736076										2025-09-04
Endrin Ketone-13C12(Surrogate)	Surrogate: Endrin Ketone-13C12	2483736076	Organics	Pesticides								2025-09-04
Endrin(Surrogate)	Surrogate: Endrin	72208	Organics	Pesticides								2016-03-02
Endrin-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Endrin-13C12	475274998										2025-09-04
Endrin-13C12(Surrogate)	Surrogate: Endrin-13C12	475274998	Organics	Pesticides								2025-09-04
Enrofloxacin	Enrofloxacin	93106606	Organics	PPCPs								2010-04-26
Enterococcus	Enterococcus	0	Microbiological	Pathogens	Conventionals				All			2007-07-27
Enterococcus casseliflavus, Prokaryotic DNA (16S)	Enterococcus casseliflavus, Prokaryotic DNA, Target gene: 16S, 5’-GGAGCTTGCTCCACCGAA-3’, 5’-TTTCTTCCATGCGGAAAATAGT-3’	0	Microbiological									2026-04-20
Enterococcus faecalis, Prokaryotic DNA (16S)	Enterococcus faecalis, Prokaryotic DNA, Target gene: 16S, 5’-CGCTTCTTTCCTCCCGAGT-3’, 5’-GCCATGCGGCATAAACTG-3’	0	Microbiological									2026-04-20
Enterococcus faecium, Prokaryotic DNA (16S)	Enterococcus faecium, Prokaryotic DNA, Target gene: 16S, 5’-TTCTTTTTCCACCGGAGCTT-3’, 5’-AACCATGCGGTTTYGATTG-3’	0	Microbiological									2026-04-20
Enterovirus		0										2018-02-13
Epitestosterone	Epitestosterone	481301										2018-08-31
EPN	EPN	2104645	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
EPN(Surrogate)	Surrogate: EPN	2104645	Organics	Pesticides	OrganophosphatePest.	Semi-VOAs	Insecticides	Endrins				2013-01-31
EPTC	EPTC	759944	Organics	Pesticides	Herbicides				All			2007-07-27
EPTC(Surrogate)	Surrogate: EPTC	759944	Organics	Pesticides	Herbicides							2016-03-02
Erythromycin	Erythromycin	114078										2021-05-07
Erythromycin-H2O	Erythromycin-H2O	0	Organics	PPCPs					All			2012-05-22
Erythromycin-H2O-13C2(Surrogate)	Surrogate: Erythromycin-H2O-13C2	0	Organics	PPCPs								2010-04-26
Esfenvalerate	Esfenvalerate	66230044	Organics	Pesticides					All			2016-05-20
Esfenvalerate/Fenvalerate, Total	Total Esfenvalerate/Fenvalerate, sum peaks 1 & 2	51630581	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Esfenvalerate/Fenvalerate-1	Esfenvalerate/Fenvalerate peak 1	51630581	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Esfenvalerate/Fenvalerate-2	Esfenvalerate/Fenvalerate peak 2	66230404	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Esfenvalerate-d6, Total(Surrogate)	Surrogate: Total Esfenvalerate-d6, sum peaks 1 & 2	0	Organics	Pesticides	Pyrethroids	Insecticides						2026-05-08
Esfenvalerate-d6-1(Surrogate)	Surrogate: Esfenvalerate-d6 peak 1	0	Organics	Pesticides	Insecticides	Pyrethroids			All			2012-12-13
Esfenvalerate-d6-2(Surrogate)	Surrogate: Esfenvalerate-d6 peak 2	0	Organics	Pesticides	Insecticides	Pyrethroids			All			2013-10-29
EstFishSize	Estimated fish size observed	0	FieldObservations	Habitat								2026-06-05
Estradiol, 17alpha-	17alpha-Estradiol	57910										2018-08-31
Estradiol, 17beta-	17beta-Estradiol	50282	Organics	PPCPs					All			2013-05-28
Estradiol-d3, 17beta-(IsoDilAnalogue)	Isotope Dilution Analogue: 17beta-Estradiol-d3	79037379	Organics									2022-07-22
Estriol	Estriol	50271										2018-08-31
Estriol-d2(Surrogate)	Surrogate: Estriol-d2	53866323										2022-05-24
Estrone	Estrone	53167	Organics	PPCPs					All			2012-08-15
Ethaboxam	Ethaboxam	162650773	Organics	Pesticides	Fungicides							2016-03-10
Ethafluralin	Ethalfluralin	55283686	Organics	Pesticides	Herbicides							2013-05-30
Ethalfluralin	Ethalfluralin	55283686	Organics	Pesticides	Herbicides				All			2007-07-27
Ethanol	Ethanol (Ethyl Alcohol)	0	Organics	Pesticides								2017-04-04
Ethion	Ethion	563122	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Ethion monoxon	Ethion monoxon	17356422	Organics	Pesticides								2017-04-20
Ethion(Surrogate)	Surrogate: Ethion	563122	Organics	Pesticides	OrganophosphatePest.	OrganochlorinePesticides	Semi-VOAs	Insecticides				2016-03-02
Ethiprole(Surrogate)	Ethiprole(Surrogate)	181587019	Organics	Pesticides	Insecticides	Phenylpyrazoles						2024-06-05
Ethofumesate	Ethofumesate	0	Organics	Pesticides								2017-04-04
Ethoprop	Ethoprop (Prophos)	13194484	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides		All			2007-07-27
Ethyl Ether	Ethyl Ether	60297	Organics	VOCs								2013-05-20
Ethyl Perfluorooctane Sulfonamido Acetic Acid, N-	N-Ethyl Perfluorooctane Sulfonamido Acetic Acid (Et-PFOSA-AcOH)	0	Organics	PFAS	PFC Precursor							2014-10-20
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(Surrogate)	Surrogate: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5	0	Organics	PFAS	PFC Precursor							2014-11-03
Ethyl Perfluorooctanesulfonamide, N-	N-Ethyl Perfluorooctanesulfonamide (NEtFOSA)	4151502	Organics	PFAS								2025-01-27
Ethyl Perfluorooctanesulfonamide-d5, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctanesulfonamide-d5 (NEtFOSA-d5)	936109409	Organics	PFAS	IDA				All			2025-04-04
Ethyl Perfluorooctanesulfonamidoacetic Acid, N-	N-Ethyl Perfluorooctanesulfonamidoacetic Acid (NEtFOSAA)	2991506	Organics	PFAS								2025-03-12
Ethyl Perfluorooctanesulfonamidoacetic Acid-d5, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctanesulfonamidoacetic Acid-d5 (NEtFOSAA-d5)	1265205977	Organics	PFAS	IDA				All			2025-04-04
Ethyl Perfluorooctanesulfonamidoethanol, N-	N-Ethyl Perfluorooctanesulfonamidoethanol (NEtFOSE)	1691992	Organics	PFAS								2025-01-27
Ethyl Perfluorooctanesulfonamidoethanol-d9, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctanesulfonamidoethanol-d9 (NEtFOSE-d9)	1265205966	Organics	PFAS	IDA				All			2025-04-04
Ethyl Tert-butyl Ether	Ethyl Tert-butyl Ether (ETBE)	637923	Organics	VOCs					All			2013-05-28
Ethyl-6-methylaniline, 2-	2-Ethyl-6-methylaniline	24549062	Organics	Pesticides								2017-04-10
Ethylan	Ethylan	0	Organics	Pesticides	Insecticides							2017-04-04
Ethylbenzene	Ethylbenzene	100414	Organics	VOCs	MTBE_BTEX				All			2007-07-27
Ethylene bis(tetrabromophthalimide)	Ethylene bis(tetrabromophthalimide) (EBTEBPI)	32588764	Organics	FlameRetardants					All			2014-03-13
Ethylene Glycol	Ethylene Glycol	107211								Organics		2016-10-21
Ethylene Thiourea	Ethylene Thiourea	0	Organics	Pesticides								2017-04-04
Ethylene/vinyl Acetate Co-polymer Fiber	Ethylene/vinyl acetate copolymer Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Ethylene/vinyl Acetate Co-polymer Film	Ethylene/vinyl acetate copolymer Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Ethylene/vinyl Acetate Co-polymer Foam	Ethylene/vinyl acetate copolymer Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Ethylene/vinyl Acetate Co-polymer Fragment	Ethylene/vinyl acetate copolymer Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Ethylene/vinyl Acetate Co-polymer Sphere	Ethylene/vinyl acetate copolymer Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Ethylene-propylene copolymer fragment	Ethylene-propylene copolymer fragment that can be grouped under the plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-06-18
Ethylhexyl 2,3,4,5-tetrabromobenzoate, 2-	2-Ethylhexyl 2,3,4,5-tetrabromobenzoate	183658277	Organics	FlameRetardants								2010-07-15
Ethylparaben	Ethylparaben	120478										2021-05-07
Ethyl-perfluorooctanesulfonamide, N-	N-Ethyl-perfluorooctanesulfonamide	0	Organics	PFAS								2010-02-23
Ethyl-perfluorooctanesulfonamide-d5, N-(Surrogate)	Surrogate: Ethyl-perfluorooctanesulfonamide-d5, N- (N-EtFOSA)	0	Organics	PFAS								2021-06-02
Ethyl-perfluorooctanesulfonamidoethanol, N-	N-Ethyl-perfluorooctanesulfonamidoethanol	0	Organics	PFAS								2010-02-23
Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(Surrogate)	Surrogate: Ethyl-perfluorooctanesulfonamidoethanol-d9, N- (N-EtFOSE)	0	Organics	PFAS								2021-06-02
Ethynylestradiol, 17alpha-	17alpha-Ethynylestradiol	57636										2018-08-31
Ethynylestradiol-d4, 17alpha-(IsoDilAnalogue)	Isotope Dilution Analogue: 17alpha-Ethynylestradiol-d4	350820063	Organics									2022-07-22
Ethynylestradiol-d4, 17alpha-(Surrogate)	Surrogate: 17alpha-Ethynylestradiol-d4	350820063										2022-05-24
Etofenprox	Etofenprox	80844071	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-06-19
Etoxazole	Etoxazole	153233911	Organics									2018-07-16
Europium	Europium	7440531	Inorganics									2013-05-20
Ev_FlowHab	Evenness of flow habitat types physical-habitat metric	0	Bioassessment						All			2021-01-28
Evidence of Fire	Evidence of Fire	0	Habitat						All			2009-08-20
Evidence of Fire Intensity	Evidence of Fire Intensity - Specific to EMAP BA	0	Habitat						All			2009-08-27
Evidence of Illegal Connection	Evidence of Illegal Connection	0										2016-06-13
Evidence of Illegal Dumping	Evidence of Illegal Dumping	0										2016-06-13
Evidence of Recent Rainfall	Evidence of Recent Rainfall	0	Habitat						All			2009-08-20
Evidence of Scour	Site is affected by recent scouring event	0	Habitat	FieldObservations								2016-02-24
E-waste	E-waste	0	Debris	Trash	Plastics	Toxic			All			2014-11-04
Excavation Extent	Excavation Extent	0	Habitat						All			2019-05-07
Excavation Intensity	Excavation Intensity	0	Habitat						All			2019-05-07
Excavation Proximity	Excavation Proximity	0	Habitat						All			2019-05-07
Excess Animal Waste Extent	Excess Animal Waste Extent	0	Habitat						All			2019-05-07
Excess Animal Waste Intensity	Excess Animal Waste Intensity	0	Habitat						All			2019-05-07
Excess Animal Waste Proximity	Excess Animal Waste Proximity	0	Habitat						All			2019-05-07
Excess Sediment Input Other Extent	Excess Sediment Input Other Extent	0	Habitat						All			2019-05-07
Excess Sediment Input Other Intensity	Excess Sediment Input Other Intensity	0	Habitat						All			2019-05-07
Excess Sediment Input Other Proximity	Excess Sediment Input Other Proximity	0	Habitat						All			2019-05-07
Excessive Human Visitation Extent	Excessive Human Visitation Extent	0	Habitat						All			2019-05-07
Excessive Human Visitation Intensity	Excessive Human Visitation Intensity	0	Habitat						All			2019-05-07
Excessive Human Visitation Proximity	Excessive Human Visitation Proximity	0	Habitat						All			2019-05-07
Fabric	Fabric	0	Debris	Trash	Non-Plastics	Biodegradable			All			2014-11-04
FabricCloth	Fabric Cloth using Trash Protocol	0	Trash						All			2011-05-04
Fallow Fields Extent	Fallow Fields Extent	0	Habitat						All			2019-05-07
Fallow Fields Intensity	Fallow Fields Intensity	0	Habitat						All			2019-05-07
Fallow Fields Proximity	Fallow Fields Proximity	0	Habitat						All			2019-05-07
Famoxadone	Famoxadone	131807573	Organics	Pesticides	Fungicides							2016-03-10
Famphur	Famphur	52857	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
FBDE 069	Fluorobrominated Diphenyl Ether (FBDE) 069 (4′-Fluoro-2,3′,4,6-tetrabromodiphenyl ether)	863314878	Organics									2023-10-20
FBDE 160	Fluorobrominated Diphenyl Ether (FBDE) 160 (4′-Fluoro-2,3,3′,4,5,6-hexabromodiphenyl ether)	863314889	Organics									2023-10-20
Fenamidone	Fenamidone	161326347	Organics	Pesticides	Fungicides							2016-03-10
Fenamiphos	Fenamiphos (Phosphoramidic acid, Isopropyl-, 4-(methylthio)-m-tolyl Ethyl Ester)	22224926	Organics	Pesticides	Pest-Ops	Insecticides			All			2013-05-28
Fenamiphos sulfone	Fenamiphos sulfone	31972448	Organics	Pesticides								2017-04-20
Fenamiphos sulfoxide	Fenamiphos sulfoxide	31972437	Organics	Pesticides								2017-04-20
Fenarimol	Fenarimol	60168889	Organics	Pesticides	Fungicides							2016-03-10
Fenbuconazole	Fenbuconazole	114369436	Organics	Pesticides	Fungicides							2016-03-10
Fenbutatin-Oxide	Fenbutatin-Oxide	0	Organics	Pesticides	Insecticides							2017-04-04
Fenchlorphos	Fenchlorphos (Ronnel)	299843	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Fenhexamid	Fenhexamid	126833178	Organics	Pesticides	Fungicides							2016-03-10
Fenitrothion	Fenitrothion	122145	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Fenoxycarb	Fenoxycarb	0	Organics	Pesticides	Insecticides							2017-04-04
Fenpropathrin	Fenpropathrin (Danitol)	39515418	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Fenpropathrin-d6(Surrogate)	Surrogate: Fenpropathrin-d6	0	Organics	Pesticides	Pyrethroids	Insecticides						2026-05-08
Fenpyroximate	Fenpyroximate	134098616	Organics	Pesticides	Insecticides							2016-03-10
Fensulfothion	Fensulfothion	115902	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides		All			2007-07-27
Fenthion	Fenthion (Mercaptophos)	55389	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Fenuron	Fenuron	101428	Organics	Pesticides	Herbicides				All			2007-07-27
Fenuron trichloroacetate	Fenuron trichloroacetate	4482557	Organics	Pesticides								2017-04-20
Fenvalerate	Fenvalerate	51630581	Organics	Pesticides					All			2016-05-20
Fenvalerate-d5(Surrogate)	Surrogate: Fenvalerate-d5	0	Organics	Pesticides	Pyrethroids	Insecticides						2026-05-08
Fenvalerate-d6, Total(Surrogate)	Surrogate: Total Fenvalerate-d6	82523668	Organics	Pesticides	Pyrethroids	Insecticides						2026-06-04
Feral Pig Disturbance Extent	Feral Pig Disturbance Extent	0	Habitat						All			2019-05-07
Feral Pig Disturbance Intensity	Feral Pig Disturbance Intensity	0	Habitat						All			2019-05-07
Feral Pig Disturbance Proximity	Feral Pig Disturbance Proximity	0	Habitat						All			2019-05-07
Ferbam	Ferbam	0	Organics	Pesticides	Fungicides							2017-04-04
Fertilization	Fertilization (%)	0	Toxicity						All			2007-07-27
Fertilized eggs per nest	Fertilized eggs per nest (#)	0	Toxicity						All			2007-07-27
Filling Time	Time to fill a collection device with water	0	Habitat						All			2009-08-27
FinalSampleExtVolume	Final post-processing volume	0	Laboratory	Ancillary								2014-02-05
Fine	Fine	0	Inorganics	Conventionals	GrainSize				All			2011-09-08
Fine_AS (<0.075 mm)	Fine_ASTM Scale (<0.075 mm)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Fipronil	Fipronil	120068373	Organics	Pesticides	Insecticides				All			2009-08-19
Fipronil Amide	Fipronil Amide	0	Organics	Pesticides	Insecticides				All			2014-11-03
Fipronil Desulfinyl	Fipronil Desulfinyl	205650653	Organics	Pesticides	Insecticides				All			2013-05-28
Fipronil Desulfinyl Amide	Fipronil Desulfinyl Amide	1115248093	Organics	Pesticides	Insecticides				All			2014-11-03
Fipronil Desulfinyl-13C4 15N2(Surrogate)	Surrogate: Fipronil Desulfinyl-13C4 15N2	0	Organics	Pesticides	Fipronils							2019-06-03
Fipronil desulfinyl-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil desulfinyl-13C4,15N2	0	Organics	Pesticides	Insecticides	Fipronils	IDA		All			2023-10-25
Fipronil DetrifluoroMethylsulfinyl	Fipronil DetrifluoroMethylsulfinyl	120068793	Organics	Pesticides	Fipronils							2018-07-26
Fipronil Detrifluoromethylsulfinyl-13C4 15N2(Surrogate)	Surrogate: Fipronil Detrifluoromethylsulfinyl-13C4 15N2	0	Organics	Pesticides	Fipronils							2019-06-03
Fipronil detrifluoromethylsulfinyl-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil detrifluoromethylsulfinyl-13C4,15N2	0	Organics	Pesticides	Insecticides	Fipronils	IDA		All			2023-10-25
Fipronil Sulfide	Fipronil Sulfide	120067836	Organics	Pesticides	Insecticides				All			2009-08-19
Fipronil Sulfide-13C4 15N2(Surrogate)	Surrogate: Fipronil Sulfide-13C4 15N2	0	Organics	Pesticides	Fipronils							2019-06-03
Fipronil sulfide-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil sulfide-13C2,15N2	0	Organics	Pesticides	Insecticides	Fipronils	IDA		All			2023-10-25
Fipronil Sulfone	Fipronil Sulfone	120068362	Organics	Pesticides	Insecticides				All			2013-05-28
Fipronil Sulfone-13C4 15N2(Surrogate)	Surrogate: Fipronil Sulfone-13C4 15N2	0	Organics	Pesticides	Fipronils							2019-06-03
Fipronil sulfone-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil sulfone-13C4,15N2	0	Organics	Pesticides	Insecticides	Fipronils	IDA		All			2023-10-25
Fipronil-13C4 15N2(Surrogate)	Surrogate: Fipronil-13C4 15N2	0	PESTICIDES	Fipronils								2016-10-05
Fipronil-13C4(Surrogate)	Surrogate: Fipronil-13C4	0										2021-02-12
Fipronil-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil-13C2,15N2	0	Organics	Pesticides	Insecticides	Fipronils	IDA		All			2023-10-25
Fipronil-C13(Surrogate)	Surrogate: Fipronil-C13	0	Organics	Pesticides								2018-03-04
Fire Breaks Extent	Fire Breaks Extent	0	Habitat						All			2019-05-07
Fire Breaks Intensity	Fire Breaks Intensity	0	Habitat						All			2019-05-07
Fire Breaks Proximity	Fire Breaks Proximity	0	Habitat						All			2019-05-07
Fireworks	Fireworks	0	Debris	Trash	Non-Plastics	Toxic			All			2014-11-04
Fish Cover Artificial Structures	Fish Cover/Instream Habitat Complexity – Other Artificial Structures	0	Habitat						All			2009-08-20
Fish Cover Boulders	Fish Cover/Instream Habitat Complexity – Other Boulders	0	Habitat						All			2009-08-20
Fish Cover Filamentous Algae	Fish Cover/Instream Habitat Complexity - Other Filamentous Algae	0	Habitat						All			2009-08-20
Fish Cover Live Trees/Roots	Fish Cover/Instream Habitat Complexity – Other Live Trees or Roots	0	Habitat						All			2009-08-20
Fish Cover Macrophytes	Fish Cover/Instream Habitat Complexity - Macrophytes	0	Habitat						All			2009-08-20
Fish Cover Overhang.Veg	Fish Cover/Instream Habitat Complexity – Other Overhanging Vegetation =<1 m of surface	0	Habitat						All			2009-08-20
Fish Cover Undercut Banks	Fish Cover/Instream Habitat Complexity – Other Undercut Banks	0	Habitat						All			2009-08-20
Fish Cover Woody Debris <0.3 m	Fish Cover/Instream Habitat Complexity – Other Woody Debris <0.3 m	0	Habitat						All			2009-08-20
Fish Cover Woody Debris >0.3 m	Fish Cover/Instream Habitat Complexity – Other Woody Debris >0.3 m	0	Habitat						All			2009-08-20
Fish Stocking	Fish Stocking	0	Habitat						All			2009-08-20
Fishing Line/Net	Fishing Line/Net	0	Debris	Trash	Plastics	Miscellaneous			All			2014-11-04
Float Time	Float time of observed object	0	Habitat						All			2009-12-10
Floatables	Floatables	0	Habitat									2014-04-17
Flonicamid	Flonicamid	158062670	Organics	Pesticides	Insecticides							2016-03-10
Florpyrauxifen-Benzyl	Florpyrauxifen-Benzyl	1390661729	Organics						All			2022-10-28
Flow Diversions Extent	Flow Diversions Extent	0	Habitat						All			2019-05-07
Flow Diversions Intensity	Flow Diversions Intensity	0	Habitat						All			2019-05-07
Flow Diversions Proximity	Flow Diversions Proximity	0	Habitat						All			2019-05-07
Fluazifop-P-butyl	Fluazifop-P-butyl	0	Organics	Pesticides	Herbicides							2017-04-04
Fluazinam	Fluazinam	79622596	Organics	Pesticides	Fungicides							2016-03-10
Flubendiamide	Flubendiamide	272451657	Organics									2018-07-16
Fluchloralin	Fluchloralin	0	Organics	Pesticides	Herbicides							2017-04-04
Flucythrinate	Flucythrinate	70124775	Organics	Pesticides	Pyrethroids	Insecticides						2026-05-08
Fludioxonil	Fludioxonil	131341861	Organics	Pesticides	Fungicides							2016-03-10
Flufenacet	Flufenacet	142459583	Organics	Pesticides	Herbicides							2016-03-10
Fluindapyr	Fluindapyr	1383809877	Organics						All			2022-10-28
Flumequine	Flumequine	42835256	Organics	PPCPs								2010-04-26
Flumetralin	Flumetralin	62924703	Organics	Pesticides	Herbicides							2016-03-10
Flumetsulam	Flumetsulam	98967409	Organics	Herbicides								2013-05-20
Flumioxazin	Flumioxazin	103361097	Organics	Pesticides								2018-03-21
Fluocinonide	Fluocinonide	356127	Organics	PPCPs								2010-04-26
Fluometuron	Fluometuron	2164172	Organics	Pesticides	Herbicides				All			2007-07-27
Fluopicolide	Fluopicolide	239110157	Organics	Pesticides	Fungicides							2016-03-10
Fluopyram	Fluopyram	658066354	Organics	Pesticides	Fungicides							2017-06-07
Fluoranthene	Fluoranthene	206440	Organics	PAHs	SVOCs	HMW_PAH			All			2007-07-27
Fluoranthene/Pyrenes, C1-	C1-Fluoranthene/Pyrenes	0	Organics	PAHs	SVOCs	HMW_PAH			All			2010-06-21
Fluoranthene-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Fluoranthene-d10	93951690	Organics	PAHs	IDA							2023-11-14
Fluoranthene-d10(Surrogate)	Surrogate: Fluoranthene-d10	93951690	Organics	PAHs								2025-08-25
Fluoranthenes/Pyrenes, C2-	C2-Fluoranthenes/Pyrenes	0	Organics	PAHs					All			2014-01-28
Fluoranthenes/Pyrenes, C3-	C3-Fluoranthenes/Pyrenes	0	Organics	PAHs					All			2014-01-28
Fluoranthenes/Pyrenes, C4-	C4-Fluoranthenes/Pyrenes	0	Organics	PAHs	Alkylated PAHs							2018-07-24
Fluorene	Fluorene	86737	Organics	PAHs	SVOCs	LMW_PAH			All			2007-07-27
Fluorene-d10(Surrogate)	Surrogate: Fluorene-d10	0	Organics	PAHs								2014-01-28
Fluorenes, C1-	C1-Fluorenes	0	Organics	PAHs	SVOCs	LMW_PAH			All			2010-06-21
Fluorenes, C2-	C2-Fluorenes	0	Organics	PAHs	SVOCs	LMW_PAH			All			2010-06-21
Fluorenes, C3-	C3-Fluorenes	0	Organics	PAHs	SVOCs	LMW_PAH			All			2010-06-21
Fluorescence	Fluorescence	0	WaterQualityMeasurements						All			2012-05-22
Fluorescence, Daily Mean	Daily Mean Fluorescence (Calculated)	0	WaterQualityMeasurements	Conventionals					All			2024-09-06
Fluoridamid	Fluoridamid (Acetamide)	0	Organics	Pesticides	Herbicides							2017-04-04
Fluoride	Fluoride	16984488	Inorganics	Conventionals					All			2007-07-27
Fluoro(Perfluoro-2-(Perfluoro-2-Sulfoethoxy)Propoxy)Acetic Acid	Fluoro(Perfluoro-2-(Perfluoro-2-Sulfoethoxy)Propoxy)Acetic Acid (Hydrolyzed PSDA) (Nafion Byproduct 5)	2416366191	Organics	PFAS								2026-02-10
Fluoro-2,3,3',4,5,6-Hexabromodiphenyl Ether, 4'-(Surrogate)	Surrogate: 4'-Fluoro-2,3,3',4,5,6-Hexabromodiphenyl Ether (FBDE 160)	863314889	Organics									2025-11-25
Fluoro-2,3',4,6-Tetrabromodiphenyl Ether, 4'-(Surrogate)	Surrogate: 4'-Fluoro-2,3',4,6-Tetrabromodiphenyl Ether (FBDE 069)	863314878	Organics									2025-11-25
Fluoro-2,3',6-Tribromodiphenyl Ether, 4'-(Surrogate)	Surrogate: 4'-Fluoro-2,3',6-tribromodiphenyl Ether	863314867	Organics	PBDEs					All			2013-05-28
Fluorobenzene	Fluorobenzene	462066	Organics	Organofluorides					All			2010-11-01
Fluorobenzene(Surrogate)	Surrogate: Fluorobenzene	462066										2020-07-15
Fluorobiphenyl, 2-	2-Fluorobiphenyl	321608	Organics	SVOCs								2016-05-20
Fluorobiphenyl, 2-(Surrogate)	Surrogate: 2-Fluorobiphenyl	321608	Organics	VOCs								2016-03-02
Fluoroelastomer Fiber	Fluoroelastomer Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Fluoroelastomer Fiber Bundle	Fluoroelastomer Fiber Bundle	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Fluorophenol, 2-	2-Fluorophenol	367124	Organics	VOCs								2016-05-20
Fluorophenol, 2-(Surrogate)	Surrogate: 2-Fluorophenol	367124	Organics	VOCs	Phenols	non-Chlorinated Phenols						2016-03-02
Fluorotelomer Carboxylic Acid, 3:3-	3:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorohexanoic acid) (3:3 FTCA)	356025	Organics	PFAS								2021-06-02
Fluorotelomer Carboxylic Acid, 5:3-	5:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorooctanoic acid) (5:3 FTCA)	914637493	Organics	PFAS								2021-06-02
Fluorotelomer Carboxylic Acid, 7:3-	7:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorodecanoic acid) (7:3 FTCA)	812704	Organics	PFAS								2021-06-02
Fluorotelomer Carboxylic Acid-13C2, 10:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 10:2-Fluorotelomer Carboxylic Acid-13C2 (2-Perfluorodecyl Ethanoic Acid-13C2) (10:2 FTCA-13C2)	0	Organics	PFAS	PFC Precursor	IDA						2026-02-10
Fluorotelomer Carboxylic Acid-13C2, 6:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 6:2-Fluorotelomer Carboxylic Acid-13C2 (2-Perfluorohexyl Ethanoic Acid-13C2) (6:2 FTCA-13C2)	0	Organics	PFAS	PFC Precursor	IDA						2026-02-10
Fluorotelomer Carboxylic Acid-13C2, 8:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 8:2-Fluorotelomer Carboxylic Acid-13C2 (2-Perfluorooctyl Ethanoic Acid-13C2) (8:2 FTCA-13C2)	0	Organics	PFAS	PFC Precursor	IDA						2026-02-10
Fluorotelomer Phosphate Diester, 10:2-	10:2-Fluorotelomer Phosphate Diester (10:2 diPAP)	1895267	Organics	PFAS	PFC Precursor							2026-02-10
Fluorotelomer Phosphate Diester, 6:2/8:2-	6:2/8:2 Fluorotelomer Phosphate Diester (6:2/8:2-diPAP)	943913153	Organics	PFAS	PFC Precursor							2026-02-10
Fluorotelomer Unsaturated Carboxylic Acid, 10:2-	10:2-Fluorotelomer Unsaturated Carboxylic Acid (FTuCA)	0	Organics	PFAS	PFC Precursor							2014-10-20
Fluorotelomer Unsaturated Carboxylic Acid, 6:2-	6:2-Fluorotelomer Unsaturated Carboxylic Acid (FTuCA)	0	Organics	PFAS	PFC Precursor							2014-10-20
Fluorotelomer Unsaturated Carboxylic Acid, 8:2-	8:2-Fluorotelomer Unsaturated Carboxylic Acid (FTuCA)	0	Organics	PFAS	PFC Precursor							2014-10-20
Fluorotelomer Unsaturated Carboxylic Acid-13C2, 10:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 10:2-Fluorotelomer Unsaturated Carboxylic Acid-13C2 (2H-Perfluoro-2-Dodecenoic Acid-13C2) (10:2 FTuCA-13C2)	0	Organics	PFAS	PFC Precursor	IDA						2026-02-10
Fluorotelomer Unsaturated Carboxylic Acid-13C2, 10:2-(Surrogate)	Surrogate: 10:2-Fluorotelomer Unsaturated Carboxylic Acid-13C2	0	Organics	PFAS	PFC Precursor							2014-11-03
Fluorotelomer Unsaturated Carboxylic Acid-13C2, 6:2-(Surrogate)	Surrogate: 6:2-Fluorotelomer Unsaturated Carboxylic Acid-13C2	0	Organics	PFAS	PFC Precursor							2014-11-03
Fluorotelomer Unsaturated Carboxylic Acid-13C2, 8:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 8:2-Fluorotelomer Unsaturated Carboxylic Acid-13C2 (2H-Perfluoro-2-Decenoic Acid-13C2) (8:2 FTuCA-13C2)	0	Organics	PFAS	PFC Precursor	IDA						2026-02-10
Fluoxastrobin	Fluoxastrobin	361377299	Organics	Pesticides	Fungicides							2025-08-25
Fluoxetine	Fluoxetine	54910893	Organics	PPCPs					All			2012-05-22
Fluoxetine-d5(Surrogate)	Surrogate: Fluoxetine-d5	0	Organics	PPCPs								2010-04-26
Flupyradifurone	Flupyradifurone	951659408	Organics	Pesticides	Insecticides							2018-01-03
Fluridone	Fluridone	59756604	Organics	Pesticides								2008-11-17
Fluridone(Surrogate)	Surrogate: Fluridone	59756604	Organics	Pesticides	Herbicides				All			2026-05-08
Flusilazole	Flusilazole	85509199	Organics	Pesticides	Fungicides							2016-03-10
Fluticasone Propionate	Fluticasone Propionate	80474142	Organics	PPCPs								2013-05-29
Flutolanil	Flutolanil	66332965	Organics	Fungicides								2016-05-20
Flutriafol	Flutriafol	76674210	Organics	Pesticides	Fungicides							2016-03-10
Fluvalinate	Fluvalinate	0	Organics	Pesticides								2016-05-20
Fluxapyroxad	Fluxapyroxad	907204313	Organics	Pesticides	Fungicides							2016-03-10
Foam Ball	Foam Ball	0	Debris	Trash	Plastics	Miscellaneous			All			2014-11-04
Foliose Algae	Foliose Algae	0	Debris	Trash	Non-Plastics	Marine Origin			All			2014-11-04
Folpet	Folpet	133073	Organics	Pesticides	Fungicides							2016-10-25
Fonofos	Fonofos (Dyfonate)	944229	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Fonofos(Surrogate)	Surrogate: Fonofos	0	Organics	Pesticides	OrganophosphatePest.	Insecticides						2011-07-15
Fonofos-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Fonofos-13C6	0	Organics	Pest-OPs	IDA				All			2023-10-03
Food Service	Food Service	0	Debris	Trash	Plastics				All			2014-11-05
Food Service, Other	Food Service, Other	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
Forest Dominant Age Class	Forest Dominant Age Class	0	Habitat						All			2009-08-20
Formaldehyde	Formaldehyde (Methanal)	0	Organics	Pesticides								2017-04-04
Formate	Formate	0	Organics									2017-05-03
Formate(Surrogate)	Surrogate: Formate	0	Organics									2017-08-10
Formetanate hydrochloride	Formetanate hydrochloride	0	Organics	Pesticides	Insecticides							2017-04-04
Fosetyl-al, Technical	Fosetyl-aluminum, Technical	39148248	Organics	Pesticides								2017-04-10
FPOM	Fine particulate organic matter	0	Habitat						All			2012-09-12
Furniture	Furniture	0	Debris	Trash	Plastics	Non-Plastics	Household	Large	All			2014-11-04
Furosemide	Furosemide	54319	Organics	PPCPs								2010-04-26
Gadolinium	Gadolinium	7440542	Inorganics	Metals								2018-08-28
Gage Height	Water surface level measured against a staff gage within a given waterbody	0	Habitat						All			2012-12-04
Galaxolide	Galaxolide	0	Organics	Pesticides								2008-06-27
Galaxolide-d6(Surrogate)	Galaxolide-d6(Surrogate)	0	Organics	PPCPs					All			2022-01-04
Gallium	Gallium	7440553	Inorganics									2013-05-20
Garbage Bag of Trash	Garbage Bag of Trash	0	Debris	Trash	Non-Plastics	Large			All			2014-11-04
Gasoline	Gasoline	0	Organics									2010-08-10
Gasterosteus aculeatus (Gaac)	Gasterosteus aculeatus, Assay name: Gaac, 5’ ACGCCACCTTAACACGTTTC 3’, 5’ AGAGCCTGTCTGGTGAAGG 3’, 5FAM-CTGGTGCCACACTTGTTCAC-3IABkFQ	0	Microbiological									2023-12-22
Gemfibrozil	Gemfibrozil	25812300	Organics	PPCPs					All			2012-05-22
Gemfibrozil-d6(IsoDilAnalogue)	Isotope Dilution Analogue: Gemfibrozil-d6	1184986455	Organics									2022-07-22
Gemfibrozil-d6(Surrogate)	Surrogate: Gemfibrozil-d6	1184986455	Organics	PPCPs					All			2025-09-04
Geosmin	Geosmin	19700211	Organics	Terpenes/Terpinoids								2025-11-05
Germination	Germination (%)	0	Toxicity						All			2007-07-27
Giardia	Giardia	0	Microbiological	Pathogens	Conventionals				All			2013-05-28
Giardia Cysts Fluorescence Antibody	Giardia Cysts Fluorescence Antibody	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts Negative	Giardia Cysts Negative	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/Amorphous Structure	Giardia Cysts/Amorphous Structure	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/DAPI & DIC Positive	Giardia Cysts/DAPI & DIC Positive	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/Empty	Giardia Cysts/Empty	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/Flourescence Antibody	Giardia Cysts/Flourescence Antibody	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/Internal Structure	Giardia Cysts/Internal Structure	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/Internal Structure (>One)	Giardia Cysts/Internal Structure (>One)	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/Internal Structure (One)	Giardia Cysts/Internal Structure (One)	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/Internal Structures (>One)	Giardia Cysts/Internal Structures (>One)	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/Negative	Giardia Cysts/Negative	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/Positive	Giardia Cysts/Positive	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/Positive (Internal Staining)	Giardia Cysts/Positive (Internal Staining)	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/Positive (Stained Nuclei)	Giardia Cysts/Positive (Stained Nuclei)	0	Microbiological	Pathogens								2017-03-27
Giardia Cysts/Total IFA Count	Giardia Cysts/Total IFA Count	0	Microbiological	Pathogens								2017-03-27
Glass	Glass using Trash Protocol	0	Trash						All			2011-05-04
Glass Foam	Glass Foam	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Glass fragment	Glass fragment	0	Microdebris	Anthropogenic	Glass	Fragment						2018-04-26
Glass Servicewear	Glass Servicewear	0	Debris	Trash	Non-Plastics	Household			All			2014-11-04
Glass Shard	Glass Shard	0	Debris	Trash	Non-Plastics	Household			All			2014-11-04
Glass sphere	Glass sphere	0	Microdebris	Anthropogenic	Glass	Sphere						2018-04-26
Glide	Glide	0	Habitat						All			2009-08-20
Glide/Pool Bank Stability	Glide/Pool Bank Stability (used for EMAP RBP 20-score habitat characterization)	0	Habitat						All			2009-08-20
Glide/Pool Channel Alteration	Glide/Pool Channel Alteration	0	Habitat						All			2009-08-20
Glide/Pool Channel Flow Status	Glide/Pool Channel Flow Status	0	Habitat						All			2009-08-20
Glide/Pool Channel Sinuosity	Glide/Pool Channel Sinuosity	0	Habitat						All			2009-08-20
Glide/Pool Epifaunal Substrate	Glide/Pool Epifaunal Substrate	0	Habitat						All			2009-08-20
Glide/Pool Pool Substrate	Glide/Pool Pool Substrate	0	Habitat						All			2009-08-20
Glide/Pool Pool Variability	Glide/Pool Pool Variability	0	Habitat						All			2009-08-20
Glide/Pool Riparian Zone Width	Glide/Pool Riparian Zone Width	0	Habitat						All			2009-08-20
Glide/Pool Sediment Deposition	Glide/Pool Sediment Deposition	0	Habitat						All			2009-08-20
Glide/Pool Vegetative Protection	Glide/Pool Vegetative Protection	0	Habitat						All			2009-08-20
Glipizide	Glipizide	29094619	Organics	PPCPs								2010-04-26
Glipizide-d11(Surrogate)	Surrogate: Glipizide-d11	0	Organics	PPCPs								2010-04-26
Glufosinate	Glufosinate	0	Organics	Pesticides	Herbicides							2017-04-04
Glyburide	Glyburide	10238218	Organics	PPCPs								2010-04-26
Glyburide-d3(Surrogate)	Surrogate: Glyburide-d3	0	Organics	PPCPs								2010-04-26
Glyoxal	Glyoxal (Oxaldehyde)(Ethanedial)	107222	Organics	VOCs	PPCPs				All			2025-01-21
Glyphosate	Glyphosate	1071836	Organics	Pesticides	Herbicides				All			2007-07-27
Glyphosate, isopropylamine salt	Glyphosate, isopropylamine salt	38641940	Organics	Pesticides								2017-04-20
Gold	Gold	0	Inorganics	Metals								2014-01-29
Golf Course/Parks/Sports Fields Extent	Golf Course/Parks/Sports Fields Extent	0	Habitat						All			2019-05-07
Golf Course/Parks/Sports Fields Intensity	Golf Course/Parks/Sports Fields Intensity	0	Habitat						All			2019-05-07
Golf Course/Parks/Sports Fields Proximity	Golf Course/Parks/Sports Fields Proximity	0	Habitat						All			2019-05-07
Gonad Index CI Mean	Gonad Index CI Mean	0	Tissue	Condition								2014-02-05
Gonad Index Standard Error	Gonad Index Standard Error	0	Tissue	Condition								2014-02-05
Grading/Compaction Extent	Grading/Compaction Extent	0	Habitat						All			2019-05-07
Grading/Compaction Intensity	Grading/Compaction Intensity	0	Habitat						All			2019-05-07
Grading/Compaction Proximity	Grading/Compaction Proximity	0	Habitat						All			2019-05-07
Granule	Granule	0	Inorganics	Conventionals	GrainSize				All			2011-09-08
Granule + Pebble	Granule + Pebble	0	Inorganics	Conventionals	GrainSize				All			2011-09-08
Granule_WS (2.0 to <4.0 mm_Phi -1 to >-2)	Granule_Wentworth Scale (2.0 to <4.0 mm_Phi -1 to >-2)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Gravel	Gravel	0	Inorganics	Conventionals	GrainSize				All			2011-09-08
Gravel_AS (4.75 to <75 mm)	Gravel_ASTM Scale (4.75 to <75 mm)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Gravel_WS (2 to <64 mm_Phi -1 to >-6)	Gravel_Wentworth Scale (2 to <64 mm_Phi -1 to >-6)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Grazing_Recent	Evidence of grazing activiy by cattle within the past year	0	Habitat						All			2012-09-13
Gross Alpha	Gross Alpha	12587461	Radiochemistry									2013-05-20
Gross Beta	Gross Beta	12587472	Radiochemistry									2013-05-20
Groundwater Extraction Extent	Groundwater Extraction Extent	0	Habitat						All			2019-05-07
Groundwater Extraction Intensity	Groundwater Extraction Intensity	0	Habitat						All			2019-05-07
Groundwater Extraction Proximity	Groundwater Extraction Proximity	0	Habitat						All			2019-05-07
Growth (ash-free dry wt/surv indiv)	Growth (ash-free dry weight/surviving individual)	0	Toxicity	Endpoint								2014-02-05
Growth (Chlorophyll a fluorescence)	Growth (Chlorophyll a fluorescence)	0	Toxicity									2022-11-15
Growth (Chlorophyll a)	Growth (Chlorophyll a)	0	Toxicity									2017-12-15
Growth (gonad)	Growth (gonad)	0	Toxicity						All			2007-07-27
Growth (length head capsule)	Growth (length head capsule)	0	Toxicity						All			2007-07-27
Growth (length)	Growth (length)	0	Toxicity						All			2007-07-27
Growth (weight)	Growth (weight)	0	Tissue	Condition					All			2014-02-05
Growth (wt/surv indiv)	Growth (weight/surviving individual)	0	Toxicity						All			2007-07-27
Growth Ratio	Growth Ratio (final measurement / initial measurement)	0	Toxicity									2011-12-22
Growth Standard Error	Growth Standard Error	0	Tissue	Condition								2014-02-05
H_AqHab	Shannon diversity of natural instream cover types physical-habitat metric	0	Bioassessment						All			2021-01-28
H_SubNat	Shannon diversity of natural substrate types physical-habitat metric	0	Bioassessment						All			2021-01-28
HabitatType	HabitatType	0	FieldObservations	Habitat					All			2009-08-20
Halauxifen-methyl	Halauxifen-methyl	943831989	Organics						All			2022-10-28
Halofenozide	Halofenozide	0	Organics	Pesticides	Insecticides							2017-04-04
Halosulfuron Methyl	Halosulfuron Methyl	100784201	Organics	Pesticides	Herbicides							2016-10-25
Hard Plastic Piece, non-specific	Hard Plastic Piece, non-specific	0	Debris	Trash	Plastics	Bags/Packaging			All			2014-11-04
Hardened Features Other Extent	Hardened Features Other Extent	0	Habitat						All			2019-05-07
Hardened Features Other Intensity	Hardened Features Other Intensity	0	Habitat						All			2019-05-07
Hardened Features Other Proximity	Hardened Features Other Proximity	0	Habitat						All			2019-05-07
Hardness as CaCO3	Hardness as CaCO3	0	Inorganics	Conventionals	WaterQualityMeasurements				All			2007-07-27
Hatchability	Hatchability (%)	0	Toxicity						All			2007-07-27
Hay Extent	Hay Extent	0	Habitat						All			2019-05-07
Hay Intensity	Hay Intensity	0	Habitat						All			2019-05-07
Hay Proximity	Hay Proximity	0	Habitat						All			2019-05-07
HCH, alpha-	alpha-Hexachlorocyclohexane (HCH) (alpha-BHC)	319846	Organics	Pesticides	Pest-OCHs	Insecticides	Rodenticides		All			2013-05-28
HCH, alpha-(Surrogate)	Surrogate: alpha-Hexachlorocyclohexane (HCH) (alpha-BHC)	0	Organics	Pesticides								2014-01-28
HCH, beta-	beta-Hexachlorocyclohexane (HCH) (beta-BHC)	319857	Organics	Pesticides	Pest-OCHs	Insecticides	Rodenticides		All			2013-05-28
HCH, beta-(Surrogate)	Surrogate: beta-Hexachlorocyclohexane (HCH) (beta-BHC)	319857	Organics	Pesticides								2016-03-02
HCH, delta-	delta-Hexachlorocyclohexane (HCH) (delta-BHC)	319868	Organics	Pesticides	Pest-OCHs	Insecticides	Rodenticides		All			2013-05-28
HCH, delta-(Surrogate)	Surrogate: delta-Hexachlorocyclohexane (HCH) (delta-BHC)	0	Organics	Pesticides								2013-05-27
HCH, gamma-	gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane)	58899	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors	Rodenticides	All			2013-05-28
HCH, gamma-(Surrogate)	Surrogate: gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane)	0	Organics	Pesticides								2013-05-29
HCH, gamma-/PCB 015/17/18	gamma-HCH/PCB 15/17/18	0	Organics	Pesticides/PCBs								2014-02-01
HCH, gamma-/PCB 015/18	gamma-HCH/PCB 15/18	0	Organics	Pesticides/PCBs								2014-02-01
HCH, gamma-/PCB 015/19	gamma-HCH/PCB 15/19	0	Organics	Pesticides/PCBs								2014-02-01
HCH, gamma-/PCB 015/20	gamma-HCH/PCB 15/20	0	Organics	Pesticides/PCBs								2014-02-01
HCH, gamma-/PCB 015/21	gamma-HCH/PCB 15/21	0	Organics	Pesticides/PCBs								2014-02-01
HCH, gamma-/PCB 015/22	gamma-HCH/PCB 15/22	0	Organics	Pesticides/PCBs								2014-02-01
HCH, gamma-/PCB 015/23	gamma-HCH/PCB 15/23	0	Organics	Pesticides/PCBs								2014-02-01
HCH, gamma-/PCB 015/24	gamma-HCH/PCB 15/24	0	Organics	Pesticides/PCBs								2014-02-01
HCH, gamma-/PCB 015/25	gamma-HCH/PCB 15/25	0	Organics	Pesticides/PCBs								2014-02-01
HCH, gamma-/PCB 015/26	gamma-HCH/PCB 15/26	0	Organics	Pesticides/PCBs								2014-02-01
HCH-13C6, alpha-(IsoDilAnalogue)	Isotope Dilution Analogue: alpha-Hexachlorocyclohexane-13C6 (HCH) (alpha-BHC)	0	Organics	Pest-OCHs	IDA							2023-10-26
HCH-13C6, alpha-(IsoDilAnalogues)	Isotope Dilution Analogue: alpha-Hexachlorocyclohexane-13C6 (HCH) (alpha-BHC)	222966667	Organics	Pest-OCHs	IDA							2025-06-18
HCH-13C6, beta-(IsoDilAnalogues)	Isotope Dilution Analogue: beta-Hexachlorocyclohexane-13C6 (HCH) (beta-BHC)	222966689	Organics	Pest-OCHs	IDA							2023-10-27
HCH-13C6, delta-(IsoDilAnalogue)	Isotope Dilution Analogue: delta-Hexachlorocyclohexane-13C6 (HCH) (delta-BHC)	0	Organics	Pest-OCHs	IDA				All			2023-10-19
HCH-13C6, gamma-(IsoDilAnalogue)	Isotope Dilution Analogue: gamma-Hexachlorocyclohexane-13C6 (HCH) (gamma-BHC) (Lindane)	104215852	Organics	Pest-OCHs	IDA							2023-10-27
HCH-d6, gamma-(IsoDilAnalogue)	Isotope Dilution Analogue: HCH-d6, gamma-	0										2023-10-27
HCH-d6, gamma-(Surrogate)	Surrogate: gamma-Hexachlorocyclohexane-d6 (HCH-d6) (gamma-BHC-d6) (Lindane-d6)	0	Organics	Pesticides								2013-06-20
Heavy Urban Other Extent	Heavy Urban Other Extent	0	Habitat						All			2019-05-07
Heavy Urban Other Intensity	Heavy Urban Other Intensity	0	Habitat						All			2019-05-07
Heavy Urban Other Proximity	Heavy Urban Other Proximity	0	Habitat						All			2019-05-07
Helicobacter, Avian (GFD)	Avian Helicobacter, Assay name: GFD, 5'-TCGGCTGAGCACTCTAGGG-3', 5'-GCGTCTCTTTGTACATCCCA-3'	0	Microbiological									2023-01-27
Heneicosane, n-	n-Heneicosane	629947	Organics	Alkanes								2013-05-01
Hentriacontane, n-	n-Hentriacontane	630046	Organics	Alkanes								2013-05-01
Hepatitis A Virus	Hepatitis A Virus	0	Microbiological	Pathogens								2020-10-29
Heptachlor	Heptachlor	76448	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors		All			2007-07-27
Heptachlor Epoxide	Heptachlor Epoxide	1024573	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors		All			2013-05-28
Heptachlor Epoxide(Surrogate)	Surrogate: Heptachlor Epoxide	0	Organics	Pesticides								2008-11-17
Heptachlor Epoxide, cis-	cis-Heptachlor Epoxide	0	Organics	Pesticides								2016-05-20
Heptachlor Epoxide, trans-	trans-Heptachlor Epoxide	0	Organics	Pesticides								2016-05-20
Heptachlor Epoxide/Oxychlordane	Heptachlor Epoxide/Oxychlordane	0	Organics	Pesticides								2014-02-01
Heptachlor Epoxide-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Heptachlor Epoxide-13C10	0										2023-10-27
Heptachlor Epoxide-13C10(Surrogate)	Surrogate: Heptachlor Epoxide-13C10	0	Organics	Pesticides								2013-06-17
Heptachlor Epoxide-13C10, cis-(Surrogate)	Surrogate: cis-Heptachlor Epoxide-13C10	0	Organics	Pesticides								2016-05-20
Heptachlor(Surrogate)	Surrogate: Heptachlor	0	Organics	Pesticides								2008-11-17
Heptachlor-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Heptachlor-13C10	0										2023-10-27
Heptachlor-13C10(Surrogate)	Surrogate: Heptachlor-13C10	0	Organics	Pesticides								2013-06-17
Heptachlorobenzene	Heptachlorobenzene	0	Organics	Pesticides								2014-01-28
Heptacosane, n-	n-Heptacosane	593497	Organics	Alkanes								2013-05-01
Heptadecane, n-	n-Heptadecane	629787	Organics	Alkanes								2013-05-01
Hexa(Methoxymethyl)Melamine	Hexa(Methoxymethyl)Melamine (HMMM)	3089110	Organics	Tire- and Vehicle-derived Contaminants								2026-02-10
Hexabromobenzene	Hexabromobenzene (HBBZ)	87821	Organics	FlameRetardants								2010-01-04
Hexabromobenzene-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Hexabromobenzene-13C6 (HBB-13C6)	2483735506	Organics	FlameRetardants	IDA							2024-10-31
Hexabromocyclododecane, alpha-	alpha-Hexabromocyclododecane (alpha-HBCDD)	0	Organics	FlameRetardants								2011-05-11
Hexabromocyclododecane, alpha-(Surrogate)	Surrogate: alpha-Hexabromocyclododecane (HBCDD)	0	Organics	FlameRetardants								2013-05-27
Hexabromocyclododecane, beta-	beta-Hexabromocyclododecane (beta-HBCDD)	0	Organics	FlameRetardants								2011-05-11
Hexabromocyclododecane, gamma-	gamma-Hexabromocyclododecane (gamma-HBCDD)	0	Organics	FlameRetardants								2011-05-11
Hexabromocyclododecane, Total	Total Hexabromocyclododecane (HBCDD)	3194556	Organics	FlameRetardants								2011-05-11
Hexabromocyclododecane-13C12(Surrogate)	Surrogate: Hexabromocyclododecane-13C12 (HBCDD)	0	Organics	FlameRetardants								2014-01-28
Hexachloro(phenyl)norbornene	Hexachloro(phenyl)norbornene (HCPN)	0	Organics	FlameRetardants								2015-07-16
Hexachlorobenzene	Hexachlorobenzene	118741	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors	Fungicides		All			2007-07-27
Hexachlorobenzene(Surrogate)	Surrogate: Hexachlorobenzene	0	Organics	Pesticides								2008-11-17
Hexachlorobenzene-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Hexachlorobenzene-13C6	0										2023-10-27
Hexachlorobenzene-13C6(Surrogate)	Surrogate: Hexachlorobenzene-13C6	0	Organics	Pesticides								2013-06-17
Hexachlorobutadiene	Hexachlorobutadiene	87683	Organics	VOCs	SVOCs	Fungicides			All			2007-07-27
Hexachlorocyclopentadiene	Hexachlorocyclopentadiene (HCCPD)	77474	Organics	SVOCs					All			2007-07-27
Hexachlorocyclopentadienyldibromocyclooctane	Hexachlorocyclopentadienyldibromocyclooctane (HCDBCO)	51936551	Organics	FlameRetardants					All			2014-03-13
Hexachloroethane	Hexachloroethane	67721	Organics	SVOCs					All			2007-07-27
Hexacosane, n-	n-Hexacosane	0	Organics	Alkanes								2014-01-28
Hexadecane, n-	n-Hexadecane	0	Organics	Alkanes								2014-01-28
Hexafluoropropylene Oxide Dimer Acid	Hexafluoropropylene Oxide Dimer Acid (HFPO-DA)	13252136	Organics	PFAS								2025-01-27
Hexafluoropropylene Oxide Dimer Acid-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Hexafluoropropylene Oxide Dimer Acid-13C3 (HFPO-DA-13C3)	3030247970	Organics	PFAS	IDA				All			2025-04-04
Hexahydro-1,3,5-trinitro-1,3,5-triazine	Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX)	121824	Organics									2019-12-18
Hexanone, 2-	2-Hexanone	591786	Organics	VOCs					All			2007-07-27
Hexazinone	Hexazinone	51235042	Organics	Pesticides	Pest-Triazines	Herbicides			All			2007-07-27
High Concentration of Salts Extent	High Concentration of Salts Extent	0	Habitat						All			2019-05-07
High Concentration of Salts Intensity	High Concentration of Salts Intensity	0	Habitat						All			2019-05-07
High Concentration of Salts Proximity	High Concentration of Salts Proximity	0	Habitat						All			2019-05-07
High density polyethylene fragment	HDPE fragment, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-04-26
Highway >2 lanes Extent	Highway >2 lanes Extent	0	Habitat						All			2019-05-07
Highway >2 lanes Intensity	Highway >2 lanes Intensity	0	Habitat						All			2019-05-07
Highway >2 lanes Proximity	Highway >2 lanes Proximity	0	Habitat						All			2019-05-07
Hiking Trails	Hiking Trails	0	Habitat						All			2009-08-20
Holmium	Holmium	7440600	Inorganics									2013-05-20
Homeless Encampment, Distance from Transect	Homeless Encampment, Distance from Transect	0	Habitat	Debris					All			2014-11-04
Homeless Encampment, Distance from Transect Downstream	Homeless Encampment, Distance from Transect Downstream	0	Habitat	Debris					All			2014-11-04
Homeless Encampment, Distance from Transect Upstream	Homeless Encampment, Distance from Transect Upstream	0	Habitat	Debris					All			2014-11-04
Homeless Encampment, Within Transect	Homeless Encampment, Within Transect	0	Habitat	Debris					All			2014-11-04
Homoanatoxin-a	Homoanatoxin-a	142926861	Microbiological	Cyanotoxins								2026-03-26
Hopane, C29-	C29-Hopane	0	Organics	Hopanes					All			2014-01-28
Hopane, C30-	C30-Hopane	0	Organics	Hopanes					All			2014-01-28
Horses Extent	Horses Extent	0	Habitat						All			2019-05-07
Horses Intensity	Horses Intensity	0	Habitat						All			2019-05-07
Horses Proximity	Horses Proximity	0	Habitat						All			2019-05-07
Hose Piece	Hose Piece	0	Debris	Trash	Non-Plastics	Household			All			2014-11-04
Household	Household	0	Debris	Trash	Plastics				All			2014-11-05
Household, Other	Household, Other	0	Debris	Trash	Plastics	Non-Plastics	Household		All			2014-11-04
HpCDD, 1,2,3,4,6,7,8-	1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD)	35822469	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
HpCDD, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD)	35822469	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
HpCDD-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin-13C12 (HpCDD-13C12)	109719837	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
HpCDF, 1,2,3,4,6,7,8-	1,2,3,4,6,7,8-Heptachlorodibenzofuran (HpCDF)	67562394	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
HpCDF, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran	0	Organics	DioxinsDibenzofurans								2015-06-22
HpCDF, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Heptachlorodibenzofuran	0	Organics	DioxinsDibenzofurans								2015-06-22
HpCDF, 1,2,3,4,7,8,9-	1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF)	55673897	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
HpCDF, 1,2,3,4,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF)	67562394	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
HpCDF-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,6,7,8-Heptachlorodibenzofuran-13C12 (HpCDF-13C12)	109719848	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
HpCDF-13C12, 1,2,3,4,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,7,8,9-Heptachlorodibenzofuran-13C12 (HpCDF-13C12)	109719940	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
Human Adenovirus		0										2018-02-13
Human Norovirus GI		0										2018-02-13
Human Norovirus GII		0										2018-02-13
Human Waste/Diaper	Human Waste/Diaper	0	Debris	Trash	Non-Plastics	Toxic			All			2014-11-04
HumanHealth	HumanHealth using Trash Protocol	0	Trash						All			2011-05-04
HxCDD, 1,2,3,4,7,8-	1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	39227286	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
HxCDD, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	39227286	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
HxCDD, 1,2,3,6,7,8-	1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	57653857	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
HxCDD, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	57653857	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
HxCDD, 1,2,3,7,8,9-	1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin (HxCDD)	19408743	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
HxCDD-13C12, 1,2,3,4,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD-13C12)	109719804	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
HxCDD-13C12, 1,2,3,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD-13C12)	109719815	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
HxCDD-13C12, 1,2,3,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD)	109719826	Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans							2024-11-13
HxCDF, 1,2,3,4,7,8-	1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF)	70648269	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
HxCDF, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF)	70648269	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
HxCDF, 1,2,3,6,7,8-	1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF)	57117449	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
HxCDF, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF)	57117449	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
HxCDF, 1,2,3,7,8,9-	1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF)	72918219	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
HxCDF, 1,2,3,7,8,9-(Surrogate)	Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF)	72918219	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
HxCDF, 2,3,4,6,7,8-	2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF)	60851345	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
HXCDF, 2,3,4,6,7,8-(Surrogate)	Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF)	60851345	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
HxCDF-13C12, 1,2,3,4,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,7,8-Hexachlorodibenzofuran-13C12 (HxCDF-13C12)	114423982	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
HxCDF-13C12, 1,2,3,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,6,7,8-Hexachlorodibenzofuran-13C12 (HxCDF-13C12)	116843039	Organics	Dioxins/DibenzofuransDioxins/Dibenzofurans	IDA							2025-08-25
HxCDF-13C12, 1,2,3,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8,9-Hexachlorodibenzofuran-13C12 (HxCDF-13C12)	116843040	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
HxCDF-13C12, 2,3,4,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,4,6,7,8-Hexachlorodibenzofuran-13C12 (HxCDF-13C12)	116843051	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
Hydramethylnon	Hydramethylnon	0	Organics	Pesticides	Insecticides							2017-04-04
Hydraulic Height	Height from bottom of stream to top of bankfull height or the summation of station water depth and bankfull height	0	Habitat						All			2013-05-17
Hydrochlorothiazide	Hydrochlorothiazide	58935	Organics	PPCPs								2010-04-26
Hydrocodone	Hydrocodone	125291	Organics	PPCPs								2010-04-26
Hydrocodone-d3(Surrogate)	Surrogate: Hydrocodone-d3	0	Organics	PPCPs								2010-04-26
Hydrocortisone	Hydrocortisone	50237	Organics	PPCPs								2010-04-26
Hydrocortisone-d4(Surrogate)	Surrogate: Hydrocortisone-d4	0	Organics	PPCPs								2010-04-26
Hydrogen Sulfide	Hydrogen Sulfide	0	WaterQualityMeasurements						All			2007-07-27
Hydrolyzable Phosphorus + Orthophosphate as P	Hydrolyzable Phosphorus + Orthophosphate as P	0	Inorganics	Conventionals								2013-05-20
Hydroperiod	Hydroperiod of the waterbody	0	Habitat						All			2012-09-13
Hydroxide	Hydroxide	14280309	Inorganics	Conventionals					All			2012-09-13
Hydroxide Alkalinity as CaCO3	Hydroxide Alkalinity as CaCO3	471341	Inorganics	Conventionals	WaterQualityMeasurements							1900-01-01
Hydroxy-amitriptyline, 10-	10-Hydroxy-amitriptyline	0	Organics	PPCPs								2010-04-26
Hydroxyatrazine, 2-	2-Hydroxyatrazine	2163680	Organics	Pesticides	Pest-Triazines				All			2010-05-18
Hydroxycarbofuran, 3-	3-Hydroxycarbofuran	16655826	Organics	Pesticides	Insecticides	Carbamates						2014-01-28
Hydroxydicamba, 5-	5-Hydroxydicamba	7600502	Organics	Pesticides								2017-04-10
Hydroxy-ibuprofen, 2-	2-Hydroxy-ibuprofen	0	Organics	PPCPs								2010-04-26
Hydroxy-Imidacloprid, 5-	5-Hydroxy-Imidacloprid	380912094	Organics	Pesticides								2018-08-07
Hydroxypropanal, 3-	3-Hydroxypropanal	2134294	Organics	Pesticides								2008-11-17
IBI	Score for the Index of Biotic Integrity (IBI)	0	Sediment Quality Objectives	Index/Metric								2022-03-18
Ibuprofen	Ibuprofen	15687271	Organics	PPCPs					All			2012-05-22
Ibuprofen-13C3(Surrogate)	Surrogate: Ibuprofen-13C3	0	Organics	PPCPs								2010-04-26
Ibuprofen-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Ibuprofen-d3	121662144	Organics									2022-07-22
Imazalil	Imazalil	35554440	Organics	Pesticides	Fungicides							2016-03-10
Imazamox	Imazamox	114311329	Organics									2020-06-26
Imazapyr	Imazapyr	0	Organics	Pesticides	Herbicides							2017-04-04
Imazaquin	Imazaquin	81335377	Organics	Herbicides								2013-05-20
Imazethapyr	Imazethapyr	81335775	Organics	Herbicides								2013-05-20
Imidacloprid	Imidacloprid	138261413	Organics	PPCPs					All			2012-09-13
Imidacloprid guanidine	Imidacloprid guanidine	0	Organics	Pesticides								2017-04-20
Imidacloprid guanidine olefin	Imidacloprid guanidine olefin	0	Organics	Pesticides								2017-04-20
Imidacloprid olefin	Imidacloprid olefin	115086549	Organics	Pesticides								2017-04-20
Imidacloprid urea	Imidacloprid urea	120868668	Organics	Pesticides								2017-04-20
Imidacloprid-d4(Surrogate)	Surrogate: Imidacloprid-d4	0	Organics	Pesticides	Insecticides							2018-01-31
Imidaclothiz	Imidaclothiz	105843365	Organics	Pesticides								2018-08-07
Incised Height	Incised Height	0	Habitat						All			2009-08-20
Increment	Increment	0	Habitat						All			2009-08-20
Indaziflam	Indaziflam	950782862	Organics	Herbicides								2019-08-05
Indeno(1,2,3-c,d)pyrene	Indeno(1,2,3-c,d)pyrene	193395	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		All			2007-07-27
Indeno(1,2,3-c,d)pyrene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Indeno(1,2,3-c,d)pyrene-d12	203578330	Organics	PAHs	IDA							2023-11-14
Indeno(1,2,3-c,d)pyrene-d12(Surrogate)	Surrogate: Indeno(1,2,3-c,d)pyrene-d12	0	Organics	PAHs								2012-04-04
Indole	Indole	120729	Organics									2018-07-16
Indoxacarb	Indoxacarb	173584446	Organics	Pesticides	Ozadiazine	Insecticides			All			2015-09-11
Industrial Extent	Industrial Extent	0	Habitat						All			2019-05-07
Industrial Intensity	Industrial Intensity	0	Habitat						All			2019-05-07
Industrial Plants	Industrial Plants	0	Habitat						All			2009-08-20
Industrial Proximity	Industrial Proximity	0	Habitat						All			2019-05-07
Industrial Water Quality Other Extent	Industrial Water Quality Other Extent	0	Habitat						All			2019-05-07
Industrial Water Quality Other Intensity	Industrial Water Quality Other Intensity	0	Habitat						All			2019-05-07
Industrial Water Quality Other Proximity	Industrial Water Quality Other Proximity	0	Habitat						All			2019-05-07
Inorganic natural material	Inorganic natural material, including rock and minerals	0	Microdebris	Natural	Natural	Natural						2018-04-26
Inorganic Natural Material Fiber	Inorganic natural material Fiber	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Inorganic Natural Material Film	Inorganic natural material Film	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Inorganic Natural Material Foam	Inorganic natural material Foam	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Inorganic Natural Material Fragment	Inorganic natural material Fragment	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Inorganic Natural Material Sphere	Inorganic natural material Sphere	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Instream Plant Cover	Instream Plant Cover	0	Habitat						All			2011-11-01
IntertidalSubstrateCharacteristics_Mud	IntertidalSubstrateCharacteristics_Mud	0	Habitat	Debris					All			2014-11-04
IntertidalSubstrateCharacteristics_Rocky	IntertidalSubstrateCharacteristics_Rocky	0	Habitat	Debris					All			2014-11-04
IntertidalSubstrateCharacteristics_Sand	IntertidalSubstrateCharacteristics_Sand	0	Habitat	Debris					All			2014-11-04
IntertidalSubstrateCharacteristics_Vegetated	IntertidalSubstrateCharacteristics_Vegetated	0	Habitat	Debris					All			2014-11-04
Invasive Plants Extent	Invasive Plants Extent	0	Habitat						All			2019-05-07
Invasive Plants Intensity	Invasive Plants Intensity	0	Habitat						All			2019-05-07
Invasive Plants Proximity	Invasive Plants Proximity	0	Habitat						All			2019-05-07
Iodomethane	Iodomethane	74884								Organics	Pesticide	2016-07-29
Iohexol	Iohexol	66108950										2018-08-31
Iopromide	Iopromide	73334073										2018-08-31
Iopromide-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Iopromide-d3	1189947736	Organics							Constituents		2024-02-15
Iopromide-d3(Surrogate)	Surrogate: Iopromide-d3	1189947736	Organics	PPCPs								2026-06-12
Ioxynil	Ioxynil	0	Organics	Pesticides	Herbicides							2017-04-04
Ipconazole	Ipconazole	125225287	Organics	Pesticides	Fungicides							2016-07-27
IPI	Score for the Index of Physical-habitat Integrity (IPI)	0	Bioassessment						All			2021-01-28
IPI_Ev_FlowHab_qa	Quality assurance metric for the evenness of flow habitat types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	Bioassessment						All			2021-01-28
IPI_Ev_FlowHab_score	Scored evenness of flow habitat types physical-habitat metric	0	Bioassessment						All			2021-01-28
IPI_H_AqHab_pred	Predicted Shannon diversity of natural instream cover types physical-habitat metric	0	Bioassessment						All			2021-01-28
IPI_H_AqHab_qa	Quality assurance metric for the Shannon diversity of natural instream cover types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	Bioassessment						All			2021-01-28
IPI_H_AqHab_score	Scored Shannon diversity of natural instream cover types physical-habitat metric	0	Bioassessment						All			2021-01-28
IPI_H_SubNat_qa	Quality assurance metric for the Shannon diversity of natural substrate types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	Bioassessment						All			2021-01-28
IPI_H_SubNat_score	Scored Shannon diversity of natural substrate types physical-habitat metric	0	Bioassessment						All			2021-01-28
IPI_IPI_qa	Quality assurance metric for the Index of Physical-habitat Integrity score, calculated as the minimum of other quality assurance metric values	0	Bioassessment						All			2021-01-28
IPI_PCT_SAFN_pred	Predicted percent sands and fines streambed substrate physical-habitat metric	0	Bioassessment						All			2021-01-28
IPI_PCT_SAFN_qa	Quality assurance metric for the percent sands and fines physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	Bioassessment						All			2021-01-28
IPI_PCT_SAFN_score	Scored percent sands and fines streambed substrate physical-habitat metric	0	Bioassessment						All			2021-01-28
IPI_XCMG_pred	Predicted riparian cover as sum of three layers physical-habitat metric	0	Bioassessment						All			2021-01-28
IPI_XCMG_qa	Quality assurance metric for the riparian cover metric, calculated as the percent of expected measurements present in the input data	0	Bioassessment						All			2021-01-28
IPI_XCMG_score	Scored riparian cover as sum of three layers physical-habitat metric	0	Bioassessment						All			2021-01-28
Iprodione	Iprodione	36734197	Organics	Fungicides								2016-05-20
IQ Test - Fluorescence (EC50)	IQ Test - Fluorescence (EC50)	0	Toxicity						All			2007-07-27
Iron	Iron	7439896	Inorganics	Conventionals	Metals				All			2007-07-27
Irrigation Equipment	Irrigation Equipment	0	Habitat						All			2009-08-20
Isoborneol	Isoborneol	124765	Organics									2018-07-16
Isobutylparaben	Isobutylparaben	4247023										2021-05-07
Isodecyl Diphenyl Phosphate	Isodecyl Diphenyl Phosphate	29761215	Organics	FlameRetardants	PhosphateFlameRetardants							2017-09-19
Isodrin	Isodrin	0	Organics	Pesticides								2008-11-07
Isodrin-13C12(Surrogate)	Surrogate: Isodrin-13C12	0	Organics	Pesticides								2013-06-17
Isofenphos	Isofenphos	25311711	Organics	Pesticides								2016-10-25
Isofetamid	Isofetamid	875915789	Organics									2018-07-16
Isophorone	Isophorone	78591	Organics	SVOCs					All			2007-07-27
Isopropalin	Isopropalin	0	Organics	Pesticides	Herbicides							2017-04-04
Isopropyl Alcohol	Isopropyl Alcohol (2-propanol)	67630										2017-01-12
Isopropylbenzene	Isopropylbenzene (Cumene)	98828	Organics	VOCs					All			2013-05-28
Isopropylphenyl Diphenyl Phosphate	Isopropylphenyl Diphenyl Phosphate	28108998	Organics	FlameRetardants	PhosphateFlameRetardants							2017-09-19
Isopropylphenyl Diphenyl Phosphate, 2-	2-Isopropylphenyl Diphenyl Phosphate (2IPPDPP)	64532941	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Isopropylphenyl Diphenyl Phosphate-d10, 2-(IsoDilAnalogue)	Isotope Dilution Analogue: 2-Isopropylphenyl Diphenyl Phosphate-d10 (2IPPDPP-d10)	2733216221	Organics	FlameRetardants	PhosphateFlameRetardants	IDA						2026-02-10
Isopropyltoluene, p-	p-Isopropyltoluene	99876	Organics	VOCs					All			2007-07-27
Isoproturon	Isoproturon	34123596										2021-05-07
Isoquinoline	Isoquinoline	119653	Organics									2018-07-16
Isotopes	Isotopes	0	Inorganics	Conventionals					All			2012-09-13
Isoxaben	Isoxaben (Flexidor) (Gallery)	82558507	Organics	Pesticides								2016-05-20
Isoxaben(Surrogate)	Surrogate: Isoxaben (Flexidor) (Gallery)	82558507	Organics	Herbicides					All			2013-05-28
ITEQ	International Toxic Equivalent (ITEQ)	0	Organics	DioxinsDibenzofurans								2010-07-15
Jasmolin-1	Jasmolin-1 (Jasmolin I)	4466142	Organics	Pesticides	Pyrethrins	Insecticides						2026-05-08
Jasmolin-2	Jasmolin-2 (Jasmolin II)	1172630	Organics	Pesticides	Pyrethrins	Insecticides						2026-05-08
Kelp holdfast	Kelp holdfast	0	Debris	Natural	Non-Plastics	Marine Origin			All			2014-11-04
Kelp Stipe/Blade	Kelp Stipe/Blade	0	Debris	Natural	Non-Plastics	Marine Origin			All			2014-11-04
Kepone	Kepone (Chlordecone)	143500	Organics	Pesticides	Pest-OCHs				All			2013-05-28
Ketocarbofuran phenol, 3-	3-ketocarbofuran phenol	17781167	Organics	Pesticides								2017-04-10
Ketocarbofuran, 3-	3-Ketocarbofuran	16709301	Organics	Pesticides	Pest-Carbamates							2013-05-20
Ketoprofen	Ketoprofen	22071154										2021-05-07
Ketorolac	Ketorolac	74103063										2021-05-07
Keyboard	Keyboard	0	Debris	Trash	Plastics	Toxic			All			2014-11-04
Kresoxim-methyl	Kresoxim-methyl	143390890	Organics	Fungicides								2016-05-20
Lachnospiraceae, Canine (DG37)	Canine Lachnospiraceae, Assay name: DG37, 5'-TTTTCTCCCACGGTCATCTG-3', 5'-CTTGGTTATGGGCGACATTG-3'	0	Microbiological									2023-01-27
LagoonFlowStatus	Lagoon flow status	0	FieldObservations	Habitat								2026-06-05
Landfill Extent	Landfill Extent	0	Habitat						All			2019-05-07
Landfill Intensity	Landfill Intensity	0	Habitat						All			2019-05-07
Landfill Proximity	Landfill Proximity	0	Habitat						All			2019-05-07
Lanthanum	Lanthanum	7439910	Inorganics									2013-05-20
Large	Large using Trash Protocol	0	Trash						All			2011-05-04
Large/Unmovable, Other	Large/Unmovable, Other	0	Debris	Trash	Non-Plastics	Large			All			2014-11-04
Larval abnormality	Larval abnormality	0	Toxicity						All			2007-07-27
Lead	Lead	7439921	Inorganics	TraceElements	Metals				All			2007-07-27
Length	Length	0	Tissue	Habitat	WaterQualityMeasurements	Conventionals			All	CollectionDevice		2012-06-01
Length Downstream	Length Downstream from X location	0	Habitat						All			2013-05-28
Length Pool	Length Pool	0	Habitat						All			2012-05-22
Length Reach	Length Reach	0	Habitat						All			2013-05-28
Length Riffle	Length Riffle	0	Habitat						All			2012-05-22
Length Root	Length Root	0	Toxicity						All			2013-05-28
Length Shoot	Length Shoot	0	Toxicity						All			2013-05-28
Length Upstream	Length Upstream from X location	0	Habitat						All			2013-05-28
Length, Segment	Segment Length	0	Habitat						All			2009-08-20
Leptophos	Leptophos	21609905	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Level Of Trash	Level Of Trash using Trash Protocol	0	Trash						All			2011-05-04
Lid	Lid	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
Lidocaine	Lidocaine	137586										2021-05-07
Light Urban Other Extent	Light Urban Other Extent	0	Habitat						All			2019-05-07
Light Urban Other Intensity	Light Urban Other Intensity	0	Habitat						All			2019-05-07
Light Urban Other Proximity	Light Urban Other Proximity	0	Habitat						All			2019-05-07
Lighter	Lighter	0	Debris	Trash	Plastics	Toxic			All			2014-11-04
Liming	Liming	0	Habitat						All			2009-08-20
Limonene, d-	d-Limonene	0	Organics									2018-07-16
Lincomycin	Lincomycin	154212	Organics	PPCPs					All			2012-05-22
Linuron	Linuron	330552	Organics	Pesticides	Herbicides				All			2007-07-27
Linuron-d6(Surrogate)	Surrogate: Linuron-d6	1219804768	Organics	Pesticides	Herbicides							2021-10-19
Lipid	Lipid	0	Organics	Inorganics	Conventionals				All			2007-07-27
Lithium	Lithium	7439932	Inorganics	Metals								2009-08-05
Littering	Littering using Trash Protocol	0	Trash						All			2011-05-04
Live young	Live young (#)	0	Toxicity						All			2007-07-27
Livestock Use	Livestock Use	0	Habitat						All			2009-08-20
Logging	Logging	0	Habitat						All			2009-08-20
Lomefloxacin	Lomefloxacin	98079517	Organics	PPCPs								2010-04-26
Loss On Ignition	Loss On Ignition (LOI)	0	Inorganics	Conventionals								2009-04-21
Low density polyethylene fragment	LDPE fragment, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-04-26
LWD >0.8 DLE, Length >15m	LWD >0.8 DLE, Length >15m	0	Habitat						All			2009-08-20
LWD >0.8m DLE, Length 1.5-5m	LWD >0.8m DLE, Length 1.5-5m	0	Habitat						All			2009-08-20
LWD >0.8m DLE, Length 5-15m	LWD >0.8m DLE, Length 5-15m	0	Habitat						All			2009-08-20
LWD 0.1-<0.3m DLE, Length >15m	LWD 0.1-<0.3m DLE, Length >15m	0	Habitat						All			2009-08-20
LWD 0.1-<0.3m DLE, Length 1.5-5m	LWD 0.1-<0.3m DLE, Length 1.5-5m	0	Habitat						All			2009-08-20
LWD 0.1-<0.3m DLE, Length 5-15m	LWD 0.1-<0.3m DLE, Length 5-15m	0	Habitat						All			2009-08-20
LWD 0.3-<0.6m DLE, Length >15	LWD 0.3-<0.6m DLE, Length >15	0	Habitat						All			2009-08-20
LWD 0.3-<0.6m DLE, Length 1.5-5m	LWD 0.3-<0.6m DLE, Length 1.5-5m	0	Habitat						All			2009-08-20
LWD 0.3-<0.6m DLE, Length 5-15m	LWD 0.3-<0.6m DLE, Length 5-15m	0	Habitat						All			2009-08-20
LWD 0.6-<0.8m DLE, Length >15m	LWD 0.6-<0.8m DLE, Length >15m	0	Habitat						All			2009-08-20
LWD 0.6-<0.8m DLE, Length 1.5-5m	LWD 0.6-<0.8m DLE, Length 1.5-5m	0	Habitat						All			2009-08-20
LWD 0.6-<0.8m DLE, Length 5-15	LWD 0.6-<0.8m DLE, Length 5-15	0	Habitat						All			2009-08-20
LWD A	Large Woody Debris in the A class of corresponding Diameter and Length categories	0	Habitat						All			2012-05-22
LWD L	Large Woody Debris in the L class of corresponding Diameter and Length categories	0	Habitat						All			2012-05-22
LWD M	Large Woody Debris in the M class of corresponding Diameter and Length categories	0	Habitat						All			2012-05-22
LWD S	Large Woody Debris in the S class of corresponding Diameter and Length categories	0	Habitat						All			2012-05-22
LWD T	Large Woody Debris in the T class of corresponding Diameter and Length categories	0	Habitat						All			2012-05-22
Lyngbyatoxin-a	Lyngbyatoxin-a	0	Microbiological	Cyanotoxins					All			2012-05-22
Macroalgae Cover, Attached	Presence/Absence of attached macroalgae at a point along a transect	0	Habitat						All			2008-12-04
Macroalgae Cover, Unattached	Presence/Absence of unattached macroalgae at a point along a transect	0	Habitat						All			2008-12-04
Macroinvertebrate Habitat Patch Richness Metric	Metric assesses macroinvertebrate habitat patch richness along the channel edge and bank within the assessment area.	0	Habitat						All			2019-05-13
Macrophyte Cover	Presence/Absence of macrophytes at a point along a transect	0	Habitat						All			2008-12-04
Magnesium	Magnesium	7439954	Inorganics	Conventionals	Metals	AlkalineEarthMetals			All	Constituents		2007-07-27
Maintained Lawns	Maintained Lawns	0	Habitat						All			2009-08-20
Malachite Green	Malachite Green	569642	Organics									2017-07-26
Malaoxon	Malaoxon	1634782	Organics	Pesticides								2016-03-10
Malathion	Malathion	121755	Organics	Pesticides	Pest-OPs	Insecticides	Endocrine Disruptors		All			2007-07-27
Maleic hydrazide	Maleic hydrazide	0	Organics	Pesticides	Herbicides							2017-04-04
Male-specific F+ Coliphage (E. coli Famp)	Male-specific F+ coliphages, Host Bacterium Strain: E. coli Famp	0										2022-02-11
Malonate(Surrogate)	Surrogate: Malonate	141822							All			2025-12-10
M-AMBI	Score for Multivariate AZTI Marine Biotic Index (M-AMBI)	0	Sediment Quality Objectives	Index/Metric								2022-03-18
Mancozeb	Mancozeb	0	Organics	Pesticides	Fungicides							2017-04-04
Mandestrobin	Mandestrobin	173662970	Organics						All			2022-10-28
Mandipropamid	Mandipropamid	374726622	Organics	Pesticides	Fungicides							2016-09-06
Maneb	Maneb	0	Organics	Pesticides	Fungicides							2017-04-04
Manganese	Manganese	7439965	Inorganics	TraceElements	Metals	Conventionals			All			2007-07-27
Marbon CNB 23010-1	Marbon CNB 23010 (VCH-DP isomer 1)	26595573	Organics	FlameRetardants								2015-07-16
Marbon CNB 23010-2	Marbon CNB 23010 (VCH-DP isomer 2)	26595573	Organics	FlameRetardants								2015-07-16
Marine, Other	Marine, Other	0	Debris	Natural	Non-Plastics	Marine Origin			All			2014-11-04
Mature	Mature (%)	0	Toxicity						All			2007-07-27
Mature females	Mature females (%)	0	Toxicity						All			2007-07-27
MBAS	MBAS (Methylene Blue Active Substances)	0	Inorganics	Surfactants					All			2013-05-28
MCPA	MCPA (2-Methyl-4-chlorophenoxy)Acetic Acid) (2,4-MCPA)	94746	Organics	Herbicides					All			2013-05-28
MCPA, alkanolamine salt	MCPA, alkanolamine salt	0	Organics	Pesticides								2017-04-20
MCPA, butoxyethanol ester	MCPA, butoxyethanol ester	19480434	Organics	Pesticides								2017-04-20
MCPA, dimethylamine salt	MCPA, dimethylamine salt	2039465	Organics	Pesticides								2017-04-20
MCPA, isooctyl ester	MCPA, isooctyl ester	26544207	Organics	Pesticides								2017-04-20
MCPA, sodium salt	MCPA, sodium salt	3653483	Organics	Pesticides								2017-04-20
MCPP	MCPP (2-(2-Methyl-4-chlorophenoxy) Propionic Acid)	93652	Organics	Herbicides					All			2013-05-28
MCPP, diethanolamine salt	MCPP, diethanolamine salt	1432140	Organics	Pesticides								2017-04-20
MCPP, dimethylamine salt	MCPP, dimethylamine salt	32351705	Organics	Pesticides								2017-04-20
MCPP, potassium salt	MCPP, potassium salt	1929868	Organics	Pesticides								2017-04-20
Mean Grain Size	Mean Grain Size	0	Inorganics	Conventionals								2016-07-18
Mean Growth (Ash Free Dry Weight)	Mean Growth (Ash Free Dry Weight)	0	Toxicity	Endpoint								2014-02-05
Mean Percent Normal Alive	The observed number of normal larvae divided by the mean number of live embryos inoculated at the beginning of the test	0	Toxicity	Endpoint								2014-02-05
Mechanical Pencil	Mechanical Pencil	0	Debris	Trash	Plastics	Household			All			2014-11-04
Meclofenamic Acid	Meclofenamic Acid	644622										2021-05-07
Median Effective Concentration	Median Effective Concentration	0	Toxicity						All			2013-05-28
Median Grain Size	Median Grain Size	0	Inorganics	Conventionals								2016-07-11
Median Inhibatory Concentration	Median Inhibatory Concentration	0	Toxicity						All			2013-05-28
Medical Device	Medical Device	0	Debris	Trash	Plastics	Toxic			All			2014-11-04
Menthol	Menthol	0	Organics									2018-07-16
Meprobamate	Meprobamate	57534	Organics	PPCPs								2010-04-26
Mercuric Chloride	Mercuric Chloride	0	Inorganics	Metals								2017-04-04
Mercury	Mercury	7439976	Inorganics	TraceElements	Metals				All			2007-07-27
Mercury (II)R	Reactive Mercury	0	Inorganics	Metals					All			2014-01-29
Mercury, Acid Labile	Acid Labile Mercury	0	Inorganics	Metals					All			2014-01-29
Mercury, Extract Fraction 1	Mercury selective sequential extraction, Fraction 1	0	Inorganics									2020-10-27
Mercury, Extract Fraction 2	Mercury selective sequential extraction, Fraction 2	0	Inorganics									2020-10-27
Mercury, Extract Fraction 3	Mercury selective sequential extraction, Fraction 3	0	Inorganics									2020-10-27
Mercury, Extract Fraction 4	Mercury selective sequential extraction, Fraction 4	0	Inorganics									2020-10-27
Mercury, Extract Fraction 5	Mercury selective sequential extraction, Fraction 5	0	Inorganics									2020-10-27
Mercury, Methyl	Methyl Mercury	22967926	Inorganics	TraceElements	Metals				All			2007-07-27
Merphos	Merphos (Tributylphosphorotrithioite)	150505	Organics	Pesticides	Pest-OPs				All			2007-07-27
Mesh Size	Mesh Size	0	Tissue	Habitat					All			2009-08-20
Metabolite B	Metabolite B (metabolite of Benzobicyclon)	0										2017-12-12
Metal	Metal using Trash Protocol	0	Trash						All			2011-05-04
Metal Object	Metal Object	0	Debris	Trash	Non-Plastics	Metals			All			2014-11-04
Metal Pipe/Bar	Metal Pipe/Bar	0	Debris	Trash	Non-Plastics	Metals			All			2014-11-04
Metal, Other	Metal, Other	0	Debris	Trash	Non-Plastics	Metals			All			2014-11-04
Metalaxyl	Metalaxyl	57837191	Organics	Herbicides								2013-05-20
Metalaxyl-hydroxymethyl	Metalaxyl-hydroxymethyl	85933499	Organics						All			2022-11-03
Metaldehyde	Metaldehyde	0	Organics	Pesticides								2017-04-04
Metam-Sodium	Metam-Sodium	0	Organics	Pesticides								2017-04-04
Metazachlor	Metazachlor	67129082										2021-05-07
Metconazole	Metconazole	125116236	Organics	Fungicides								2016-05-20
MeterAveragingInterval	Time period (seconds) upon which the meter reading is averaged internally to attain a result	0	WaterQualityMeasurements						All			2012-05-22
Metformin	Metformin	657249	Organics	PPCPs								2010-04-26
Metformin-d6(Surrogate)	Surrogate: Metformin-d6	0	Organics	PPCPs								2010-04-26
Methadone	Methadone	76993										2018-08-20
Methamidophos	Methamidophos (O,S-Dimethyl thiophosphate)	10265926	Organics	Pesticides	Pest-OPs	Insecticides			All			2013-05-28
Methidathion	Methidathion	950378	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Methidathion oxon	Methidathion oxon	0	Organics	Pesticides								2017-04-20
Methiocarb	Methiocarb	2032657	Organics	Pesticides	Pest-Carbamates	Insecticides			All			2007-07-27
Methiocarb sulfone	Methiocarb sulfone	2179251	Organics	Pesticides								2017-04-20
Methiocarb sulfoxide	Methiocarb sulfoxide	2635101	Organics	Pesticides								2017-04-20
Methomyl	Methomyl	16752775	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Methoprene	Methoprene	40596698	Organics	Pesticides								2008-11-17
Methoxychlor	Methoxychlor	72435	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors		All			2007-07-27
Methoxychlor(Surrogate)	Surrogate: Methoxychlor	0	Organics	Pesticides	OrganochlorinePesticides	Semi-VOAs	Insecticides	Endocrine Disruptors				2011-07-15
Methoxychlor-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Methoxychlor-13C12	0	Organics	Pest-OCHs	IDA				All			2023-10-03
Methoxychlor-d6(Surrogate)	Surrogate: Methoxychlor-d6	0	Organics	Pesticides								2013-06-17
Methoxyfenozide	Methoxyfenozide	161050584	Organics	Pesticides	Insecticides							2016-03-10
Methoxy-methylsulfanylphosphoryl acetamide, N-	N-Methoxy-methylsulfanylphosphoryl acetamide (Acephate)	0	Organics	Pesticides	Insecticides							2017-04-04
Methoxytetrafluoropropionic Acid, 3-	3-Methoxytetrafluoropropionic Acid (2,2,3,3-Tetrafluoro-3-Methoxypropanoic Acid) (MTP)	93449219	Organics	PFAS								2026-02-10
Methyl (3,4-dichlorophenyl)carbamate	Methyl (3,4-dichlorophenyl)carbamate (Swep)	1918189	Organics	Pesticides	Pest-Carbamates				All			2013-05-28
Methyl 2,4-dichlorophenylacetate	Methyl 2,4-dichlorophenylacetate (2,4-DCAA)	55954239										2017-01-12
Methyl 3-Amino-2,5-dichlorobenzoate	Methyl 3-Amino-2,5-dichlorobenzoate (Chloramben Methyl)	7286840	Organics	Herbicides								2013-05-20
Methyl isothiocyanate	Methyl isothiocyanate	0	Organics	Pesticides	Herbicides							2017-04-04
Methyl Methacrylate	Methyl Methacrylate (MMA)	80626	Organics	VOCs	PPCPs				All			2025-01-21
Methyl paraoxon	Methyl paraoxon	950356	Organics	Pesticides								2017-04-20
Methyl Perfluorooctane Sulfonamido Acetic Acid, N-	N-Methyl Perfluorooctane Sulfonamido Acetic Acid (Me-PFOSA-AcOH)	0	Organics	PFAS	PFC Precursor							2014-10-20
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(Surrogate)	Surrogate: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3	0	Organics	PFAS	PFC Precursor							2014-11-03
Methyl Perfluorooctanesulfonamide, N-	N-Methyl Perfluorooctanesulfonamide (NMeFOSA)	31506328	Organics	PFAS								2025-04-04
Methyl Perfluorooctanesulfonamide-d3, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctanesulfonamide-d3 (NMeFOSA-d3)	936109374	Organics	PFAS	IDA				All			2025-04-04
Methyl Perfluorooctanesulfonamidoacetic Acid, N-	N-Methyl Perfluorooctanesulfonamidoacetic Acid (NMeFOSAA)	2355319	Organics	PFAS								2025-04-03
Methyl Perfluorooctanesulfonamidoacetic Acid-d3, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctanesulfonamidoacetic Acid-d3 (NMeFOSAA-d3)	1400690701	Organics	PFAS	IDA				All			2025-04-04
Methyl Perfluorooctanesulfonamidoethanol, N-	N-Methyl Perfluorooctanesulfonamidoethanol (NMeFOSE)	24448097	Organics	PFAS								2025-04-25
Methyl Perfluorooctanesulfonamidoethanol-d7, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctanesulfonamidoethanol-d7 (NMeFOSE-d7)	1265205955	Organics	PFAS	IDA				All			2025-04-04
Methyl salicylate	Methyl salicylate	119368	Organics									2018-07-16
Methyl Tert-butyl Ether	Methyl Tert-butyl Ether (MTBE)	1634044	Organics	VOCs	MTBE_BTEX				All			2013-05-28
Methyl triclosan	Methyl triclosan	4640011	Organics	PPCPs								2018-07-24
Methyl Triclosan-13C12(Surrogate)	Surrogate: Methyl Triclosan-13C12	0	Organics	PPCPs								2018-08-07
Methyl vinyl ether Co-polymers Fiber	Methyl vinyl ether copolymers Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Methyl vinyl ether Co-polymers Film	Methyl vinyl ether copolymers Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Methyl vinyl ether Co-polymers Foam	Methyl vinyl ether copolymers Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Methyl vinyl ether Co-polymers Fragment	Methyl vinyl ether copolymers Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Methyl-1(H)-indole, 3-	3-Methyl-1(H)-indole (Skatole)	83341	Organics									2018-07-16
Methyl-1H-benzotriazole, 5-	5-Methyl-1H-benzotriazole	136856	Organics									2018-07-16
Methyl-2-pentanone, 4-	4-Methyl-2-pentanone (Methyl Isobutyl Ketone)	108101	Organics	VOCs					All			2013-05-28
Methylanthracene	Methylanthracene	0	Organics	PAHs								2014-01-28
Methylanthracene, 2-	2-Methylanthracene	613127	Organics	PAHs	Semi-VOAs				All			2010-07-08
Methylbenzo(a)pyrene, 7-	7-Methylbenzo(a)pyrene	63041770	Organics	PAHs								2013-08-27
Methylchlolanthrene, 3-	Methylchlolanthrene, 3-	0	Organics	PAHs								2016-05-20
Methylchrysene, 1-	1-Methylchrysene	0	Organics	PAHs								2014-01-28
Methylchrysene, 5/6-	5-Methylchrysene/6-Methylchrysene	0	Organics	PAHs								2011-06-20
Methyldibenzothiophene, 2-	2-Methyldibenzothiophene	0	Organics	PAHs								2014-01-28
Methyldibenzothiophene, 4-	4-Methyldibenzothiophene	7372885	Organics	PAHs	SVOCs				All			2007-07-27
Methyldibenzothiophenes, 2/3-	2-Methyldibenzothiophene/3-Methyldibenzothiophene	0	Organics	PAHs								2010-09-23
Methylene Chloride	Methylene Chloride (Dichloromethane)	75092	Organics	VOCs					All			2013-05-28
Methylenebis(2-chloroaniline), 4,4'-	4,4'-Methylenebis(2-chloroaniline)	0	Organics	VOCs								2014-01-29
Methylfluoranthene, 2-	2-Methylfluoranthene	33543316	Organics	PAHs	SVOCs	HMW_PAH			All			2007-07-27
Methylfluoranthene, 3-	3-Methylfluoranthene	0	Organics	PAHs								2014-01-28
Methylfluoranthene, 3-/Benzo(a)fluorene	3-Methylfluoranthene/Benzo(a)fluorene	0	Organics	PAHs	HMW_PAH							2018-07-24
Methylfluorene, 1-	1-Methylfluorene	1730376	Organics	PAHs	SVOCs				All			2007-07-27
Methylfluorene, 2-	2-Methylfluorene	1430973	Organics	PAHs	Semi-VOAs				All			2010-07-08
Methylisoborneol, 2-	2-Methylisoborneol	2371428	Organics	Terpenes/Terpinoids								2025-11-05
Methylnaphthalene, 1-	1-Methylnaphthalene	90120	Organics	PAHs	SVOCs	LMW_PAH			All			2007-07-27
Methylnaphthalene, 2-	2-Methylnaphthalene	91576	Organics	PAHs	SVOCs	LMW_PAH			All			2007-07-27
Methylnaphthalene-d10, 2-(IsoDilAnalogue)	Isotope Dilution Analogue: 2-Methylnaphthalene-d10	7297452	Organics	PAHs	IDA							2023-11-14
Methylnaphthalene-d10, 2-(Surrogate)	Surrogate: 2-Methylnaphthalene-d10	7297452	Organics	PAHs								2025-09-04
Methylparaben	Methylparaben	99763										2021-05-07
Methyl-perfluorooctanesulfonamide-d3, N-(Surrogate)	Surrogate: Methyl-perfluorooctanesulfonamide-d3, N- (N-MeFOSA)	0	Organics	PFAS								2021-06-02
Methyl-perfluorooctanesulfonamidoethanol, N-	N-Methyl-perfluorooctanesulfonamidoethanol	0	Organics	PFAS								2010-02-23
Methyl-perfluorooctanesulfonamidoethanol-d7, N-(Surrogate)	Surrogate: N-Methyl-perfluorooctanesulfonamidoethanol-d7	0	Organics	PFAS								2010-02-23
Methylphenanthrene	Methylphenanthrene	0	Organics									2017-05-04
Methylphenanthrene, 1-	1-Methylphenanthrene	832699	Organics	PAHs	SVOCs	LMW_PAH			All			2007-07-27
Methylphenanthrene, 2-	2-Methylphenanthrene	0	Organics	PAHs								2014-01-28
Methylphenanthrene, 3-	3-Methylphenanthrene	832713	Organics	PAHs	SVOCs	LMW_PAH			All			2014-12-08
Methylphenanthrene, 3/4-	3/4-Methylphenanthrene	0	Organics	PAHs								2014-12-23
Methylphenanthrene, 9/4-	9/4-Methylphenanthrene	0	Organics	PAHs	SVOCs	LMW_PAH			All			2014-12-08
Methylphenanthrene-d10, 2-(Surrogate)	Surrogate: 2-Methylphenanthrene-d10	0	Organics	PAHs								2012-04-04
Methylphenol, 2-	2-Methylphenol	95487	Organics	SVOCs	Phenols	non-Chlorinated Phenols			All			2007-07-27
Methylphenol, 2-(Surrogate)	Surrogate: 2-Methylphenol	0	Organics	SVOCs								2016-05-20
Methylphenol, 3-	3-Methylphenol	0	Organics	SVOCs								2016-05-20
Methylphenol, 3/4-	3-Methylphenol/4-Methylphenol	106445	Organics	SVOCs	Phenols	non-Chlorinated Phenols			All			2007-07-27
Methylphenol, 3/4-(Surrogate)	Surrogate: 3-Methylphenol/4-Methylphenol	0	Organics	SVOCs								2016-05-20
Methylphenol, 4-	4-Methylphenol	0	Organics	SVOCs								2016-05-20
Methylprednisolone	Methylprednisolone	83432	Organics	PPCPs								2010-04-26
Methylprednisolone-d2(Surrogate)	Surrogate: Methylprednisolone-d2	0	Organics	PPCPs								2010-04-26
Methylprednisolone-d3(Surrogate)	Surrogate: Methylprednisolone-d3	0	Organics	PPCPs								2018-01-29
Methylpyridine, 2-	2-Methylpyridine	0	Organics	VOCs								2014-02-05
Metiram	Metiram	0	Organics	Pesticides	Fungicides							2017-04-04
Metolachlor	Metolachlor	51218452	Organics	Herbicides					All			2007-07-27
Metolachlor ethanesulfonic acid	Metolachlor ethanesulfonic acid	171118095	Organics	Pesticides								2017-04-20
Metolachlor oxanilic acid	Metolachlor oxanilic acid	0	Organics	Pesticides								2017-04-20
Metolachlor, S-	S-Metolachlor	87392129	Organics	Pesticides								2019-06-13
Metolachlor-13C6(Surrogate)	Surrogate: Metolachlor-13C6	0	Organics						All			2022-10-27
Metoprolol	Metoprolol	51384511	Organics	PPCPs								2010-04-26
Metoprolol-d7(Surrogate)	Surrogate: Metoprolol-d7	0	Organics	PPCPs								2010-04-26
Metribuzin	Metribuzin	21087649	Organics	Herbicides					All			2007-07-27
Metsulfuron Methyl	Metsulfuron Methyl	74223646	Organics	Herbicides								2013-05-20
Mevinphos	Mevinphos (Phosdrin)	7786347	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Mexacarbate	Mexacarbate	315184	Organics	Pesticides	Pest-Carbamates	Insecticides			All			2007-07-27
MGK 264	MGK 264 (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide)	0										2017-01-12
MGK 264-A	MGK 264 Peak A (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide)	113484	Organics	Pesticides								2018-08-07
MGK 264-B	MGK 264 Peak B (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide)	113484	Organics	Pesticides								2018-08-07
Miconazole	Miconazole	22916478	Organics	PPCPs								2010-04-26
Microalgae Thickness	Thickness of microalgae (if present) at a point along a transect	0	Habitat						All			2008-12-04
Microcystin-[Dha7]LR	Microcystin-[dehydroalanine7]LR	0										2019-03-21
Microcystin-[DLeu1]LR	Microcystin-[deleucine1]LR	0										2019-03-21
Microcystin-HilR	Microcystin- homoisoleucineR	0										2019-03-21
Microcystin-HtyR	Microcystin-homotyrosineR	0										2019-03-21
Microcystin-LA	Microcystin-LA (MCY-LA)	96180799	Microbiological	Cyanotoxins					All			2013-05-28
Microcystin-LF	Microcystin-LF (MCY-LF)	154037704	Microbiological	Cyanotoxins					All			2013-05-28
Microcystin-LR	Microcystin-LR (MCY-LR)	101043372	Microbiological	Cyanotoxins					All			2013-05-28
Microcystin-LW	Microcystin-LW (MCY-LW)	157622021	Microbiological	Cyanotoxins					All			2013-05-28
Microcystin-LY	Microcystin-LY (MCY-LY)	123304109	Microbiological	Cyanotoxins					All			2013-05-28
Microcystin-RR	Microcystin-RR (MCY-RR)	111755374	Microbiological	Cyanotoxins					All			2013-05-28
Microcystins gene, Prokaryotic DNA (mcyE)	Microcystins gene, Prokaryotic DNA, Target Gene: mcyE, Proprietary primer sequences from Bend Genetics LLC	0	Microbiological	Cyanotoxins	Gene Marker				All			2026-05-27
Microcystins, Total	Total Microcystins	0	Microbiological	Cyanotoxins					All			2014-03-07
Microcystin-WR	Microcystin-WR (MCY-WR)	0										2019-03-21
Microcystin-YR	Microcystin-YR (MCY-YR)	101064486	Microbiological	Cyanotoxins					All			2013-05-28
Military Land Extent	Military Land Extent	0	Habitat						All			2019-05-07
Military Land Intensity	Military Land Intensity	0	Habitat						All			2019-05-07
Military Land Proximity	Military Land Proximity	0	Habitat						All			2019-05-07
Milk Carton	Milk Carton	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
Mines, Quaries	Mines, Quaries	0	Habitat						All			2009-08-20
Mining Extent	Mining Extent	0	Habitat						All			2019-05-07
Mining Intensity	Mining Intensity	0	Habitat						All			2019-05-07
Mining Proximity	Mining Proximity	0	Habitat						All			2019-05-07
Mirex	Mirex	2385855	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors		All			2007-07-27
Mirex(Surrogate)	Surrogate: Mirex	2385855	Organics	Pesticides								2013-06-17
Mirex-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Mirex-13C10	0	Organics	Pest-OCHs	IDA							2023-10-27
Mirex-13C10(Surrogate)	Surrogate: Mirex-13C10	0	Organics	Pesticides								2014-01-28
Miscellaneous	Miscellaneous using Trash Protocol	0	Trash						All			2011-05-04
Miscellaneous, Other	Miscellaneous, Other	0	Debris	Trash	Plastics	Miscellaneous			All			2014-11-04
Moisture	Moisture	0	Organics	Inorganics	Conventionals				All			2007-07-27
Molinate	Molinate (Ordram)	2212671	Organics	Pesticides	Pest-OPs				All			2007-07-27
Molinate sulfoxide	Molinate sulfoxide	52236290	Organics	Pesticides								2017-04-20
Molybdenum	Molybdenum	7439987	Inorganics	Metals					All			2007-07-27
Molybdenum, Acid Labile	Acid Labile Molybdenum	0	Inorganics	Metals					All			2010-11-11
Monobromophenyl-hexachloro-norbornene-1	Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 1)	0	Organics	FlameRetardants								2015-07-16
Monobromophenyl-hexachloro-norbornene-2	Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 2)	0	Organics	FlameRetardants								2015-07-16
Monobromophenyl-hexachloro-norbornene-3	Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 3)	0	Organics	FlameRetardants								2015-07-16
Monobutyl Monooctyl-Diphenylamine	Monobutyl Monooctyl-Diphenylamine (SDPA-C4C8)	0	Organics	Substituted Diphenylamines (SDPAs)								2026-02-10
Monobutyltin as Sn	Monobutyltin as Sn (MBT)	78763549	Organics	Organotins	Biocide				All			2010-06-21
Monocrotophos	Monocrotophos	6923224	Organics	Pesticides	Insecticides	Organophosphorous						2014-01-28
Mono-dechlorinated Dechlorane Plus	Mono-dechlorinated Dechlorane Plus (C11-DP)	0	Organics	FlameRetardants					All			2014-03-13
Monomethyl tetrachloroterephthalate	Monomethyl tetrachloroterephthalate (MTP)	887547	Organics	Pesticides								2017-04-10
Monomethylarsonic Acid	Monomethylarsonic Acid	0	Inorganics	Metals								2014-01-29
Monuron	Monuron	150685	Organics	Pesticides	Pest-Carbamates	Herbicides			All			2007-07-27
Monuron(Surrogate)	Surrogate: Monuron	150685										2016-12-21
Monuron-TCA	Monuron-TCA	140410	Organics	Pesticides								2017-04-20
Morphine	Morphine	57272										2021-05-07
Mortality/Abnormality	Mortality/Abnormality (%)	0	Toxicity						All			2007-07-27
Mortality/Normality	Mortality/Normality (%)	0	Toxicity						All			2007-07-27
Motor Oil	Motor Oil	0	Organics	PAHs								2014-01-28
Mountain Bikes Extent	Mountain Bikes Extent	0	Habitat						All			2019-05-07
Mountain Bikes Intensity	Mountain Bikes Intensity	0	Habitat						All			2019-05-07
Mountain Bikes Proximity	Mountain Bikes Proximity	0	Habitat						All			2019-05-07
Mowing/Cutting Extent	Mowing/Cutting Extent	0	Habitat						All			2019-05-07
Mowing/Cutting Intensity	Mowing/Cutting Intensity	0	Habitat						All			2019-05-07
Mowing/Cutting Proximity	Mowing/Cutting Proximity	0	Habitat						All			2019-05-07
Musk Ambrette	Musk Ambrette	0	Organics	Musk								2013-05-29
Musk Ketone	Musk Ketone	0	Organics	Musk								2013-05-29
Musk Moskene	Musk Moskene	0	Organics	Musk								2013-05-29
Musk Xylene	Musk Xylene	0	Organics	Musk								2013-05-29
Mutagenicity	Mutagenicity	0	Toxicity						All			2007-07-27
Myclobutanil	Myclobutanil	88671890	Organics	Fungicides								2016-05-20
N,N-Diethyl-3-methyl-benzamide-d7(Surrogate)	Surrogate: N,N-Diethyl-3-methyl-benzamide-d7	0	Organics	PPCPs								2013-05-30
N,N-Diethyl-3-methyl-benzamide-d7, N,N-(Surrogate)	Surrogate: N,N-Diethyl-3-methyl-benzamide-d7	0	Organics	PPCPs								2013-05-29
Nabam	Nabam	0	Organics	Pesticides	Fungicides							2017-04-04
Nail/Screw/Bolt	Nail/Screw/Bolt	0	Debris	Trash	Non-Plastics	Metals			All			2014-11-04
Naled	Naled (Dibrom)	300765	Organics	Pesticides	Pest-OPs	Insecticides	Rodenticides		All			2007-07-27
Naphthalene	Naphthalene	91203	Organics	PAHs	SVOCs	LMW_PAH	VOCs		All			2007-07-27
Naphthalene-d8(IsoDilAnalogue)	Isotope Dilution Analogue: Naphthalene-d8	1146652	Organics	PAHs	IDA							2023-11-07
Naphthalene-d8(Surrogate)	Surrogate: Naphthalene-d8	1146652	Organics	PAHs	SVOCs	Insecticides			All			2007-07-27
Naphthalenes, C1-	C1-Naphthalenes	0	Organics	PAHs	SVOCs	LMW_PAH			All			2010-06-21
Naphthalenes, C2-	C2-Naphthalenes	0	Organics	PAHs	SVOCs	LMW_PAH			All			2010-06-21
Naphthalenes, C3-	C3-Naphthalenes	0	Organics	PAHs	SVOCs	LMW_PAH			All			2010-06-21
Naphthalenes, C4-	C4-Naphthalenes	0	Organics	PAHs	SVOCs	LMW_PAH			All			2010-06-21
Naphthobenzothiophene	Naphthobenzothiophene	0	Organics	PAHs					All			2014-01-28
Naphthobenzothiophene, C1-	C1-Naphthobenzothiophene	0	Organics	PAHs					All			2014-01-28
Naphthobenzothiophene, C2-	C2-Naphthobenzothiophene	0	Organics	PAHs					All			2014-01-28
Naphthobenzothiophene, C3-	C3-Naphthobenzothiophene	0	Organics	PAHs					All			2014-01-28
Naphthylamine, 2-	2-Naphthylamine	0										2017-11-08
Napropamide	Napropamide	15299997	Organics	Pesticides	Herbicides				All			2013-05-28
Naproxen	Naproxen	22204531	Organics	PPCPs								2010-04-26
Naproxen-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Naproxen-d3	958293771	Organics									2022-07-22
Naproxen-d3(Surrogate)	Surrogate: Naproxen-d3	958293771	Organics	PPCPs	Pharmaceuticals							2026-06-12
Naptalam, sodium salt	Naptalam, sodium salt	132672	Organics	Pesticides								2017-04-10
Napthalene	Napthalene	0	Organics									2016-12-21
Natural, cotton/wool	Natural, cotton/wool	0	Debris	Trash	Non-Plastics	Biodegradable			All			2014-11-04
Neburon	Neburon	555373	Organics	Pesticides	Pest-Carbamates	Herbicides			All			2007-07-27
Neodymium	Neodymium	7440008	Inorganics									2013-05-20
Nest	Nest (%)	0	Toxicity						All			2007-07-27
Nickel	Nickel	7440020	Inorganics	TraceElements	Metals				All			2007-07-27
Nicosulfuron	Nicosulfuron	111991094	Organics	Herbicides								2013-05-20
NID as CTAS	4-Nitro-Inden-1-One (NID) as Cobalt Thiocyanate Active Substances (CTAS)	0										2016-12-23
Nifedipine	Nifedipine	21829254										2021-05-07
Niobium	Niobium	7440031	Inorganics									2013-05-20
Nitenpyram	Nitenpyram	120738898	Organics	Pesticides	Insecticides	Neonics						2017-10-05
Nitralin	Nitralin	0	Organics	Pesticides	Herbicides							2017-04-04
Nitrapyrin	Nitrapyrin	1929824	Organics	Pesticides								2017-04-04
Nitrate + Nitrite as N	Nitrate + Nitrite as N	0	Inorganics	Conventionals	Nutrients				All			2013-05-28
Nitrate as N	Nitrate as N	14797558	Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			All			2007-07-27
Nitrate as NO3	Nitrate as Nitrate	14797558	Inorganics	Conventionals					All			2016-05-20
Nitrate as NO3, Daily Mean	Daily Mean Nitrate as Nitrate (Calculated)	14797558	WaterQualityMeasurements	Conventionals	Inorganics	Nutrients			All			2024-09-06
Nitrite as N	Nitrite as N	14797650	Inorganics	Conventionals	Nutrients				All			2007-07-27
Nitroaniline, 2-	2-Nitroaniline	88744	Organics	SVOCs					All			2007-07-27
Nitroaniline, 3-	3-Nitroaniline	99092	Organics	SVOCs					All			2007-07-27
Nitroaniline, 4-	4-Nitroaniline	100016	Organics	SVOCs					All			2007-07-27
Nitrobenzene	Nitrobenzene	98953	Organics	VOCs					All			2007-07-27
Nitrobenzene-d5(Surrogate)	Surrogate: Nitrobenzene-d5	4165600	Organics	VOCs								2016-03-02
Nitrofen	Nitrofen	0	Organics	Pesticides	Herbicides							2017-04-04
Nitrogen Oxide	Nitrogen Oxide	10102439	Inorganics	Conventionals								2014-01-22
Nitrogen, Inorganic	Inorganic Nitrogen as N	0	Inorganics									2012-10-29
Nitrogen, Organic	Organic Nitrogen as N	7727379	Inorganics	Conventionals	Nutrients				All			2012-01-11
Nitrogen, Total	Total Nitrogen	0	Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			All			2011-11-10
Nitrogen, Total Kjeldahl	Total Kjeldahl Nitrogen (TKN)	7727379	Inorganics	Conventionals	Nutrients				All			2007-07-27
Nitrogen-15	Nitrogen-15	29817796	Organics	Radiochemistry								2014-11-05
Nitrogen-15/Nitrogen-14 Ratio	Nitrogen-15/Nitrogen-14 Ratio (Delta 15N nitrate isotope)	0										2019-03-26
Nitrophenol, 2-	2-Nitrophenol	88755	Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols		All			2007-07-27
Nitrophenol, 2-(Surrogate)	Surrogate: 2-Nitrophenol	0	Organics	SVOCs								2016-05-20
Nitrophenol, 4-	4-Nitrophenol	100027	Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols		All			2007-07-27
Nitrophenol, 4-(Surrogate)	Surrogate: 4-Nitrophenol	0	Organics	SVOCs								2016-05-20
Nitrosodiethylamine, N-	N-Nitrosodiethylamine	0	Organics	VOCs								2017-03-29
Nitrosodimethylamine, N-	N-Nitrosodimethylamine	0	Organics	SVOCs								2014-01-29
Nitrosodimethylamine-d6, N-(Surrogate)	Surrogate: N-Nitrosodimethylamine-d6	0	Organics	SVOCs								2017-03-29
Nitrosodi-n-propylamine, N-	N-Nitrosodi-n-propylamine	621647	Organics	SVOCs					All			2007-07-27
Nitrosodiphenylamine, N-	N-Nitrosodiphenylamine	0	Organics	SVOCs								2014-01-29
Nitrosomethylethylamine, N-	N-Nitrosomethylethylamine	0	Organics	SVOCs								2017-03-29
No Debris Collected	No Debris Collected	0	Debris	Trash	Survey				All			2014-11-04
No Debris Present	No Debris Present	0	Debris	Trash	Survey				All			2014-11-04
Nodularin	Nodularin	118399227	Microbiological	Cyanotoxins					All			2012-05-22
NoItems	Number of Items using Trash Protocol	0	Trash						All			2011-05-04
Nonachlor, cis-	cis-Nonachlor	5103731	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			All			2007-07-27
Nonachlor, cis-(Surrogate)	Surrogate: cis-Nonachlor	0	Organics	Pesticides								2008-11-17
Nonachlor, trans-	trans-Nonachlor	39765805	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			All			2007-07-27
Nonachlor, trans-(Surrogate)	Surrogate: trans-Nonachlor	0	Organics	Pesticides								2008-11-17
Nonachlor-13C10, cis-(IsoDilAnalogue)	Isotope Dilution Analogue: cis-Nonachlor-13C10	0	Organics	Pest-OCHs	IDA							2023-10-27
Nonachlor-13C10, trans-(IsoDilAnalogue)	Isotope Dilution Analogue: trans-Nonachlor-13C10	0	Organics	Pest-OCHs	IDA							2023-10-27
Nonacosane, n-	n-Nonacosane	630035	Organics	Alkanes								2013-05-01
Nonadecane, n-	n-Nonadecane	629925	Organics	Alkanes								2013-05-01
Nonafluoro-3,6-Dioxaheptanoic Acid	Nonafluoro-3,6-Dioxaheptanoic Acid (NFDHA)	151772586	Organics	PFAS					All			2025-04-04
Nonane	Nonane (C9)	111842	Organics									2017-05-03
Nonane(Surrogate)	Surrogate: Nonane	111842	Organics									2017-08-10
None	Used for non-treated samples	0	WaterQualityMeasurements	ToxTreatment					All			2007-07-27
NonPoint Source Discharges Stormwater Extent	NonPoint Source Discharges Stormwater Extent	0	Habitat						All			2019-05-07
NonPoint Source Discharges Stormwater Intensity	NonPoint Source Discharges Stormwater Intensity	0	Habitat						All			2019-05-07
NonPoint Source Discharges Stormwater Proximity	NonPoint Source Discharges Stormwater Proximity	0	Habitat						All			2019-05-07
Nonylphenol	Nonylphenol	25154523	Organics	Surfactants	Phenols	non-Chlorinated Phenols	Endocrine Disruptors		All			2007-07-27
Nonylphenol diethoxylate	Nonylphenol diethoxylate	20427843										2021-05-07
Nonylphenol Diethoxylate, 4-	4-Nonylphenol Diethoxylate	0	Organics	PPCPs								2013-05-29
Nonylphenol Diethoxylate, 4-(Surrogate)	Surrogate: 4-Nonylphenol Diethoxylate	20427843										2020-09-04
Nonylphenol diethoxylate, tech-	tech-Nonylphenol diethoxylate	0										2021-01-14
Nonylphenol Diethoxylate-13C6, 4-(Surrogate)	Surrogate: 4-Nonylphenol Diethoxylates-13C6	0	Organics	PPCPs								2013-05-29
Nonylphenol monoethoxylate	Nonylphenol monoethoxylate	0										2021-01-14
Nonylphenol Monoethoxylate, 4-	4-Nonylphenol Monoethoxylate	0	Organics	PPCPs								2013-05-29
Nonylphenol monoethoxylate, 4-n-	4-n-Nonylphenol monoethoxylate	104358										2022-02-11
Nonylphenol Monoethoxylate-13C6, 4-(Surrogate)	Surrogate: 4-Nonylphenol Monoethoxylate-13C6	0	Organics	PPCPs								2013-05-29
Nonylphenol, 4-n-	4-n-Nonylphenol	104405	Organics	Surfactants								2016-05-20
Nonylphenol, p-	p-Nonylphenol	0	Organics	Surfactants	Phenols							2011-05-11
Nonylphenol, tech-	tech-Nonylphenol (Branched p-nonylphenol)	84852153	Organics	Surfactants								2016-05-20
Nonylphenol-13C6, 4-n-(Surrogate)	Surrogate: 4-n-Nonylphenol-13C6	0	Organics	PPCPs								2013-06-25
Nonylphenol-13C6, n-4-(Surrogate)	Surrogate: 4-n-Nonylphenol-13C6	0	Organics	PPCPs								2010-04-26
Nonylphenol-d4, 4-(Surrogate)	Surrogate: 4-Nonylphenol-d4	1173019629	Organics									2020-06-26
Nonylphenolethoxylate	Nonylphenolethoxylate	9016459	Organics	Surfactants	Phenols	non-Chlorinated Phenols	Endocrine Disruptors		All			2007-07-27
Norethisterone	Norethisterone	68224										2021-05-07
Norfloxacin	Norfloxacin	70458967	Organics	PPCPs								2010-04-26
Norfluoxetine	Norfluoxetine	83891036	Organics	PPCPs								2025-08-25
Norfluoxetine-d5(Surrogate)	Surrogate: Norfluoxetine-d5	0	Organics	PPCPs								2010-04-26
Norflurazon	Norflurazon (3(2H)-Pyridazinone, 4-chloro-5-(methylamino)-2-[3-(trifluoromethyl)phenyl]-) (Telok)	27314132	Organics	Pesticides	Herbicides				All			2013-05-20
Norgestimate	Norgestimate	35189287	Organics	PPCPs								2010-04-26
Normal Development	Normal Development (%)	0	Toxicity						All			2007-07-27
Norverapamil	Norverapamil	67018853	Organics	PPCPs								2010-04-26
Not Characterized Fiber	Fiber particle not attempted to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown							1900-01-01
Not Characterized Fiber Bundle	Fiber bundle particle not attempted to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown							1900-01-01
Not Characterized Film	Film particle not attempted to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown							1900-01-01
Not Characterized Foam	Foam particle not attempted to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown							1900-01-01
Not Characterized Fragment	Fragment particle not attempted to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown							1900-01-01
Not Characterized Sphere	Sphere particle not attempted to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown							1900-01-01
Novaluron	Novaluron	116714466	Organics	Pesticides	Herbicides							2016-03-10
Noxious Chemical Odors Extent	Noxious Chemical Odors Extent	0	Habitat						All			2019-05-07
Noxious Chemical Odors Intensity	Noxious Chemical Odors Intensity	0	Habitat						All			2019-05-07
Noxious Chemical Odors Proximity	Noxious Chemical Odors Proximity	0	Habitat						All			2019-05-07
NumberOfFish	Number of fish observed	0	FieldObservations	Habitat								2026-06-05
Nutrient Related Water Other Extent	Nutrient Related Water Other Extent	0	Habitat						All			2019-05-07
Nutrient Related Water Other Intensity	Nutrient Related Water Other Intensity	0	Habitat						All			2019-05-07
Nutrient Related Water Other Proximity	Nutrient Related Water Other Proximity	0	Habitat						All			2019-05-07
NutrientSpike	Combination of multiple nutrients; see tox test comments for specific analytes and concentrations	0	Tox Treatment									2021-08-20
Nylon Fiber	Nylon Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Nylon Film	Nylon Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Nylon Foam	Nylon Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Nylon Fragment	Nylon Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Nylon Sphere	Nylon Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
O,O,O-Triethyl phosphorothioate	O,O,O-Triethyl phosphorothioate	0										2017-01-12
ObservedChannelFlowLevel	ObservedChannelFlowLevel	0	FieldObservations	Habitat					All			2011-05-31
ObservedFlow	ObservedFlow	0	FieldObservations	Habitat					All			2009-08-20
Obstructions (culverts, paved stream crossings) Extent	Obstructions (culverts, paved stream crossings) Extent	0	Habitat						All			2019-05-07
Obstructions (culverts, paved stream crossings) Intensity	Obstructions (culverts, paved stream crossings) Intensity	0	Habitat						All			2019-05-07
Obstructions (culverts, paved stream crossings) Proximity	Obstructions (culverts, paved stream crossings) Proximity	0	Habitat						All			2019-05-07
OCDD, 1,2,3,4,6,7,8,9-	1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD)	3268879	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
OCDD, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD)	3268879	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
OCDD-13C12, 1,2,3,4,6,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin-13C12 (OCDD-13C12)	114423971	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
OCDF, 1,2,3,4,6,7,8,9-	1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF)	39001020	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
OCDF, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF)	39001020	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
Octabromo-1,3,3-trimethyl-1-phenylindane	Octabromo-1,3,3-trimethyl-1-phenylindane (OBIND)	155613937	Organics	FlameRetardants					All			2014-03-13
Octachlorostyrene	Octachlorostyrene	0	Organics	VOCs								2014-01-29
Octachlorostyrene-13C8(Surrogate)	Surrogate: Octachlorostyrene-13C8	0	Organics	VOCs								2014-01-29
Octacosane, n-	n-Octacosane	0	Organics	Alkanes								2014-01-28
Octacosane, n-(Surrogate)	Surrogate: n-Octacosane	0	Organics	Alkanes								2016-10-31
Octadecane, n-	n-Octadecane	0	Organics	Alkanes								2014-01-28
Octamethylcyclotetrasiloxane	Octamethylcyclotetrasiloxane	556672										2021-05-19
Octyl bicycloheptene dicarboximide, N-	N-Octyl bicycloheptene dicarboximide	0	Organics	Pesticides								2017-04-04
Octylammonium Methanearsonate	Octylammonium Methanearsonate	0	Organics	Pesticides	Herbicides							2017-04-04
Octylphenol	Octylphenol	0	Organics	PPCPs								2010-04-26
Octylphenol diethoxylate, 4-n-	4-n-Octylphenol diethoxylate	51437902										2021-05-07
Octylphenol diethoxylate, tert-4-	4-tert-Octylphenol diethoxylate (OP2EO)	2315619	Organics	Phenols								2018-07-18
Octylphenol monoethoxylate, 4-	4-Octylphenol monoethoxylate	0										2021-01-14
Octylphenol monoethoxylate, 4-n-	4-n-Octylphenol monoethoxylate	51437899										2022-02-11
Octylphenol monoethoxylate, tert-4-	4-tert-Octylphenol monoethoxylate (OP1EO)	2315675	Organics	Phenols								2018-07-18
Octylphenol, 4-	4-Octylphenol	1806264										2018-08-31
Octylphenol, 4-n-	4-n-Octylphenol	1806264										2022-02-11
Octylphenol, tert-4-	4-tert-Octylphenol	140669	Organics	Phenols								2018-07-18
Odor	Odor	0	FieldObservations	Habitat					All			2009-08-20
Odor Intensity	Odor Intensity - Specific to EMAP BA (characterizes intensity of odor)	0	Habitat						All			2009-08-20
Offspring	Offspring (#)	0	Toxicity						All			2007-07-27
Ofloxacin	Ofloxacin	82419361	Organics	PPCPs								2010-04-26
Oil, Gas Wells	Oil, Gas Wells	0	Habitat						All			2009-08-20
OilandGrease; FOG-HEM	Oil and Grease; Fats, Oils and Grease N-Hexane Extractable Material (Polar Material)	0	Inorganics									2018-07-05
OilandGrease; HEM	Oil and Grease, N-Hexane Extractable Material	0	Organics	PAHs					All			2013-09-24
OilandGrease; SGT-HEM	Oil and Grease, Silica Gel Treated N-Hexane Extractable Material (Non-Polar Material Not Adsorbed by Silica Gel)	0	Organics	PAHs					All			2013-09-24
Okadaic Acid	Okadaic Acid	78111178	Microbiological	Cyanotoxins					All			2013-05-28
Omethoate	Omethoate	0	Organics	Pesticides	Insecticides							2017-04-04
Oncorhynchus mykiss (KF55)	Oncorhynchus mykiss, Assay name: KF55, 5’ AACATAAAACCTCCAGCCATCTCT 3’, 5’ AGCACGGCTCAAACGAAAA 3’, 5FAM-AGTACCAAACCCCC-3IABkFQ	0	Microbiological									2023-12-22
Open Shell Volume	Open Shell Volume (weight (in grams) of water displaced by each empty bivalve)	0	Organics	Inorganics	Metals	Conventionals	Semi-VOAs	VOAs	All			2012-11-08
Orchards	Orchards	0	Habitat						All			2009-08-20
Orchards Extent	Orchards Extent	0	Habitat						All			2019-05-07
Orchards Intensity	Orchards Intensity	0	Habitat						All			2019-05-07
Orchards Proximity	Orchards Proximity	0	Habitat						All			2019-05-07
Organic natural material	Hair or other unprocessed natural fiber, fragment, film	0	Microdebris	Natural	Natural	Natural						2018-04-26
Organic Natural Material Fiber	Organic natural material Fiber	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Organic Natural Material Film	Organic natural material Film	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Organic Natural Material Foam	Organic natural material Foam	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Organic Natural Material Fragment	Organic natural material Fragment	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Organic Natural Material Sphere	Organic natural material Sphere	0	Microdebris	Non-Anthropogenic	Non-Plastic							1900-01-01
Ormetoprim	Ormetoprim	0	Organics	PPCPs								2010-04-26
OrthoPhosphate as P	Reactive Phosphorous (PO4)	14265442	Inorganics	Conventionals	Nutrients				All			2007-07-27
Oryzalin	Oryzalin (Rycelan) (Ryzelan) (Surflan)	19044883	Organics	Herbicides					All			2013-05-20
Osmoregulation	Osmoregulation	0	Toxicity						All			2007-07-27
o-Terphenyl(Surrogate)	Surrogate: o-Terphenyl	84151	Organics	SVOCs					All			2016-03-02
OtherPresence	OtherPresence	0	FieldObservations	Habitat					All			2009-08-20
Outfall Accessibility	Outfall Accessibility	0										2016-06-13
Outfall Structural Cond	Structural condition of the outfall	0										2016-06-17
Outfall, Distance from Transect	Outfall, Distance from Transect	0	Habitat	Debris					All			2014-11-04
Outfall, Within Transect	Outfall, Within Transect	0	Habitat	Debris					All			2014-11-04
OverlandRunoffLast24hrs	Influence of overland runoff during last 24 hours	0	FieldObservations	Habitat					All	Constituents		2011-02-09
Oxacillin	Oxacillin	66795	Organics	PPCPs								2010-04-26
Oxadiazon	Oxadiazon	19666309	Organics	Pesticides	Pest-OCHs				All			2007-07-27
Oxamyl	Oxamyl	23135220	Organics	Pesticides	Pest-Carbamates	Insecticides	Nematocides		All			2007-07-27
Oxathiapiprolin	Oxathiapiprolin	1003318679	Organics	Pesticides	Fungicides							2018-01-03
Oxidation-Reduction Potential	Oxidation-Reduction Potential (OPR)	0	WaterQualityMeasurements	Conventionals								2016-05-20
Oxolinic Acid	Oxolinic Acid	14698294	Organics	PPCPs								2010-04-26
Oxybenzone	Oxybenzone	131577										2018-08-31
Oxycarboxin	Oxycarboxin	5259881	Organics	Pesticides								2017-04-20
Oxychlordane	Oxychlordane	27304138	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			All			2007-07-27
Oxychlordane(Surrogate)	Surrogate: Oxychlordane	0	Organics	Pesticides								2008-11-17
Oxychlordane-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Oxychlordane-13C10	0	Organics	Pest-OCHs	IDA							2023-10-27
Oxychlordane-13C10(Surrogate)	Surrogate: Oxychlordane-13C10	0	Organics	Pesticides								2013-06-17
Oxycodone	Oxycodone	76426	Organics	PPCPs								2010-04-26
Oxycodone-d6(Surrogate)	Surrogate: Oxycodone-d6	0	Organics	PPCPs								2010-04-26
Oxydemeton-methyl	Oxydemeton-methyl	301122	Organics	Pesticides								2017-04-20
Oxyfluorfen	Oxyfluorfen (Goal)	42874033	Organics	Pesticides	Pest-OCHs				All			2013-05-28
Oxygen, Dissolved	Dissolved Oxygen (DO)	0	WaterQualityMeasurements	Conventionals					All			2009-08-20
Oxygen, Dissolved, Daily Mean	Daily Mean Dissolved Oxygen (DO) (Calculated)	0	WaterQualityMeasurements	Conventionals					All			2024-09-06
Oxygen, Saturation	Oxygen, Saturation	0	WaterQualityMeasurements	Conventionals					All			2007-07-27
Oxygen, Saturation, Daily Mean	Daily Mean Oxygen Saturation (Calculated)	0	WaterQualityMeasurements	Conventionals					All			2024-09-06
Oxygen-18/Oxygen-16 Ratio	Oxygen-18/Oxygen-16 Ratio (Delta 18O nitrate isotope)	14797718	Isotopes									2013-05-20
Oxytetracycline	Oxytetracycline	79572	Organics	PPCPs					All			2012-05-22
Oxythioquinox	Oxythioquinox (Chinomethionate)	0	Organics	Pesticides	Fungicides							2017-04-04
Paclobutrazol	Paclobutrazol	76738620	Organics	Pesticides	Fungicides							2016-03-10
Paint Fiber	Paint Fiber	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Paint Film	Paint Film	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Paint Foam	Paint Foam	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Paint fragment	Paint anthropogenic fragment	0	Microdebris	Anthropogenic	Paint	Fragment						2018-04-26
Paper/Cardboard	Paper/Cardboard	0	Debris	Trash	Non-Plastics	Biodegradable			All			2014-11-04
PAR	Photosynthetically Active Radiation (PAR)	0	WaterQualityMeasurements						All			2007-07-27
Paraoxon	Paraoxon	0	Organics	Pesticides	Insecticides							2008-11-07
Paraquat	Paraquat	4685147	Organics	Pesticides	Herbicides							2013-03-14
Paraquat Bis(methylsulfate)	Paraquat Bis(methylsulfate)	0	Organics	Pesticides	Herbicides							2017-04-04
Paraquat Dichloride	Paraquat Dichloride	1910425	Organics	Pesticides	Herbicides				All			2013-05-28
Parathion, Ethyl	Ethyl Parathion (Parathion)	56382	Organics	Pesticides	Pest-OPs	Insecticides			All			2013-05-28
Parathion, Methyl	Methyl Parathion	298000	Organics	Pesticides	Pest-OPs	Insecticides			All			2013-05-28
Parathion, Total	Total Parathion	0										2016-12-23
Parking Lot/Pavement Extent	Parking Lot/Pavement Extent	0	Habitat						All			2019-05-07
Parking Lot/Pavement Intensity	Parking Lot/Pavement Intensity	0	Habitat						All			2019-05-07
Parking Lot/Pavement Proximity	Parking Lot/Pavement Proximity	0	Habitat						All			2019-05-07
Parks, Campgrounds	Parks, Campgrounds	0	Habitat						All			2009-08-20
Paroxetine	Paroxetine	61869087	Organics	PPCPs								2010-04-26
Paroxetine-d6(Surrogate)	Surrogate: Paroxetine-d6	0	Organics	PPCPs								2010-04-26
Particulate Organic Carbon	Particulate Organic Carbon (POC)	0	Inorganics	Conventionals								2013-05-27
Particulate Organic Hydrogen	Particulate Organic Hydrogen	0	Inorganics	Conventionals								2012-03-27
Passive Input (Construction/Erosion) Extent	Passive Input (Construction/Erosion) Extent	0	Habitat						All			2019-05-07
Passive Input (Construction/Erosion) Intensity	Passive Input (Construction/Erosion) Intensity	0	Habitat						All			2019-05-07
Passive Input (Construction/Erosion) Proximity	Passive Input (Construction/Erosion) Proximity	0	Habitat						All			2019-05-07
Pasture	Pasture	0	Habitat						All			2009-08-20
Pasture Extent	Pasture Extent	0	Habitat						All			2019-05-07
Pasture Intensity	Pasture Intensity	0	Habitat						All			2019-05-07
Pasture Proximity	Pasture Proximity	0	Habitat						All			2019-05-07
Paved Roads Extent	Paved Roads Extent	0	Habitat						All			2019-05-07
Paved Roads Intensity	Paved Roads Intensity	0	Habitat						All			2019-05-07
Paved Roads Proximity	Paved Roads Proximity	0	Habitat						All			2019-05-07
PBB 001	Polybrominated Biphenyl (PBB) 1	0	Organics	FlameRetardants					All			2012-03-29
PBB 002	Polybrominated Biphenyl (PBB) 2	0	Organics	FlameRetardants					All			2012-03-29
PBB 003	Polybrominated Biphenyl (PBB) 3	0	Organics	FlameRetardants					All			2012-03-29
PBB 004	Polybrominated Biphenyl (PBB) 4	0	Organics	FlameRetardants					All			2012-03-29
PBB 007	Polybrominated Biphenyl (PBB) 7	0	Organics	FlameRetardants					All			2012-03-29
PBB 009	Polybrominated Biphenyl (PBB) 9	0	Organics	FlameRetardants					All			2012-03-29
PBB 010	Polybrominated Biphenyl (PBB) 10	0	Organics	FlameRetardants					All			2012-03-29
PBB 015	Polybrominated Biphenyl (PBB) 15	0	Organics	FlameRetardants					All			2012-03-29
PBB 015(Surrogate)	Surrogate: PBB 015	92864	Organics						All			2025-08-25
PBB 018	Polybrominated Biphenyl (PBB) 18	0	Organics	FlameRetardants					All			2012-03-29
PBB 026	Polybrominated Biphenyl (PBB) 26	0	Organics	FlameRetardants					All			2012-03-29
PBB 030	Polybrominated Biphenyl (PBB) 30	0	Organics	FlameRetardants					All			2012-03-29
PBB 031	Polybrominated Biphenyl (PBB) 31	0	Organics	FlameRetardants					All			2012-03-29
PBB 049	Polybrominated Biphenyl (PBB) 49	0	Organics	FlameRetardants					All			2012-03-29
PBB 052	Polybrominated Biphenyl (PBB) 52	0	Organics	FlameRetardants					All			2012-03-29
PBB 053	Polybrominated Biphenyl (PBB) 53	0	Organics	FlameRetardants					All			2012-03-29
PBB 077	Polybrominated Biphenyl (PBB) 77	0	Organics	FlameRetardants					All			2012-03-29
PBB 080	Polybrominated Biphenyl (PBB) 80	0	Organics	FlameRetardants					All			2012-03-29
PBB 103	Polybrominated Biphenyl (PBB) 103	0	Organics	FlameRetardants					All			2012-03-29
PBB 155	Polybrominated Biphenyl (PBB) 155	0	Organics	FlameRetardants					All			2012-03-29
PBDE 001	Polybrominated Diphenyl Ether (PBDE) 1	0	Organics	FlameRetardants								2010-07-14
PBDE 001(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 1	0	Organics	FlameRetardants								2010-07-14
PBDE 002	Polybrominated Diphenyl Ether (PBDE) 2	0	Organics	FlameRetardants								2010-07-14
PBDE 003	Polybrominated Diphenyl Ether (PBDE) 3	0	Organics	FlameRetardants								2010-07-14
PBDE 003(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 3	0	Organics	FlameRetardants								2010-07-14
PBDE 004(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 4	0	Organics	FlameRetardants								2010-07-14
PBDE 007	Polybrominated Diphenyl Ether (PBDE) 7	0	Organics	FlameRetardants								2010-07-14
PBDE 008	Polybrominated Diphenyl Ether (PBDE) 8	0	Organics	FlameRetardants								2010-07-14
PBDE 008/11	Polybrominated Diphenyl Ether (PBDE) 8/11	0	Organics	PBDEs	FlameRetardants							2017-05-04
PBDE 010	Polybrominated Diphenyl Ether (PBDE) 10	0	Organics	FlameRetardants								2010-07-14
PBDE 011	Polybrominated Diphenyl Ether (PBDE) 11	0	Organics	FlameRetardants								2010-07-14
PBDE 012	Polybrominated Diphenyl Ether (PBDE) 12	0	Organics	FlameRetardants								2010-07-14
PBDE 012/13	Polybrominated Diphenyl Ether (PBDE) 12/13	0	Organics	PBDEs	FlameRetardants							2017-05-04
PBDE 013	Polybrominated Diphenyl Ether (PBDE) 13	0	Organics	FlameRetardants								2010-07-14
PBDE 015	Polybrominated Diphenyl Ether (PBDE) 15	0	Organics	FlameRetardants								2010-07-14
PBDE 015(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 15	0	Organics	FlameRetardants								2010-07-14
PBDE 015-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 15-13C12	488710174	Organics	FlameRetardants	PBDEs							2024-09-13
PBDE 017	Polybrominated Diphenyl Ether (PBDE) 17	147217752	Organics	PBDEs	FlameRetardants				All			2025-08-25
PBDE 017/25	Polybrominated Diphenyl Ether (PBDE) 17/25	0	Organics	PBDEs	FlameRetardants							2013-06-25
PBDE 019(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 19	0	Organics	FlameRetardants								2010-07-14
PBDE 025	Polybrominated Diphenyl Ether (PBDE) 25	0	Organics	FlameRetardants								2010-07-14
PBDE 028	Polybrominated Diphenyl Ether (PBDE) 28	41318756	Organics	PBDEs	FlameRetardants				All			2025-08-25
PBDE 028(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 28	0	Organics	FlameRetardants								2010-07-14
PBDE 028/33	Polybrominated Diphenyl Ether (PBDE) 28/33	0	Organics	PBDEs	FlameRetardants							2013-06-25
PBDE 028-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 028-13C12	0	Organics						All			2022-02-24
PBDE 028-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 28-13C12	0	Organics	PBDEs								2021-08-20
PBDE 030	Polybrominated Diphenyl Ether (PBDE) 30	0	Organics	FlameRetardants								2010-07-14
PBDE 032	Polybrominated Diphenyl Ether (PBDE) 32	0	Organics	FlameRetardants								2010-07-14
PBDE 033	Polybrominated Diphenyl Ether (PBDE) 33	0	Organics	FlameRetardants								2010-07-14
PBDE 033(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 33	0	Organics	FlameRetardants								2014-01-28
PBDE 035	Polybrominated Diphenyl Ether (PBDE) 35	0	Organics	FlameRetardants								2010-07-14
PBDE 037	Polybrominated Diphenyl Ether (PBDE) 37	0	Organics	FlameRetardants								2010-07-14
PBDE 037(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 37	0	Organics	FlameRetardants								2010-07-14
PBDE 047	Polybrominated Diphenyl Ether (PBDE) 47	5436431	Organics	PBDEs	FlameRetardants				All			2007-07-27
PBDE 047(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 47	5436431	Organics	FlameRetardants								2010-07-14
PBDE 047-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 047-13C12	0	Organics						All			2022-02-24
PBDE 047-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 47-13C12	0	Organics	PBDEs								2021-08-20
PBDE 049	Polybrominated Diphenyl Ether (PBDE) 49	0	Organics	FlameRetardants								2010-07-14
PBDE 049/71	Polybrominated Diphenyl Ether (PBDE) 49/71	0	Organics	SVOCs								2016-05-20
PBDE 051	Polybrominated Diphenyl Ether (PBDE) 51	0	Organics	FlameRetardants								2010-07-14
PBDE 052(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 52	0	Organics	FlameRetardants								2010-07-14
PBDE 054(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 54	0	Organics	FlameRetardants								2011-05-11
PBDE 066	Polybrominated Diphenyl Ether (PBDE) 66	189084615	Organics	PBDEs	FlameRetardants				All			2025-08-25
PBDE 069-F(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 69-F	0	Organics	FlameRetardants								2011-05-11
PBDE 071	Polybrominated Diphenyl Ether (PBDE) 71	0	Organics	FlameRetardants								2010-07-14
PBDE 075	Polybrominated Diphenyl Ether (PBDE) 75	0	Organics	FlameRetardants								2010-07-14
PBDE 077	Polybrominated Diphenyl Ether (PBDE) 77	0	Organics	FlameRetardants								2010-07-14
PBDE 077(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 77	0	Organics	FlameRetardants								2010-07-14
PBDE 077-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 77-13C12	1401355552	Organics	FlameRetardants	PBDEs							2024-09-12
PBDE 079	Polybrominated Diphenyl Ether (PBDE) 79	0	Organics	FlameRetardants								2010-07-14
PBDE 081(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 81	0	Organics	FlameRetardants								2010-07-14
PBDE 085	Polybrominated Diphenyl Ether (PBDE) 85	182346210	Organics	PBDEs	FlameRetardants				All			2007-07-27
PBDE 099	Polybrominated Diphenyl Ether (PBDE) 99	60348609	Organics	PBDEs	FlameRetardants				All			2007-07-27
PBDE 099(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 99	0	Organics	FlameRetardants								2010-07-14
PBDE 099-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 099-13C12	0	Organics						All			2022-02-24
PBDE 099-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 99-13C12	0	Organics	PBDEs								2021-08-20
PBDE 100	Polybrominated Diphenyl Ether (PBDE) 100	189084648	Organics	PBDEs	FlameRetardants				All			2025-08-25
PBDE 100(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 100	0	Organics	FlameRetardants								2008-11-17
PBDE 100-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 100-13C12	0	Organics						All			2022-02-24
PBDE 100-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-13C12	0	Organics	PBDEs								2021-08-20
PBDE 100-L(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-Labeled	0	Organics	PBDEs	FlameRetardants				All			2011-11-29
PBDE 104(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 104	0	Organics	FlameRetardants								2008-11-17
PBDE 105	Polybrominated Diphenyl Ether (PBDE) 105	0	Organics	FlameRetardants								2008-11-17
PBDE 105(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 105	0	Organics	FlameRetardants								2008-11-17
PBDE 111(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 111	0	Organics	FlameRetardants								2008-11-17
PBDE 114(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 114	0	Organics	FlameRetardants								2008-11-17
PBDE 116	Polybrominated Diphenyl Ether (PBDE) 116	0	Organics	FlameRetardants								2008-11-17
PBDE 118	Polybrominated Diphenyl Ether (PBDE) 118	0	Organics	FlameRetardants					All			2012-04-03
PBDE 118(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 118	0	Organics	FlameRetardants								2008-11-17
PBDE 119	Polybrominated Diphenyl Ether (PBDE) 119	0	Organics	FlameRetardants								2008-11-17
PBDE 119/120	Polybrominated Diphenyl Ether (PBDE) 119/120	0	Organics	PBDEs	FlameRetardants							2017-05-04
PBDE 120	Polybrominated Diphenyl Ether (PBDE) 120	0	Organics	FlameRetardants								2008-11-17
PBDE 123(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 123	0	Organics	FlameRetardants								2008-11-17
PBDE 126	Polybrominated Diphenyl Ether (PBDE) 126	0	Organics	FlameRetardants								2008-11-17
PBDE 126(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 126	0	Organics	FlameRetardants								2008-11-17
PBDE 126-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 126-13C12	1401355563	Organics	FlameRetardants	PBDEs							2024-09-12
PBDE 128	Polybrominated Diphenyl Ether (PBDE) 128	0	Organics	FlameRetardants								2008-11-17
PBDE 138	Polybrominated Diphenyl Ether (PBDE) 138	182677301	Organics	PBDEs	FlameRetardants				All			2025-08-25
PBDE 138(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 138	0	Organics	FlameRetardants								2009-08-14
PBDE 138/166	Polybrominated Diphenyl Ether (PBDE) 138/166	0	Organics	PBDEs	FlameRetardants							2017-05-04
PBDE 139	Polybrominated Diphenyl Ether (PBDE) 139	0	Organics	FlameRetardants								2009-01-08
PBDE 139(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 139	0	Organics	FlameRetardants								2008-11-17
PBDE 139-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 139-13C12	0	Organics						All			2022-02-24
PBDE 139-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 139-13C12	0	Organics	PBDEs								2021-08-20
PBDE 140	Polybrominated Diphenyl Ether (PBDE) 140	0	Organics	FlameRetardants								2008-11-17
PBDE 140(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 140	0	Organics	FlameRetardants								2008-11-17
PBDE 153	Polybrominated Diphenyl Ether (PBDE) 153	68631492	Organics	PBDEs	FlameRetardants				All			2007-07-27
PBDE 153(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 153	0	Organics	FlameRetardants								2008-11-17
PBDE 153-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 153-13C12	0	Organics						All			2022-02-24
PBDE 153-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 153-13C12	0	Organics	PBDEs								2021-08-20
PBDE 154	Polybrominated Diphenyl Ether (PBDE) 154	207122154	Organics	PBDEs	FlameRetardants				All			2025-08-25
PBDE 154(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 154	0	Organics	FlameRetardants								2008-11-17
PBDE 154-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 154-13C12	0	Organics						All			2022-02-24
PBDE 154-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 154-13C12	0	Organics	PBDEs								2021-08-20
PBDE 155	Polybrominated Diphenyl Ether (PBDE) 155	0	Organics	FlameRetardants								2008-11-17
PBDE 155(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 155	0	Organics	FlameRetardants								2008-11-17
PBDE 156(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 156	0	Organics	FlameRetardants								2008-11-17
PBDE 157(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 157	0	Organics	FlameRetardants								2008-11-17
PBDE 160	Polybrominated Diphenyl Ether (PBDE) 160	0	Organics	SVOCs								2016-05-20
PBDE 166	Polybrominated Diphenyl Ether (PBDE) 166	0	Organics	FlameRetardants								2008-11-17
PBDE 167(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 167	0	Organics	FlameRetardants								2008-11-17
PBDE 169(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 169	0	Organics	FlameRetardants								2008-11-17
PBDE 170(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 170	0	Organics	FlameRetardants								2008-11-17
PBDE 172(Surrogate)	Surrogate: PBDE 172 Surrogate: PBDE 172	0										2019-06-11
PBDE 178(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 178	0	Organics	FlameRetardants								2008-11-17
PBDE 179	Polybrominated Diphenyl Ether (PBDE) 179	0	Organics	FlameRetardants								2010-11-08
PBDE 180(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 180	0	Organics	FlameRetardants								2008-11-17
PBDE 181	Polybrominated Diphenyl Ether (PBDE) 181	0	Organics	FlameRetardants								2008-11-17
PBDE 183	Polybrominated Diphenyl Ether (PBDE) 183	207122165	Organics	PBDEs	FlameRetardants				All			2025-08-25
PBDE 183(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 183	0	Organics	FlameRetardants								2008-11-17
PBDE 183-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 183-13C12	0	Organics						All			2022-02-24
PBDE 183-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 183-13C12	0	Organics	PBDEs								2021-08-20
PBDE 184	Polybrominated Diphenyl Ether (PBDE) 184	0	Organics	FlameRetardants								2010-11-08
PBDE 188	Polybrominated Diphenyl Ether (PBDE) 188	0	Organics	FlameRetardants								2010-11-08
PBDE 188(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 188	0	Organics	FlameRetardants								2008-11-17
PBDE 189(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 189	0	Organics	FlameRetardants								2008-11-17
PBDE 190	Polybrominated Diphenyl Ether (PBDE) 190	189084682	Organics	PBDEs	FlameRetardants				All			2025-08-25
PBDE 194	Polybrominated Diphenyl Ether (PBDE) 194	0	Organics	FlameRetardants					All			2012-04-03
PBDE 195	Polybrominated Diphenyl Ether (PBDE) 195	0	Organics	FlameRetardants					All			2012-04-03
PBDE 196	Polybrominated Diphenyl Ether (PBDE) 196	0	Organics	FlameRetardants								2009-08-14
PBDE 197	Polybrominated Diphenyl Ether (PBDE) 197	0	Organics	FlameRetardants								2009-01-08
PBDE 197(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 197	0	Organics	FlameRetardants								2009-08-14
PBDE 197-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 197-13C12	1367487317	Organics	FlameRetardants	PBDEs							2024-09-12
PBDE 198	Polybrominated Diphenyl Ether (PBDE) 198	0	Organics	FlameRetardants					All			2012-04-03
PBDE 200	Polybrominated Diphenyl Ether (PBDE) 200	0	Organics	FlameRetardants								2010-11-08
PBDE 200/203	Polybrominated Diphenyl Ether (PBDE) 200/203	0	Organics	PBDEs	FlameRetardants							2013-06-25
PBDE 201	Polybrominated Diphenyl Ether (PBDE) 201	0	Organics	FlameRetardants								2010-11-08
PBDE 202	Polybrominated Diphenyl Ether (PBDE) 202	0	Organics	FlameRetardants								2010-11-08
PBDE 202(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 202	0	Organics	FlameRetardants								2008-11-17
PBDE 203	Polybrominated Diphenyl Ether (PBDE) 203	0	Organics	FlameRetardants								2008-11-17
PBDE 204	Polybrominated Diphenyl Ether (PBDE) 204	0	Organics	FlameRetardants								2009-01-08
PBDE 205	Polybrominated Diphenyl Ether (PBDE) 205	0	Organics	FlameRetardants								2009-01-08
PBDE 205(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 205	0	Organics	FlameRetardants								2008-11-17
PBDE 206	Polybrominated Diphenyl Ether (PBDE) 206	0	Organics	FlameRetardants								2008-11-17
PBDE 206(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 206	0	Organics	FlameRetardants								2008-11-17
PBDE 207	Polybrominated Diphenyl Ether (PBDE) 207	0	Organics	FlameRetardants								2008-11-17
PBDE 207(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 207	0	Organics	FlameRetardants								2009-08-14
PBDE 208	Polybrominated Diphenyl Ether (PBDE) 208	0	Organics	FlameRetardants								2008-11-17
PBDE 208(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 208	0	Organics	FlameRetardants								2008-11-17
PBDE 209	Polybrominated Diphenyl Ether (PBDE) 209	1163195	Organics	FlameRetardants								2008-11-17
PBDE 209(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 209	1163195	Organics	FlameRetardants								2010-07-14
PBDE 209-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 209-13C12	0	Organics						All			2022-02-24
PBDE 209-13C12(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 209-13C12	0	Organics	PBDEs								2021-08-20
PCB 001	PCB 1 Congener	0	Organics	PCBs								2010-07-14
PCB 001(Surrogate)	Surrogate: PCB 1 Congener	0	Organics	PCBs								2010-07-14
PCB 001-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 001-13C12	234432850	Organics	PCBs	IDA							2023-10-27
PCB 002	PCB 2 Congener	0	Organics	PCBs								2010-07-14
PCB 003	PCB 3 Congener	0	Organics	PCBs								2010-07-14
PCB 003(Surrogate)	Surrogate: PCB 3 Congener	0	Organics	PCBs								2010-07-14
PCB 003-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 003-13C12	208263778	Organics	PCBs	IDA							2023-10-27
PCB 004	PCB 4 Congener	0	Organics	PCBs								2010-07-14
PCB 004(Surrogate)	Surrogate: PCB 4 Congener	0	Organics	PCBs								2010-07-14
PCB 004/10	PCB 4/10 Congener	0	Organics	PCBs					All			2013-04-04
PCB 004-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 004-13C12	234432861	Organics	PCBs	IDA							2023-10-27
PCB 005	PCB 5 Congener	16605917	Organics	PCBs	Congeners				All			2007-07-27
PCB 005/8	PCB 5/8 Congener	0	Organics	PCBs	Congeners							2012-05-14
PCB 006	PCB 6 Congener	25569806	Organics	PCBs	Congeners				All			2007-07-27
PCB 007	PCB 7 Congener	0	Organics	PCBs								2010-07-14
PCB 007/9	PCB 7/9 Congener	0	Organics	PCBs								2011-05-11
PCB 008	PCB 8 Congener	34883437	Organics	PCBs	Congeners				All			2007-07-27
PCB 008(Surrogate)	Surrogate: PCB 8 Congener	34883400	Organics	PCBs	Congeners				All			2012-10-30
PCB 009	PCB 9 Congener	0	Organics	PCBs								2010-07-14
PCB 009(Surrogate)	Surrogate: PCB 9 Congener	0	Organics	PCBs								2010-07-15
PCB 009-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 9-13C12	250694894	Organics	PCBs	IDA							2024-05-02
PCB 010	PCB 10 Congener	0	Organics	PCBs								2010-07-14
PCB 011	PCB 11 Congener	0	Organics	PCBs								2010-07-14
PCB 011-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 11-13C12	0	Organics	PCBs	IDA							2025-05-05
PCB 012	PCB 12 Congener	2974927	Organics	PCBs								2010-07-14
PCB 012/13	PCB 12/13 Congener	0	Organics	PCBs								2010-07-14
PCB 013	PCB 13 Congener	2974905	Organics	PCBs								2010-07-14
PCB 014	PCB 14 Congener	0	Organics	PCBs								2010-07-14
PCB 015	PCB 15 Congener	2050682	Organics	PCBs	Congeners				All			2007-07-27
PCB 015(Surrogate)	Surrogate: PCB 15 Congener	0	Organics	PCBs								2010-07-14
PCB 015-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 015-13C12	208263676	Organics	PCBs	IDA							2023-10-27
PCB 016	PCB 16 Congener	0	Organics	PCBs								2010-07-14
PCB 016/32	PCB 16/32 Congener	0	Organics	PCBs								1900-01-01
PCB 017	PCB 17 Congener	0	Organics	PCBs								2010-07-14
PCB 017/18	PCB 17/18 Congener	0	Organics	PCBs					All			2013-05-27
PCB 018	PCB 18 Congener	37680652	Organics	PCBs	Congeners				All			2007-07-27
PCB 018/30	PCB 18/30 Congener	0	Organics	PCBs								2010-07-14
PCB 019	PCB 19 Congener	0	Organics	PCBs								2010-07-14
PCB 019(Surrogate)	Surrogate: PCB 19 Congener	0	Organics	PCBs								2010-07-14
PCB 019-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 019-13C12	234432872	Organics	PCBs	IDA							2023-10-27
PCB 020	PCB 20 Congener	38444847	Organics	PCBs								2011-05-11
PCB 020/21/33	PCB 020/21/33 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 020/28	PCB 20/28 Congener	0	Organics	PCBs								2010-07-14
PCB 020/33	PCB 20/33 Congener	0	Organics	PCBs					All			2013-05-13
PCB 020/33/53	PCB 20/33/53 Congener	0	Organics	PCBs					All			2013-05-13
PCB 021	PCB 21 Congener	55702460	Organics	PCBs								2010-07-14
PCB 021/33	PCB 21/33 Congener	0	Organics	PCBs								2010-07-14
PCB 022	PCB 22 Congener	0	Organics	PCBs								2010-07-14
PCB 022/51	PCB 22/51 Congener	0	Organics	PCBs								2016-08-10
PCB 023	PCB 23 Congener	0	Organics	PCBs								2010-07-14
PCB 023(Surrogate)	Surrogate: PCB 023	0										2020-05-01
PCB 024	PCB 24 Congener	0	Organics	PCBs								2010-07-14
PCB 024/27	PCB 24/27 Congener	0	Organics	PCBs					All			2013-05-02
PCB 025	PCB 25 Congener	55712373	Organics	PCBs	Congeners				All			2007-07-27
PCB 026	PCB 26 Congener	0	Organics	PCBs								2010-07-14
PCB 026/29	PCB 26/29 Congener	0	Organics	PCBs								2010-07-14
PCB 027	PCB 27 Congener	38444767	Organics	PCBs	Congeners				All			2007-07-27
PCB 028	PCB 28 Congener	7012375	Organics	PCBs	Congeners				All			2007-07-27
PCB 028(Surrogate)	Surrogate: PCB 28 Congener	0	Organics	PCBs								2010-07-14
PCB 028/31	PCB 28/31 Congener	0	Organics	PCBs					All			2013-05-13
PCB 028-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 028-13C12	208263767	Organics	PCBs	IDA							2023-10-19
PCB 029	PCB 29 Congener	15862074	Organics	PCBs	Congeners				All			2007-07-27
PCB 030	PCB 30 Congener	0	Organics	PCBs								2010-07-14
PCB 030(Surrogate)	Surrogate: PCB 30 Congener	35693926	Organics	PCBs	Congeners							2007-07-27
PCB 031	PCB 31 Congener	16606023	Organics	PCBs	Congeners				All			2007-07-27
PCB 031(Surrogate)	Surrogate: PCB 31 Congener	0	Organics	PCBs								2010-07-15
PCB 031-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 031-13C12	0	Organics	PCBs	IDA							2023-10-26
PCB 032	PCB 32 Congener	0	Organics	PCBs								2010-07-14
PCB 032-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 32-13C12	0	Organics	PCBs	IDA							2024-05-02
PCB 033	PCB 33 Congener	38444869	Organics	PCBs	Congeners				All			2007-07-27
PCB 034	PCB 34 Congener	0	Organics	PCBs								2010-07-14
PCB 034(Surrogate)	Surrogate: PCB 034	0										2020-05-01
PCB 035	PCB 35 Congener	0	Organics	PCBs								2010-07-14
PCB 036	PCB 36 Congener	0	Organics	PCBs								2010-07-14
PCB 037	PCB 37 Congener	38444905	Organics	PCBs	Congeners				All			2007-07-27
PCB 037(Surrogate)	Surrogate: PCB 37 Congener	0	Organics	PCBs								2010-07-14
PCB 037/42	PCB 37/42 Congener	0	Organics	PCBs								2013-05-02
PCB 037/42/59	PCB 37/42/59 Congener	0	Organics	PCBs								2016-08-10
PCB 037-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 037-13C12	208263790	Organics	PCBs	IDA							2023-10-27
PCB 038	PCB 38 Congener	0	Organics	PCBs								2010-07-14
PCB 039	PCB 39 Congener	0	Organics	PCBs								2010-07-14
PCB 040	PCB 40 Congener	0	Organics	PCBs								2010-07-14
PCB 040/41	PCB 40/41 Congener	0	Organics	PCBs								2017-05-04
PCB 040/41/71	PCB 40/41/71 Congener	0	Organics	PCBs								2010-07-14
PCB 040/71	PCB 40/71 Congener	0	Organics	PCBs								2017-05-04
PCB 041	PCB 41 Congener	0	Organics	PCBs								2010-07-14
PCB 041/64	PCB 41/64 Congener	0	Organics	PCBs								2016-08-10
PCB 041/64/71/72	PCB 041/64/71/72 Congener	0	Organics	PCBs								2016-05-20
PCB 041/71/40	PCB 41/71/40 Congener PCB 041/71/40	0										2019-02-22
PCB 042	PCB 42 Congener	0	Organics	PCBs								2010-07-14
PCB 042/59	PCB 042/59 Congener	0	Organics	PCBs								2016-05-20
PCB 043	PCB 43 Congener	0	Organics	PCBs								2010-07-14
PCB 043/49	PCB 43/49 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 043/73	PCB 43/73 Congener	0	Organics	PCBs								2014-07-03
PCB 044	PCB 44 Congener	41464395	Organics	PCBs	Congeners				All			2007-07-27
PCB 044/47	PCB 44/47 Congener	0	Organics	PCBs								2017-05-04
PCB 044/47/65	PCB 44/47/65 Congener	0	Organics	PCBs								2010-07-14
PCB 044/65	PCB 44/65 Congener	0	Organics	PCBs								2017-05-04
PCB 045	PCB 45 Congener	0	Organics	PCBs								2010-07-14
PCB 045/51	PCB 45/51 Congener	0	Organics	PCBs								2010-07-14
PCB 046	PCB 46 Congener	0	Organics	PCBs								2010-07-14
PCB 047	PCB 47 Congener	0	Organics	PCBs								2010-07-14
PCB 047/48	PCB 47/48 Congener	0	Organics	PCBs								2013-05-02
PCB 047/48/75	PCB 47/48/75 Congener	0	Organics	PCBs								2016-08-10
PCB 047-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 47-13C12	0	Organics	PCBs	IDA							2024-05-02
PCB 048	PCB 48 Congener	0	Organics	PCBs								2010-07-14
PCB 048/75	PCB 048/75 Congener	0	Organics	PCBs								2016-05-20
PCB 049	PCB 49 Congener	41464408	Organics	PCBs	Congeners				All			2007-07-27
PCB 049/69	PCB 49/69 Congener	0	Organics	PCBs								2010-07-14
PCB 050	PCB 50 Congener	62796650	Organics	PCBs								2010-07-14
PCB 050/53	PCB 50/53 Congener	0	Organics	PCBs								2010-07-14
PCB 051	PCB 51 Congener	68194047	Organics	PCBs								2010-07-14
PCB 052	PCB 52 Congener	35693993	Organics	PCBs	Congeners				All			2007-07-27
PCB 052(Surrogate)	Surrogate: PCB 52 Congener	0	Organics	PCBs								2010-07-15
PCB 052/69	PCB 52/69 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 052-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 52-13C12	208263803	Organics	PCBs	IDA							2024-05-02
PCB 053	PCB 53 Congener	41464419	Organics	PCBs								2010-07-14
PCB 054	PCB 54 Congener	0	Organics	PCBs								2010-07-14
PCB 054(Surrogate)	Surrogate: PCB 54 Congener	0	Organics	PCBs								2010-07-14
PCB 054-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 054-13C12	234432883	Organics	PCBs	IDA							2023-10-27
PCB 055	PCB 55 Congener	0	Organics	PCBs								2010-07-14
PCB 056	PCB 56 Congener	41464431	Organics	PCBs	Congeners				All			2007-07-27
PCB 056/60	PCB 56/60 Congener	0	Organics	PCBs								2010-07-14
PCB 057	PCB 57 Congener	0	Organics	PCBs								2010-07-14
PCB 058	PCB 58 Congener	0	Organics	PCBs								2010-07-14
PCB 059	PCB 59 Congener	0	Organics	PCBs								2010-07-14
PCB 059/62	PCB 59/62 Congener	0	Organics	PCBs								2017-05-04
PCB 059/62/75	PCB 59/62/75 Congener	0	Organics	PCBs								2010-07-14
PCB 059/75	PCB 59/75 Congener	0	Organics	PCBs								2017-05-04
PCB 060	PCB 60 Congener	33025411	Organics	PCBs	Congeners				All			2007-07-27
PCB 061	PCB 61 Congener	33284536	Organics	PCBs								2010-07-14
PCB 061/70	PCB 61/70 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 061/70/74/76	PCB 61/70/74/76 Congener	0	Organics	PCBs								2010-07-14
PCB 061/74	PCB 61/74 Congener	0	Organics	PCBs					All			2012-11-05
PCB 061/76	PCB 61/76 Congener	0	Organics	PCBs								2017-05-04
PCB 062	PCB 62 Congener	54230227	Organics	PCBs								2010-07-14
PCB 063	PCB 63 Congener	0	Organics	PCBs								2010-07-14
PCB 064	PCB 64 Congener	52663588	Organics	PCBs	Congeners				All			2008-02-21
PCB 065	PCB 65 Congener	33284547	Organics	PCBs								2010-07-14
PCB 065(Surrogate)	Surrogate: PCB 65 Congener	33284547	Organics	PCBs	Congeners				All			2007-07-27
PCB 066	PCB 66 Congener	32598100	Organics	PCBs	Congeners				All			2007-07-27
PCB 066/76	PCB 66/76 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 067	PCB 67 Congener	0	Organics	PCBs								2010-07-14
PCB 068	PCB 68 Congener	0	Organics	PCBs								2010-07-14
PCB 069	PCB 69 Congener	60233241	Organics	PCBs								2010-07-14
PCB 070	PCB 70 Congener	32598111	Organics	PCBs	Congeners				All			2007-07-27
PCB 070/61/74/76	PCB 70/61/74/76 Congener	0										2019-02-22
PCB 070/74	PCB 070/74	0	Organics	PCBs								2017-12-04
PCB 070/74/76	PCB 70/74/76 Congener	0	Organics	PCBs								2015-03-16
PCB 070/76	PCB 070/76	0	Organics	PCBs								2017-12-05
PCB 070-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 70-13C12	208263814	Organics	PCBs	IDA							2024-05-02
PCB 071	PCB 71 Congener	41464464	Organics	PCBs	Congeners				All			2007-07-27
PCB 072	PCB 72 Congener	0	Organics	PCBs								2010-07-14
PCB 073	PCB 73 Congener	0	Organics	PCBs								2010-07-14
PCB 074	PCB 74 Congener	32690930	Organics	PCBs	Congeners				All			2007-07-27
PCB 075	PCB 75 Congener	32598122	Organics	PCBs								2010-07-14
PCB 076	PCB 76 Congener	70362480	Organics	PCBs								2010-07-14
PCB 076/66	PCB 076/66 Congener	0	Organics	PCBs								2016-05-20
PCB 077	PCB 77 Congener	32598133	Organics	PCBs	Congeners				All			2007-07-27
PCB 077 (TEQ ND=0)	PCB 077 (TEQ ND=0)	0	Organics									2017-03-06
PCB 077 (TEQ ND=1/2 DL)	PCB 077 (TEQ ND=1/2 DL)	0	Organics	PCBs								2017-03-06
PCB 077 (TEQ ND=1/2 DL))	PCB 077 (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB 077 (TEQ ND=DL)	PCB 077 (TEQ ND=DL)	0	Organics									2017-03-06
PCB 077(Surrogate)	Surrogate: PCB 77 Congener	0	Organics	PCBs								2010-07-14
PCB 077/110	PCB 77/110 Congener	0	Organics	PCBs								2012-05-14
PCB 077/85	PCB 77/85 Congener	0	Organics	PCBs					All			2014-02-04
PCB 077-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 077-13C12	105600235	Organics	PCBs	IDA							2023-10-27
PCB 078	PCB 78 Congener	0	Organics	PCBs								2010-07-14
PCB 079	PCB 79 Congener	0	Organics	PCBs								2010-07-14
PCB 079-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 79-13C12	0	Organics	PCBs	IDA							2024-05-02
PCB 080	PCB 80 Congener	0	Organics	PCBs								2010-07-14
PCB 080-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 80-13C12	0	Organics	PCBs	IDA							2024-05-02
PCB 081	PCB 81 Congener	70362504	Organics	PCBs	Congeners				All			2007-07-27
PCB 081 (TEQ ND=0)	PCB 081 (TEQ ND=0)	0	Organics									2017-03-06
PCB 081 (TEQ ND=1/2 DL)	PCB 081 (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB 081 (TEQ ND=DL)	PCB 081 (TEQ ND=DL)	0	Organics									2017-03-06
PCB 081(Surrogate)	Surrogate: PCB 81 Congener	0	Organics	PCBs								2010-07-14
PCB 081-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 081-13C12	208461249	Organics	PCBs	IDA							2023-10-27
PCB 082	PCB 82 Congener	52663624	Organics	PCBs	Congeners				All			2007-07-27
PCB 083	PCB 83 Congener	0	Organics	PCBs								2010-07-14
PCB 083/99	PCB 83/99 Congener	0	Organics	PCBs								2010-07-14
PCB 084	PCB 84 Congener	0	Organics	PCBs								2010-07-14
PCB 084/92	PCB 084/92 Congener	0	Organics	PCBs								2016-05-20
PCB 085	PCB 85 Congener	65510454	Organics	PCBs								2010-07-14
PCB 085/110/115/116/117	PCB 85/110/115/116/117 Congener	0	Organics	PCBs								2016-04-06
PCB 085/116	PCB 85/116 Congener	0	Organics	PCBs								2014-07-15
PCB 085/116/117	PCB 85/116/117 Congener	0	Organics	PCBs								2010-07-14
PCB 085/117	PCB 85/117 Congener	0	Organics	PCBs								2017-05-04
PCB 086	PCB 86 Congener	55312691	Organics	PCBs								2010-07-14
PCB 086/108	PCB 86/108 Congener	0	Organics	PCBs								2017-05-04
PCB 086/119	PCB 86/119 Congener	0	Organics	PCBs								2017-05-04
PCB 086/125	PCB 86/125 Congener	0	Organics	PCBs								2017-05-04
PCB 086/87	PCB 86/87 Congener	0	Organics	PCBs								2017-05-04
PCB 086/87/97/108/109/119/125	PCB 86/87/97/108/109/119/125 Congener	0	Organics	PCBs	Congeners				All			2025-01-21
PCB 086/87/97/108/119/125	PCB 86/87/97/108/119/125 Congener	0	Organics	PCBs								2010-07-14
PCB 086/87/97/109/119/125	PCB 86/87/97/109/119/125 Congener	0	Organics	PCBs								2013-07-02
PCB 086/97	PCB 86/97 Congener	0	Organics	PCBs								2017-05-04
PCB 087	PCB 87 Congener	38380028	Organics	PCBs	Congeners				All			2007-07-27
PCB 087/108	PCB 087/108	0	Organics	PCBs								2017-12-04
PCB 087/115	PCB 87/115 Congener	0	Organics	PCBs					All			2012-11-05
PCB 087/117/125	PCB 87/117/125 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 087/119	PCB 087/119	0	Organics	PCBs								2017-12-04
PCB 087/125	PCB 087/125	0	Organics	PCBs								2017-12-04
PCB 087/97	PCB 087/97	0	Organics	PCBs								2017-12-04
PCB 088	PCB 88 Congener	55215173	Organics	PCBs								2010-07-14
PCB 088/91	PCB 88/91 Congener	0	Organics	PCBs								2010-07-14
PCB 089	PCB 89 Congener	0	Organics	PCBs								2010-07-14
PCB 090	PCB 90 Congener	68194070	Organics	PCBs								2010-07-14
PCB 090/101	PCB 90/101 Congener	0	Organics	PCBs								2012-05-14
PCB 090/101/113	PCB 90/101/113 Congener	0	Organics	PCBs								2010-07-14
PCB 090/101/113(Surrogate)	Surrogate: PCB 090/101/113	0										2020-05-01
PCB 090/113	PCB 90/113 Congener	0	Organics	PCBs								2017-05-04
PCB 091	PCB 91 Congener	0	Organics	PCBs								2010-07-14
PCB 092	PCB 92 Congener	0	Organics	PCBs								2010-07-14
PCB 093	PCB 93 Congener	73575561	Organics	PCBs								2010-07-14
PCB 093/100	PCB 93/100 Congener	0	Organics	PCBs								2014-07-15
PCB 093/102	PCB 93/102 Congener	0	Organics	PCBs								2017-05-04
PCB 093/95	PCB 93/95 Congener	0	Organics	PCBs								2017-05-04
PCB 093/95/100	PCB 93/95/100 Congener	0										2019-02-22
PCB 093/95/98/100/102	PCB 93/95/98/100/102 Congener	0	Organics	PCBs								2010-07-14
PCB 093/95/98/102	PCB 93/95/98/102 Congener	0	Organics	PCBs								2025-09-17
PCB 093/98	PCB 93/98 Congener	0	Organics	PCBs								2017-05-04
PCB 093/98/100/102	PCB 93/98/100/102 Congener	0										2019-05-17
PCB 094	PCB 94 Congener	0	Organics	PCBs								2010-07-14
PCB 095	PCB 95 Congener	38379996	Organics	PCBs	Congeners				All			2007-07-27
PCB 095(Surrogate)	Surrogate: PCB 95 Congener	0	Organics	PCBs								2010-07-15
PCB 095/100	PCB 95/100 Congener	0	Organics	PCBs								2015-06-09
PCB 095/102	PCB 095/102	0	Organics	PCBs								2017-12-04
PCB 095/98	PCB 095/98	0	Organics	PCBs								2017-12-04
PCB 095/98/102	PCB 95/98/102 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 095-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 095-13C12	0	Organics	PCBs	IDA							2023-10-26
PCB 096	PCB 96 Congener	0	Organics	PCBs								2010-07-14
PCB 097	PCB 97 Congener	41464511	Organics	PCBs	Congeners				All			2007-07-27
PCB 097/154	PCB 97/154 Congener	0	Organics	PCBs					All			2013-05-13
PCB 097-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 97-13C12	0	Organics	PCBs	IDA							2024-05-02
PCB 098	PCB 98 Congener	60233252	Organics	PCBs								2010-07-14
PCB 098/102	PCB 98/102 Congener	0	Organics	PCBs								2014-07-15
PCB 099	PCB 99 Congener	38380017	Organics	PCBs	Congeners				All			2007-07-27
PCB 100	PCB 100 Congener	39485831	Organics	PCBs								2008-11-17
PCB 101	PCB 101 Congener	37680732	Organics	PCBs	Congeners				All			2007-07-27
PCB 101(Surrogate)	Surrogate: PCB 101 Congener	0	Organics	PCBs								2008-11-17
PCB 101/113	PCB 101/113	0	Organics	PCBs								2017-12-04
PCB 101-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 101-13C12	104130394	Organics	PCBs	IDA							2024-05-02
PCB 102	PCB 102 Congener	68194069	Organics	PCBs								2008-11-17
PCB 103	PCB 103 Congener	0	Organics	PCBs								2008-06-27
PCB 103(Surrogate)	Surrogate: PCB 103 Congener	0	Organics	PCBs								2010-02-22
PCB 104	PCB 104 Congener	0	Organics	PCBs								2008-11-07
PCB 104(Surrogate)	Surrogate: PCB 104 Congener	0	Organics	PCBs								2008-11-17
PCB 104-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 104-13C12	234432894	Organics	PCBs	IDA							2023-10-27
PCB 105	PCB 105 Congener	32598144	Organics	PCBs	Congeners				All			2007-07-27
PCB 105 (TEQ ND=0)	PCB 105 (TEQ ND=0)	0	Organics									2017-03-06
PCB 105 (TEQ ND=1/2 DL)	PCB 105 (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB 105 (TEQ ND=DL)	PCB 105 (TEQ ND=DL)	0	Organics									2017-03-06
PCB 105(Surrogate)	Surrogate: PCB 105 Congener	0	Organics	PCBs								2008-09-05
PCB 105-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 105-13C12	208263621	Organics	PCBs	IDA							2023-10-27
PCB 106	PCB 106 Congener	0	Organics	PCBs								2008-11-07
PCB 106/118	PCB 106/118 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 107	PCB 107 Congener	0	Organics	PCBs								2008-11-07
PCB 107/108/144	PCB 107/108/144 Congener	0	Organics	PCBs								1900-01-01
PCB 107/109	PCB 107/109 Congener	0	Organics	PCBs								2016-05-20
PCB 107/124	PCB 107/124 Congener	0	Organics	PCBs								2010-07-14
PCB 108	PCB 108 Congener	70362413	Organics	PCBs								2008-11-17
PCB 108/112	PCB 108/112 Congener	0	Organics	PCBs								2016-05-20
PCB 108/124	PCB 108/124 Congener	0	Organics	PCBs								2014-07-03
PCB 109	PCB 109 Congener	0	Organics	PCBs								2008-11-07
PCB 110	PCB 110 Congener	38380039	Organics	PCBs	Congeners				All			2007-07-27
PCB 110/115	PCB 110/115 Congener	0	Organics	PCBs								2010-07-14
PCB 110/151	PCB 110/151 Congener	0	Organics	PCBs	Congeners				All			2012-11-26
PCB 111	PCB 111 Congener	0	Organics	PCBs								2008-11-07
PCB 111(Surrogate)	Surrogate: PCB 111 Congener	0	Organics	PCBs								2008-09-05
PCB 111/115	PCB 111/115 Congener	0	Organics	PCBs								2016-05-20
PCB 111-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 111-13C12	235416292	Organics	PCBs	IDA							2023-10-19
PCB 112	PCB 112 Congener	0	Organics	PCBs								2008-11-07
PCB 112(Surrogate)	Surrogate: PCB 112 Congener	74472369	Organics	PCBs	Congeners				All			2007-07-27
PCB 112/119	PCB 112/119 Congener	0	Organics	PCBs								2025-09-05
PCB 113	PCB 113 Congener	68194105	Organics	PCBs								2008-11-17
PCB 114	PCB 114 Congener	74472370	Organics	PCBs	Congeners				All			2007-07-27
PCB 114 (TEQ ND=0)	PCB 114 (TEQ ND=0)	0	Organics									2017-03-06
PCB 114 (TEQ ND=1/2 DL)	PCB 114 (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB 114 (TEQ ND=DL)	PCB 114 (TEQ ND=DL)	0	Organics									2017-03-06
PCB 114(Surrogate)	Surrogate: PCB 114 Congener	0	Organics	PCBs								2008-09-05
PCB 114/122/131	PCB 114/122/131 Congener	0	Organics	PCBs					All			1900-01-01
PCB 114/153	PCB 114/153 Congener	0	Organics	PCBs					All			2012-10-30
PCB 114-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 114-13C12	208263632	Organics	PCBs	IDA							2023-10-27
PCB 115	PCB 115 Congener	74472381	Organics	PCBs								2008-11-17
PCB 116	PCB 116 Congener	18259057	Organics	PCBs								2008-11-17
PCB 117	PCB 117 Congener	68194116	Organics	PCBs								2008-11-17
PCB 118	PCB 118 Congener	31508006	Organics	PCBs	Congeners				All			2007-07-27
PCB 118 (TEQ ND=0)	PCB 118 (TEQ ND=0)	0	Organics									2017-03-06
PCB 118 (TEQ ND=1/2 DL)	PCB 118 (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB 118 (TEQ ND=DL)	PCB 118 (TEQ ND=DL)	0	Organics									2017-03-06
PCB 118(Surrogate)	Surrogate: PCB 118 Congener	0	Organics	PCBs								2008-09-05
PCB 118-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 118-13C12	104130407	Organics	PCBs	IDA							2023-10-27
PCB 119	PCB 119 Congener	56558179	Organics	PCBs	Congeners				All			2007-07-27
PCB 120	PCB 120 Congener	0	Organics	PCBs								2008-11-07
PCB 121	PCB 121 Congener	0	Organics	PCBs								2008-11-07
PCB 122	PCB 122 Congener	0	Organics	PCBs								2008-11-07
PCB 123	PCB 123 Congener	65510443	Organics	PCBs	Congeners				All			2007-07-27
PCB 123 (TEQ ND=0)	PCB 123 (TEQ ND=0)	0	Organics									2017-03-06
PCB 123 (TEQ ND=1/2 DL)	PCB 123 (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB 123 (TEQ ND=DL)	PCB 123 (TEQ ND=DL)	0	Organics									2017-03-06
PCB 123(Surrogate)	Surrogate: PCB 123 Congener	0	Organics	PCBs								2008-09-05
PCB 123/149	PCB 123/149 Congener	0	Organics	PCBs					All			2012-04-03
PCB 123-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 123-13C12	208263643	Organics	PCBs	IDA							2023-10-27
PCB 124	PCB 124 Congener	70424703	Organics	PCBs								2008-11-17
PCB 125	PCB 125 Congener	74472392	Organics	PCBs								2008-11-17
PCB 126	PCB 126 Congener	57465288	Organics	PCBs	Congeners				All			2007-07-27
PCB 126 (TEQ ND=0)	PCB 126 (TEQ ND=0)	0	Organics									2017-03-06
PCB 126 (TEQ ND=1/2 DL)	PCB 126 (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB 126 (TEQ ND=DL)	PCB 126 (TEQ ND=DL)	0	Organics									2017-03-06
PCB 126(Surrogate)	Surrogate: PCB 126 Congener	0	Organics	PCBs								2008-09-05
PCB 126-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 126-13C12	208263654	Organics	PCBs	IDA							2023-10-27
PCB 127	PCB 127 Congener	0	Organics	PCBs								2008-11-07
PCB 127-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 127-13C12	0	Organics	PCBs	IDA							2025-05-05
PCB 128	PCB 128 Congener	38380073	Organics	PCBs	Congeners				All			2007-07-27
PCB 128/162	PCB 128/162 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 128/166	PCB 128/166 Congener	0	Organics	PCBs								2010-07-14
PCB 128/166(Surrogate)	Surrogate: PCB 128/166	0										2020-05-01
PCB 128/167	PCB 128/167 Congener	0	Organics	PCBs	Congeners				All			2007-07-27
PCB 129	PCB 129 Congener	0	Organics	PCBs								2008-11-07
PCB 129/138	PCB 129/138 Congener	0	Organics	PCBs								2017-05-04
PCB 129/138/160/163	PCB 129/138/160/163 Congener	0	Organics	PCBs								2010-07-14
PCB 129/138/163	PCB 129/138/163 Congener	0	Organics	PCBs								2013-07-02
PCB 129/160	PCB 129/160 Congener	0	Organics	PCBs								2017-05-04
PCB 129/163	PCB 129/163 Congener	0	Organics	PCBs								2017-05-04
PCB 129/166	PCB 129/166 Congener	0	Organics	PCBs								2017-05-04
PCB 130	PCB 130 Congener	0	Organics	PCBs								2008-11-07
PCB 131	PCB 131 Congener	0	Organics	PCBs								2008-11-07
PCB 131/133	PCB 131/133 Congener	0	Organics	PCBs								2017-11-09
PCB 132	PCB 132 Congener	0	Organics	PCBs								2008-06-27
PCB 132/137	PCB 132/137 Congener	0	Organics	PCBs					All			2012-10-30
PCB 132/146	PCB 132/146 Congener	0	Organics	PCBs								2025-09-05
PCB 132/153	PCB 132/153 Congener	0	Organics	PCBs					All			2012-10-30
PCB 132/153/168	PCB 132/153/168 Congener	0	Organics	PCBs								2012-05-14
PCB 132/161	PCB 132/161 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 132/168	PCB 132/168 Congener	0	Organics	PCBs	Congeners							2012-01-11
PCB 133	PCB 133 Congener	0	Organics	PCBs								2008-11-07
PCB 133/142	PCB 133/142 Congener	0	Organics	PCBs								2016-05-20
PCB 134	PCB 134 Congener	0	Organics	PCBs								2008-11-07
PCB 134/143	PCB 134/143 Congener	0	Organics	PCBs								2010-07-14
PCB 135	PCB 135 Congener	0	Organics	PCBs								2008-11-07
PCB 135/151	PCB 135/151 Congener	0	Organics	PCBs								2013-07-02
PCB 135/151/154	PCB 135/151/154 Congener	0	Organics	PCBs								2010-07-14
PCB 135/154	PCB 135/154 Congener	0	Organics	PCBs								2015-06-09
PCB 136	PCB 136 Congener	0	Organics	PCBs								2008-11-07
PCB 137	PCB 137 Congener	35694065	Organics	PCBs	Congeners				All			2007-07-27
PCB 137/164	PCB 137/164 Congener	0	Organics	PCBs	Congeners				All			2020-02-25
PCB 137/176	PCB 137/176 Congener	0	Organics	PCBs					All			2016-08-10
PCB 138	PCB 138 Congener	35065282	Organics	PCBs	Congeners				All			2007-07-27
PCB 138(Surrogate)	Surrogate: PCB 138 Congener	0	Organics	PCBs								2009-08-14
PCB 138/158	PCB 138/158 Congener	0	Organics	PCBs					All			2013-02-28
PCB 138/160	PCB 138/160 Congener	0	Organics	PCBs					All			2012-03-29
PCB 138/163	PCB 138/163	0	Organics	PCBs								2017-12-04
PCB 138/163/164	PCB 138/163/164 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 138-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 138-13C12	208263665	Organics	PCBs	IDA							2024-05-02
PCB 139	PCB 139 Congener	56030569	Organics	PCBs								2010-02-02
PCB 139/140	PCB 139/140 Congener	0	Organics	PCBs								2010-07-14
PCB 139/149	PCB 139/149 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 140	PCB 140 Congener	59291644	Organics	PCBs								2008-11-17
PCB 141	PCB 141 Congener	52712046	Organics	PCBs	Congeners				All			2007-07-27
PCB 141/179	PCB 141/179 Congener	0	Organics	PCBs					All			2012-10-30
PCB 141-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 141-13C12	0	Organics	PCBs	IDA							2024-04-22
PCB 142	PCB 142 Congener	0	Organics	PCBs								2008-11-07
PCB 143	PCB 143 Congener	68194150	Organics	PCBs								2008-11-17
PCB 144	PCB 144 Congener	0	Organics	PCBs								2008-11-07
PCB 145	PCB 145 Congener	0	Organics	PCBs								2008-11-07
PCB 146	PCB 146 Congener	51908168	Organics	PCBs	Congeners				All			2007-07-27
PCB 146/165	PCB 146/165 Congener	0	Organics	PCBs								2016-05-20
PCB 147	PCB 147 Congener	68194138	Organics	PCBs								2008-11-17
PCB 147/149	PCB 147/149 Congener	0	Organics	PCBs								2010-07-14
PCB 148	PCB 148 Congener	0	Organics	PCBs								2008-11-07
PCB 149	PCB 149 Congener	38380040	Organics	PCBs	Congeners				All			2007-07-27
PCB 150	PCB 150 Congener	0	Organics	PCBs								2008-11-07
PCB 151	PCB 151 Congener	52663635	Organics	PCBs	Congeners				All			2007-07-27
PCB 151/154	PCB 151/154	0	Organics	PCBs								2017-12-04
PCB 152	PCB 152 Congener	0	Organics	PCBs								2008-11-07
PCB 153	PCB 153 Congener	35065271	Organics	PCBs	Congeners				All			2007-07-27
PCB 153(Surrogate)	Surrogate: PCB 153 Congener	0	Organics	PCBs								2009-08-14
PCB 153/168	PCB 153/168 Congener	0	Organics	PCBs								2010-07-14
PCB 153-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 153-13C12	185376583	Organics	PCBs	IDA							2023-11-14
PCB 154	PCB 154 Congener	60145224	Organics	PCBs								2008-11-17
PCB 155	PCB 155 Congener	0	Organics	PCBs								2008-11-07
PCB 155(Surrogate)	Surrogate: PCB 155 Congener	0	Organics	PCBs								2008-11-17
PCB 155-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 155-13C12	34432907	Organics	PCBs	IDA							2023-10-27
PCB 156	PCB 156 Congener	38380084	Organics	PCBs	Congeners				All			2007-07-27
PCB 156 (TEQ ND=0)	PCB 156 (TEQ ND=0)	0	Organics									2017-03-06
PCB 156 (TEQ ND=1/2 DL)	PCB 156 (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB 156 (TEQ ND=DL)	PCB 156 (TEQ ND=DL)	0	Organics									2017-03-06
PCB 156(Surrogate)	Surrogate: PCB 156 Congener	0	Organics	PCBs								2008-09-05
PCB 156/157	PCB 156/157 Congener	0	Organics	PCBs								2010-07-14
PCB 156/157 (TEQ ND=0)	PCB 156/157 (TEQ ND=0)	0	Organics	PCBs								2017-05-04
PCB 156/157 (TEQ ND=1/2 DL)	PCB 156/157 (TEQ ND=1/2 DL)	0	Organics	PCBs								2017-05-04
PCB 156/157 (TEQ ND=DL)	PCB 156/157 (TEQ ND=DL)	0	Organics	PCBs								2017-05-04
PCB 156/157(Surrogate)	Surrogate: PCB 156/157 Congener	0	Organics	PCBs								2013-07-02
PCB 156/171	PCB 156/171 Congener	0	Organics	PCBs					All			2013-02-13
PCB 156/171/202	PCB 156/171/202 Congener	0	Organics	PCBs					All			2012-03-29
PCB 156/177/200	PCB 156/177/200 Congener	0	Organics	PCBs					All			2012-10-30
PCB 156-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 156-13C12	208263687	Organics	PCBs	IDA							2023-10-31
PCB 156-13C12/157-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 156-13C12/157-13C12	0	Organics	PCBs	IDA	Coelution						2023-10-27
PCB 157	PCB 157 Congener	69782907	Organics	PCBs	Congeners				All			2007-07-27
PCB 157 (TEQ ND=0)	PCB 157 (TEQ ND=0)	0	Organics									2017-03-06
PCB 157 (TEQ ND=1/2 DL)	PCB 157 (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB 157 (TEQ ND=DL)	PCB 157 (TEQ ND=DL)	0	Organics									2017-03-06
PCB 157(Surrogate)	Surrogate: PCB 157 Congener	0	Organics	PCBs								2008-09-05
PCB 157/173	PCB 157/173 Congener	0	Organics	PCBs								2013-02-13
PCB 157/173/201	PCB 157/173/201 Congener	0	Organics	PCBs					All			2012-03-29
PCB 157/180	PCB 157/180 Congener	0	Organics	PCBs					All			2012-10-30
PCB 157-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 157-13C12	235416305	Organics	PCBs	IDA							2023-10-31
PCB 158	PCB 158 Congener	74472427	Organics	PCBs	Congeners				All			2007-07-27
PCB 158/160	PCB 158/160 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 159	PCB 159 Congener	0	Organics	PCBs								2008-11-07
PCB 159(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 159	0										2023-02-24
PCB 159(Surrogate)	Surrogate: PCB 159 Congener	39635353	Organics	PCBs					All			2016-05-20
PCB 159/182/187	PCB 159/182/187 Congener	0	Organics	PCBs								1900-01-01
PCB 159-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 159-13C12	0	Organics	Toxaphene	IDA				All			2023-10-03
PCB 160	PCB 160 Congener	41411625	Organics	PCBs								2008-11-17
PCB 161	PCB 161 Congener	0	Organics	PCBs								2008-11-07
PCB 162	PCB 162 Congener	0	Organics	PCBs								2008-11-07
PCB 163	PCB 163 Congener	74472449	Organics	PCBs								2008-11-17
PCB 164	PCB 164 Congener	0	Organics	PCBs								2008-11-07
PCB 165	PCB 165 Congener	0	Organics	PCBs								2008-11-07
PCB 166	PCB 166 Congener	41411636	Organics	PCBs								2008-11-17
PCB 166/167	PCB 166/167 Congener	0	Organics	PCBs					All			1900-01-01
PCB 167	PCB 167 Congener	52663726	Organics	PCBs	Congeners				All			2007-07-27
PCB 167 (TEQ ND=0)	PCB 167 (TEQ ND=0)	0	Organics									2017-03-06
PCB 167 (TEQ ND=1/2 DL)	PCB 167 (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB 167 (TEQ ND=DL)	PCB 167 (TEQ ND=DL)	0	Organics									2017-03-06
PCB 167(Surrogate)	Surrogate: PCB 167 Congener	0	Organics	PCBs								2008-09-05
PCB 167-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 167-13C12	208263698	Organics	PCBs	IDA							2023-10-27
PCB 168	PCB 168 Congener	59291655	Organics	PCBs	Congeners				All			2007-07-27
PCB 168/132	PCB 168/132 Congener	0	Organics	PCBs								2016-05-20
PCB 169	PCB 169 Congener	32774166	Organics	PCBs	Congeners				All			2007-07-27
PCB 169 (TEQ ND=0)	PCB 169 (TEQ ND=0)	0	Organics									2017-03-06
PCB 169 (TEQ ND=1/2 DL)	PCB 169 (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB 169 (TEQ ND=DL)	PCB 169 (TEQ ND=DL)	0	Organics									2017-03-06
PCB 169(Surrogate)	Surrogate: PCB 169 Congener	0	Organics	PCBs								2008-09-05
PCB 169-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 169-13C12	208263701	Organics	PCBs	IDA							2023-10-27
PCB 170	PCB 170 Congener	35065306	Organics	PCBs	Congeners				All			2007-07-27
PCB 170(Surrogate)	Surrogate: PCB 170 Congener	0	Organics	PCBs								2008-09-05
PCB 170/190	PCB 170/190 Congener	0	Organics	PCBs								2012-05-14
PCB 170-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 170-13C12	160901804	Organics	PCBs	IDA							2023-10-27
PCB 171	PCB 171 Congener	52663715	Organics	PCBs								2008-11-17
PCB 171/173	PCB 171/173 Congener	0	Organics	PCBs								2010-07-14
PCB 171/202	PCB 171/202 Congener	0	Organics	PCBs					All			2013-02-13
PCB 172	PCB 172 Congener	0	Organics	PCBs								2008-11-07
PCB 173	PCB 173 Congener	0	Organics	PCBs								2008-11-07
PCB 174	PCB 174 Congener	38411255	Organics	PCBs	Congeners				All			2007-07-27
PCB 175	PCB 175 Congener	0	Organics	PCBs								2008-11-07
PCB 176	PCB 176 Congener	0	Organics	PCBs								2008-11-07
PCB 177	PCB 177 Congener	52663704	Organics	PCBs	Congeners				All			2007-07-27
PCB 178	PCB 178 Congener	0	Organics	PCBs								2008-11-07
PCB 178(Surrogate)	Surrogate: PCB 178 Congener	0	Organics	PCBs								2008-09-05
PCB 178-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 178-13C12	232919674	Organics	PCBs	IDA							2023-10-19
PCB 179	PCB 179 Congener	52663646	Organics	PCBs	Congeners				All			2007-07-27
PCB 180	PCB 180 Congener	35065293	Organics	PCBs	Congeners				All			2007-07-27
PCB 180(Surrogate)	Surrogate: PCB 180 Congener	0	Organics	PCBs								2008-09-05
PCB 180/193	PCB 180/193 Congener	0	Organics	PCBs								2010-07-14
PCB 180/193(Surrogate)	Surrogate: PCB 180/193	0										2020-05-01
PCB 180-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 180-13C12	160901826	Organics	PCBs	IDA							2023-10-27
PCB 181	PCB 181 Congener	0	Organics	PCBs								2008-11-07
PCB 182	PCB 182 Congener	0	Organics	PCBs								2008-11-07
PCB 182/187	PCB 182/187 Congener	0	Organics	PCBs	Congeners				All			2015-03-13
PCB 183	PCB 183 Congener	52663691	Organics	PCBs	Congeners				All			2007-07-27
PCB 183/185	PCB 183/185 Congener	0	Organics	PCBs								2010-07-14
PCB 184	PCB 184 Congener	0	Organics	PCBs								2008-11-07
PCB 185	PCB 185 Congener	0	Organics	PCBs								2008-11-07
PCB 186	PCB 186 Congener	0	Organics	PCBs								2008-11-07
PCB 187	PCB 187 Congener	52663680	Organics	PCBs	Congeners				All			2007-07-27
PCB 188	PCB 188 Congener	0	Organics	PCBs								2008-11-07
PCB 188(Surrogate)	Surrogate: PCB 188 Congener	0	Organics	PCBs								2008-11-17
PCB 188-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 188-13C12	234432918	Organics	PCBs	IDA							2023-10-27
PCB 189	PCB 189 Congener	39635319	Organics	PCBs	Congeners				All			2007-07-27
PCB 189 (TEQ ND=0)	PCB 189 (TEQ ND=0)	0	Organics									2017-03-06
PCB 189 (TEQ ND=1/2 DL)	PCB 189 (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB 189 (TEQ ND=DL)	PCB 189 (TEQ ND=DL)	0	Organics									2017-03-06
PCB 189(Surrogate)	Surrogate: PCB 189 Congener	0	Organics	PCBs								2008-09-05
PCB 189-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 189-13C12	208263734	Organics	PCBs	IDA							2023-10-27
PCB 190	PCB 190 Congener	0	Organics	PCBs								2008-11-07
PCB 191	PCB 191 Congener	0	Organics	PCBs								2008-11-07
PCB 191(Surrogate)	Surrogate: PCB 191 Congener	0	Organics	PCBs	Congeners							2012-04-23
PCB 192	PCB 192 Congener	0	Organics	PCBs								2008-11-07
PCB 193	PCB 193 Congener	0	Organics	PCBs								2008-06-27
PCB 194	PCB 194 Congener	35694087	Organics	PCBs	Congeners				All			2007-07-27
PCB 194(Surrogate)	Surrogate: PCB 194 Congener	0	Organics	PCBs								2009-08-14
PCB 194-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 194-13C12	208263745	Organics	PCBs	IDA							2024-04-22
PCB 195	PCB 195 Congener	52663782	Organics	PCBs	Congeners				All			2007-07-27
PCB 195/208	PCB 195/208 Congener	0	Organics	PCBs	Congeners							2012-05-14
PCB 196	PCB 196 Congener	0	Organics	PCBs								2008-11-07
PCB 196/203	PCB 196/203 Congener	0	Organics	PCBs					All			2012-10-30
PCB 197	PCB 197 Congener	0	Organics	PCBs								2008-11-07
PCB 197/200	PCB 197/200 Congener	0	Organics	PCBs								2010-07-14
PCB 198	PCB 198 Congener	68194172	Organics	PCBs								2008-06-27
PCB 198(Surrogate)	Surrogate: PCB 198 Congener	68194172	Organics	PCBs	Congeners				All			2007-07-27
PCB 198/199	PCB 198/199 Congener	0	Organics	PCBs	Congeners				All			2008-02-21
PCB 199	PCB 199 Congener	52663759	Organics	PCBs								2008-06-27
PCB 199/200	PCB 199/200 Congener	0	Organics	PCBs								2016-05-20
PCB 200	PCB 200 Congener	52663737	Organics	PCBs	Congeners				All			2007-07-27
PCB 201	PCB 201 Congener	40186718	Organics	PCBs	Congeners				All			2007-07-27
PCB 202	PCB 202 Congener	0	Organics	PCBs								2008-11-07
PCB 202(Surrogate)	Surrogate: PCB 202 Congener	0	Organics	PCBs								2008-11-17
PCB 202-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 202-13C12	105600268	Organics	PCBs	IDA							2023-10-27
PCB 203	PCB 203 Congener	52663760	Organics	PCBs	Congeners				All			2007-07-27
PCB 204	PCB 204 Congener	0	Organics	PCBs								2008-11-07
PCB 205	PCB 205 Congener	0	Organics	PCBs								2008-11-07
PCB 205(Surrogate)	Surrogate: PCB 205 Congener	0	Organics	PCBs								2008-11-17
PCB 205-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 205-13C12	234446641	Organics	PCBs	IDA							2023-10-27
PCB 206	PCB 206 Congener	40186729	Organics	PCBs	Congeners				All			2007-07-27
PCB 206(Surrogate)	Surrogate: PCB 206 Congener	0	Organics	PCBs								2008-11-17
PCB 206-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 206-13C12	208263756	Organics	PCBs	IDA							2023-10-27
PCB 207	PCB 207 Congener	0	Organics	PCBs								2008-06-27
PCB 207(Surrogate)	Surrogate: PCB 207 Congener	52663793	Organics	PCBs	Congeners				All			2007-07-27
PCB 208	PCB 208 Congener	0	Organics	PCBs								2008-11-07
PCB 208(Surrogate)	Surrogate: PCB 208 Congener	0	Organics	PCBs								2008-11-17
PCB 208-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 208-13C12	234432929	Organics	PCBs	IDA							2023-10-27
PCB 209	PCB 209 Congener (Decachlorobiphenyl) (DCB)	2051243	Organics	PCBs	Congeners				All			2013-10-14
PCB 209(Surrogate)	Surrogate: PCB 209 Congener (Decachlorobiphenyl) (DCB)	2051243	Organics	PCBs	Congeners				All			2013-10-14
PCB 209(Surrogate)DB-608	Surrogate: PCB 209 run on DB-608 (Decachlorobiphenyl) (DCB)	2051243	Organics	PCBs					All			2013-08-06
PCB 209(Surrogate)HP-5	Surrogate: PCB 209 run on HP-5 (Decachlorobiphenyl) (DCB)	2051243	Organics	PCBs					All			2013-08-06
PCB 209-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 209-13C	0										2023-10-27
PCB 209-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 209-13C12	105600279	Organics	PCBs	IDA							2023-10-27
PCB AROCLOR 1016	PCB Aroclor 1016	12674112	Organics	PCBs	Aroclors				All			2007-07-27
PCB AROCLOR 1221	PCB Aroclor 1221	11104282	Organics	PCBs	Aroclors				All			2007-07-27
PCB AROCLOR 1232	PCB Aroclor 1232	11141165	Organics	PCBs	Aroclors				All			2007-07-27
PCB AROCLOR 1242	PCB Aroclor 1242	53469219	Organics	PCBs	Aroclors				All			2007-07-27
PCB AROCLOR 1248	PCB Aroclor 1248	12672296	Organics	PCBs	Aroclors				All			2007-07-27
PCB AROCLOR 1254	PCB Aroclor 1254	11097691	Organics	PCBs	Aroclors				All			2007-07-27
PCB AROCLOR 1260	PCB Aroclor 1260	11096825	Organics	PCBs	Aroclors				All			2007-07-27
PCB AROCLOR 1262	PCB Aroclor 1262	37324235	Organics	PCBs	Aroclors				All			2017-05-17
PCB AROCLOR 1268	PCB AROCLOR 1268	11100144	Organics	PCBs	Aroclors							2020-04-17
PCB TEQ (3 PCBs)	PCB TEQ (3 PCBs)	0	Organics	DioxinsDibenzofurans								2008-06-27
PCB TEQ (5 PCBs)	PCB TEQ (5 PCBs)	0	Organics	DioxinsDibenzofurans								2008-06-27
PCB TOTAL (TEQ ND=0)	PCB TOTAL (TEQ ND=0)	0	Organics									2017-03-06
PCB TOTAL (TEQ ND=1/2 DL)	PCB TOTAL (TEQ ND=1/2 DL)	0	Organics									2017-03-06
PCB TOTAL (TEQ ND=DL)	PCB TOTAL (TEQ ND=DL)	0	Organics									2017-03-06
PCT AROCLOR 5432	Polychlorinated Terphenyl AROCLOR 5432	0										2019-05-17
PCT AROCLOR 5442	Polychlorinated Terphenyl AROCLOR 5442	0										2019-05-17
PCT AROCLOR 5460	Polychlorinated Terphenyl AROCLOR 5460	0	Organics	PCBs								2014-01-28
PCT_DR	Percent dry channel	0	Bioassessment						All			2021-01-28
PCT_FAST	Percent fast-water habitat of reach	0	Bioassessment						All			2021-01-28
PCT_POOL	Percent pool habitat of reach	0	Bioassessment						All			2021-01-28
PCT_RC	Percent concrete or asphalt streambed substrate physical-habitat metric	0	Bioassessment						All			2021-01-28
PCT_SAFN	Percent sands and fines streambed substrate physical-habitat metric	0	Bioassessment						All			2021-01-28
PCT_SLOW	Percent slow-water habitat of reach	0	Bioassessment						All			2021-01-28
Pebble	Pebble	0	Inorganics	Conventionals	GrainSize				All			2011-09-08
Pebble, Large_WS (16 to <32 mm_Phi -4 to >-5)	Large Pebble_Wentworth Scale (16 to <32 mm_Phi -4 to >-5)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Pebble, Medium_WS (8 to <16 mm_Phi -3 to >-4)	Medium Pebble_Wentworth Scale (8 to <16 mm_Phi -3 to >-4)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Pebble, Small_WS (4 to <8 mm_Phi -2 to >-3)	Small Pebble_Wentworth Scale (4 to <8 mm_Phi -2 to >-3)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Pebble, Very Large_WS (32 to <64 mm_Phi -5 to >-6)	Very Large Pebble_Wentworth Scale (32 to <64 mm_Phi -5 to >-6)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Pebulate	Pebulate (PEBC)	1114712	Organics	Pesticides	Pest-Carbamates				All			2013-05-28
PeCDD, 1,2,3,7,8-	1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD)	40321764	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
PeCDD, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD)	40321764	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
PeCDD-13C12, 1,2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin-13C12 (PeCDD-13C12)	109719791	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
PeCDF, 1,2,3,7,8-	1,2,3,7,8-Pentachlorodibenzofuran (PeCDF)	57117416	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
PeCDF, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzofuran (PeCDF)	57117416	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
PeCDF, 2,3,4,7,8-	2,3,4,7,8-Pentachlorodibenzofuran (PeCDF)	57117314	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
PeCDF, 2,3,4,7,8-(Surrogate)	Surrogate: 2,3,4,7,8-Pentachlorodibenzofuran (PeCDF)	57117314	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
PeCDF-13C12, 1,2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8-Pentachlorodibenzofuran-13C12 (PeCDF-13C12)	109719779	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
PeCDF-13C12, 2,3,4,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,4,7,8-Pentachlorodibenzofuran-13C12 (PeCDF-13C12)	116843028	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
Pen/Marker	Pen/Marker	0	Debris	Trash	Plastics	Toxic			All			2014-11-04
Pendimethalin	Pendimethalin (Prowl)	40487421	Organics	Pesticides	Herbicides				All			2013-05-28
Penicillin G	Penicillin G	61336	Organics	PPCPs								2010-04-26
Penicillin V	Penicillin V	87081	Organics	PPCPs								2025-08-25
Penoxsulam	Penoxsulam	219714962	Organics	Pesticides	Herbicides							2011-10-13
Pentabromobenzene	Pentabromobenzene (PBBZ)	608902	Organics	FlameRetardants								2015-07-16
Pentabromobenzyl acrylate	Pentabromobenzyl acrylate (PBBA)	59447551	Organics	FlameRetardants					All			2014-03-13
Pentabromobenzyl bromide	Pentabromobenzyl bromide (PBBB)	38521516	Organics	FlameRetardants					All			2014-03-13
Pentabromobenzyl Bromide-1/Pentabromotoluene	Pentabromobenzyl Bromide (isomer 1)/Pentabromotoluene (PBBB-1/PBT coeluants)	0	Organics	FlameRetardants								2015-07-16
Pentabromobenzyl Bromide-2/Polybrominated Biphenyl 101	Pentabromobenzyl bromide (isomer 2)/Polybrominated Biphenyl 101 (PBBB-2/BB-101 coeluants)	0	Organics	FlameRetardants								2015-07-16
Pentabromoethylbenzene	Pentabromoethylbenzene (PBEB)	85223	Organics	FlameRetardants								2010-01-04
Pentabromotoluene	Pentabromotoluene (PBT)	87832	Organics	FlameRetardants					All			2014-03-13
Pentachloroanisole	Pentachloroanisole	1825214	Organics	VOCs								2014-01-29
Pentachlorobenzene	Pentachlorobenzene	0	Organics	VOCs								2014-02-05
Pentachlorobenzene(Surrogate)	Surrogate: Pentachlorobenzene	0	Organics	VOCs								2014-02-05
Pentachlorobenzene-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Pentachlorobenzene-13C6	2483735540										2024-01-19
Pentachloroethane	Pentachloroethane	76017	Organics									2018-02-13
Pentachloronitrobenzene	Pentachloronitrobenzene (PCNB)	82688	Organics	Pesticides	Pest-OCHs	Algaecides	Fungicides	Nematocides	All			2014-02-05
Pentachlorophenol	Pentachlorophenol	87865	Organics	SVOCs	Phenols	Chlorinated Phenols	Insecticides	Fungicides	All			2007-07-27
Pentacosane, n-	n-Pentacosane	629992	Organics	Alkanes								2013-05-01
Pentadecane, n-	n-Pentadecane	629629	Organics	Alkanes								2013-05-01
Penthiopyrad	Penthiopyrad	183675823	Organics	Pesticides	Fungicides							2018-01-03
Pentoxifylline	Pentoxifylline	6493056										2021-05-07
Percent normal pluteus stage	Percent normal pluteus stage	0	Toxicity						All			2007-07-27
Perchlorate	Perchlorate	14797730	Inorganics	Conventionals					All			2007-07-27
Perfluoro(2-ethoxyethane)sulfonic Acid	Perfluoro(2-ethoxyethane)sulfonic acid (PFEESA)	113507827	Organics	PFAS								2021-06-02
Perfluoro(4-Ethylcyclohexane)Sulfonic Acid	Perfluoro(4-Ethylcyclohexane)Sulfonic Acid (Perfluoro(Perfluoroethyl)Cyclohexanesulfonic Acid) (PFecHS)	133201077	Organics	PFAS								2026-02-10
Perfluoro-2-Ethoxypropanoic Acid	Perfluoro-2-Ethoxypropanoic Acid (PEPA)	267239612	Organics	PFAS								2026-02-10
Perfluoro-2-Methoxyacetic Acid	Perfluoro-2-Methoxyacetic Acid (PFMOAA)	674135	Organics	PFAS								2026-02-10
Perfluoro-2-Propoxypropanoic Acid	Perfluoro-2-Propoxypropanoic Acid	13252136	Organics	PFAS								2019-08-28
Perfluoro-3-([1-(Ethenyloxy)Propan-2-yl]oxy)Propanoic Acid	Perfluoro-3-([1-(Ethenyloxy)Propan-2-yl]oxy)Propanoic Acid (EVE Acid)	69087463	Organics	PFAS								2026-02-10
Perfluoro-3,5,7,9,11-Pentaoxadodecanoic Acid	Perfluoro-3,5,7,9,11-Pentaoxadodecanoic Acid (PFO5DoDA)	39492916	Organics	PFAS								2026-02-10
Perfluoro-3,5,7,9-Butaoxadecanoic Acid	Perfluoro-3,5,7,9-Butaoxadecanoic Acid (Perfluoro-3,5,7,9-Tetraoxadecanoic Acid) (PFO4DA)	39492905	Organics	PFAS								2026-02-10
Perfluoro-3,5,7-Trioxaoctanoic Acid	Perfluoro-3,5,7-Trioxaoctanoic Acid (PFO3OA)	39492892	Organics	PFAS								2026-02-10
Perfluoro-3,5-Dioxahexanoic Acid	Perfluoro-3,5-Dioxahexanoic Acid (PFO2HxA)	39492881	Organics	PFAS								2026-02-10
Perfluoro-3,6-Dioxa-4-Methyl-7-Octene-1-Sulfonic Acid	Perfluoro-3,6-Dioxa-4-Methyl-7-Octene-1-Sulfonic Acid (PS Acid) (Nafion Byproduct 1)	29311679	Organics	PFAS								2026-02-10
Perfluoro-3-methoxypropanoic Acid	Perfluoro-3-methoxypropanoic Acid (PFMPA)	377731	Organics	PFAS								2025-01-27
Perfluoro-4-(2-Sulfoethoxy)Pentanoic Acid	Perfluoro-4-(2-Sulfoethoxy)Pentanoic Acid (R-PSDA) (Nafion Byproduct 4)	2416366180	Organics	PFAS								2026-02-10
Perfluoro-4-Isopropoxybutanoic Acid	Perfluoro-4-Isopropoxybutanoic Acid (PFECA G) (PFPE-1)	801212599	Organics	PFAS								2026-02-10
Perfluoro-4-methoxybutanoic Acid	Perfluoro-4-methoxybutanoic Acid (PFMBA)	863090895	Organics	PFAS								2025-01-27
Perfluoro-4-Methyl-3,6-Dioxaoctanesulfonic Acid, 7H-	7H-Perfluoro-4-Methyl-3,6-Dioxaoctanesulfonic Acid (Hydro-PS Acid) (Nafion Byproduct 2)	749836202	Organics	PFAS								2026-02-10
Perfluorobutanesulfonic Acid	Perfluorobutanesulfonic Acid (PFBS)	375735	Organics	PFAS								2025-01-27
Perfluorobutanesulfonic Acid-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorobutanesulfonic Acid-13C3 (PFBS-13C3)	2708218840	Organics	PFAS	IDA							2025-04-10
Perfluorobutanoic Acid	Perfluorobutanoic Acid (PFBA)	375224	Organics	PFAS								2025-01-27
Perfluorobutanoic Acid-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorobutanoic Acid-13C4 (PFBA-13C4)	1017281296	Organics	PFAS	IDA				All			2025-04-04
Perfluorodecane Sulfonic acid, 1H,1H,2H,2H-	1H,1H,2H,2H-Perfluorodecane Sulfonic Acid (8:2FTS)	39108344	Organics	PFAS								2025-01-27
Perfluorodecane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue)	Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorodecane Sulfonic Acid-13C2 (8:2FTS-13C2)	2708218908	Organics	PFAS	IDA				All			2025-04-04
Perfluorodecanesulfonic Acid	Perfluorodecanesulfonic Acid (PFDS)	335773	Organics	PFAS								2025-01-27
Perfluorodecanoic Acid	Perfluorodecanoic Acid (PFDA)	335762	Organics	PFAS								2025-01-23
Perfluorodecanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorodecanoic Acid-13C2 (PFDA-13C2)	960315508	Organics	PFAS	IDA							2026-02-10
Perfluorodecanoic Acid-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorodecanoic Acid-13C6 (PFDA-13C6)	2328024560	Organics	PFAS	IDA				All			2025-04-04
Perfluorodecylphosphate, 1H,1H,2H,2H-	1H,1H,2H,2H-perfluorodecylphosphate (8:2 monoPAP)	0	Organics	PFAS	PFC Precursor							2014-10-20
Perfluorodecylphosphate-13C2, 1H,1H,2H,2H-(Surrogate)	Surrogate: 1H,1H,2H,2H-perfluorodecylphosphate-13C2	0	Organics	PFAS								2014-10-02
Perfluorododecane Sulfonic Acid, 1H,1H,2H,2H-	1H,1H,2H,2H-Perfluorododecane Sulfonic Acid (10:2 FTS)	120226600	Organics	PFAS								2026-02-10
Perfluorododecane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue)	Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorododecane Sulfonic Acid-13C2 (10:2 FTS-13C2)	0	Organics	PFAS	IDA							2026-02-10
Perfluorododecanesulfonic Acid	Perfluorododecanesulfonic Acid (PFDoS)	79780395	Organics	PFAS								2025-01-27
Perfluorododecanoic Acid	Perfluorododecanoic Acid (PFDoA)	307551	Organics	PFAS								2025-01-23
Perfluorododecanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorododecanoic Acid-13C2 (PFDoA-13C2)	960315520	Organics	PFAS	IDA				All			2025-04-04
Perfluoroethanesulfonic Acid, 2-(1,2,2,2-Tetrafluoroethoxy)	2-(1,2,2,2-Tetrafluoroethoxy)Perfluoroethanesulfonic Acid (NVHOS)	801209994	Organics	PFAS								2026-02-10
Perfluoroheptanesulfonic Acid	Perfluoroheptanesulfonic Acid (PFHpS)	375928	Organics	PFAS								2025-01-23
Perfluoroheptanoic Acid	Perfluoroheptanoic Acid (PFHpA)	375859	Organics	PFAS								2025-01-27
Perfluoroheptanoic acid-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroheptanoic Acid-13C4 (PFHpA-13C4)	2328024559	Organics	PFAS	IDA				All			2025-04-04
Perfluoroheptyl Propanoic Acid, 3-	3-Perfluoroheptyl Propanoic Acid (7:3FTCA)	812704	Organics	PFAS								2025-02-04
Perfluorohexadecanoic Acid	Perfluorohexadecanoic acid (PFHxDA)	67905195	Organics	PFAS								2026-02-27
Perfluorohexadecanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexadecanoic Acid-13C2 (PFHxDA-13C2)	0	Organics	PFAS	IDA							2026-02-10
Perfluorohexane Sulfonic Acid, 1H,1H,2H,2H-	1H,1H,2H,2H-Perfluorohexane Sulfonic Acid (4:2FTS)	757124724	Organics	PFAS								2025-01-27
Perfluorohexane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue)	Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorohexane Sulfonic Acid-13C2 (4:2FTS-13C2)	2708218884	Organics	PFAS	IDA				All			2025-04-04
Perfluorohexanesulfonic Acid	Perfluorohexanesulfonic Acid (PFHxS)	355464	Organics	PFAS								2025-01-27
Perfluorohexanesulfonic Acid-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanesulfonic Acid-13C3 (PFHxS-13C3)	2708218862	Organics	PFAS	IDA							2025-04-10
Perfluorohexanesulfonic Acid-18O2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanesulfonic Acid-18O2 (PFHxS-18O2)	1585941145	Organics	PFAS	IDA							2026-02-10
Perfluorohexanoic Acid	Perfluorohexanoic Acid (PFHxA)	307244	Organics	PFAS								2025-01-27
Perfluorohexanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanoic Acid-13C2 (PFHxA-13C2)	960315473	Organics	PFAS	IDA							2026-02-10
Perfluorohexanoic Acid-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanoic Acid-13C5 (PFHxA-13C5)	2328024548	Organics	PFAS	IDA				All			2025-04-04
Perfluorohexylperfluorooctylphosphinate	Perfluorohexylperfluorooctylphosphinate (6:8 PFPi)	0	Organics	PFAS	PFC Precursor							2014-10-20
Perfluorohexylphosphonate	Perfluorohexylphosphonate (PFHxPA)	0	Organics	PFAS	PFC Precursor							2014-10-20
Perfluorohexylphosphonate-Cl(Surrogate)	Surrogate: Perfluorohexylphosphonate-Cl	0	Organics	PFAS	PFC Precursor							2014-10-30
Perfluorononanesulfonic Acid	Perfluorononanesulfonic Acid (PFNS)	68259121	Organics	PFAS								2025-01-27
Perfluorononanoic Acid	Perfluorononanoic Acid (PFNA)	375951	Organics	PFAS								2025-01-27
Perfluorononanoic Acid-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorononanoic Acid-13C5 (PFNA-13C5)	960315495	Organics	PFAS	IDA							2026-02-10
Perfluorononanoic Acid-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorononanoic Acid-13C9 (PFNA-13C9)	2283397806	Organics	PFAS	IDA				All			2025-04-04
Perfluorooctadecanoic Acid	Perfluorooctadecanoic Acid (PFODA) (PFOcDA)	16517116	Organics	PFAS								2026-02-27
Perfluorooctane Sulfonamido Acetic Acid	Perfluorooctane Sulfonamido Acetic Acid (FOSAA)	0	Organics	PFAS	PFC Precursor							2014-10-20
Perfluorooctane Sulfonic Acid, 1H,1H,2H,2H-	1H,1H,2H,2H-Perfluorooctane Sulfonic Acid (6:2FTS)	27619972	Organics	PFAS								2025-01-27
Perfluorooctane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue)	Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorooctane Sulfonic Acid-13C2 (6:2FTS-13C2)	2708218895	Organics	PFAS	IDA				All			2025-04-04
Perfluorooctanesulfonamide	Perfluorooctanesulfonamide (PFOSA)	754916	Organics	PFAS								2025-04-04
Perfluorooctanesulfonamide-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanesulfonamide-13C8 (PFOSA-13C8)	0	Organics	PFAS	IDA				All			2025-04-04
Perfluorooctanesulfonamide-13C8(Surrogate)	Surrogate: Perfluorooctanesulfonamide-13C8	0	Organics	PFAS	PFOA				All			2012-10-29
Perfluorooctanesulfonic Acid	Perfluorooctanesulfonic Acid (PFOS)	1763231	Organics	PFAS								2025-01-27
Perfluorooctanesulfonic Acid-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanesulfonic Acid-13C4 (PFOS-13C4)	960315531	Organics	PFAS	IDA							2026-02-10
Perfluorooctanesulfonic Acid-13C4(Surrogate)	Surrogate: Perfluorooctanesulfonic Acid-13C4 (PFOS-13C4)	960315531	Organics	PFAS								2026-01-23
Perfluorooctanesulfonic Acid-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanesulfonic Acid-13C8 (PFOS-13C8)	2522762167	Organics	PFAS	IDA				All			2025-04-04
Perfluorooctanesulfonic Acid-13C8(Surrogate)	Surrogate: Perfluorooctanesulfonic Acid-13C8 (PFOS-13C8)	2522762167	Organics	PFAS								2025-08-15
Perfluorooctanoic Acid	Perfluorooctanoic Acid (PFOA)	335671	Organics	PFAS								2025-01-27
Perfluorooctanoic Acid, 2H,2H,3H,3H-	2H,2H,3H,3H-Perfluorooctanoic Acid (5:3FTCA)	914637493	Organics	PFAS								2025-01-27
Perfluorooctanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanoic Acid-13C2 (PFOA-13C2)	864071089	Organics	PFAS	IDA				All			2025-04-04
Perfluorooctanoic Acid-13C2(Surrogate)	Surrogate: Perfluorooctanoic Acid-13C2 (PFOA-13C2)	864071089	Organics	PFAS					All			2025-06-11
Perfluorooctanoic Acid-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanoic Acid-13C4 (PFOA-13C4)	960315484	Organics	PFAS	IDA							2026-02-10
Perfluorooctanoic Acid-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanoic Acid-13C8 (PFOA-13C8)	1350614844	Organics	PFAS	IDA				All			2025-04-04
Perfluorooctylphosphate, 1H,1H,2H,2H-	1H,1H,2H,2H-perfluorooctylphosphate (6:2 monoPAP)	0	Organics	PFAS	PFC Precursor							2014-10-20
Perfluorooctylphosphate-13C2, 1H,1H,2H,2H-(Surrogate)	Surrogate: 1H,1H,2H,2H-perfluorooctylphosphate-13C2	0	Organics	PFAS								2014-10-02
Perfluorooctylphosphonate	Perfluorooctylphosphonate (PFOPA)	0	Organics	PFAS	PFC Precursor							2014-10-20
Perfluoropentanesulfonic Acid	Perfluoropentanesulfonic Acid (PFPeS)	2706914	Organics	PFAS								2025-01-27
Perfluoropentanoic Acid	Perfluoropentanoic Acid (PFPeA)	2706903	Organics	PFAS								2025-01-27
Perfluoropentanoic Acid, 4-(2-Carboxy-1,1,2,2-Tetrafluoroethoxy)-	4-(2-Carboxy-1,1,2,2-Tetrafluoroethoxy)-Perfluoropentanoic Acid (R-EVE)	2416366226	Organics	PFAS								2026-02-10
Perfluoropentanoic Acid-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoropentanoic Acid-13C5 (PFPeA-13C5)	2283397793	Organics	PFAS	IDA				All			2025-04-04
Perfluoropropanesulfonic Acid	Perfluoropropanesulfonic Acid (PFPrS)	423416	Organics	PFAS								2026-02-10
Perfluoropropanoic Acid	Perfluoropropanoic Acid (PFPrA)	422640	Organics	PFAS								2026-02-10
Perfluoropropyl Propanoic Acid, 3-	3-Perfluoropropyl Propanoic Acid (3:3FTCA)	356025	Organics	PFAS								2025-01-27
Perfluorotetradecanoic Acid	Perfluorotetradecanoic Acid (PFTeDA)	376067	Organics	PFAS								2025-01-27
Perfluorotetradecanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorotetradecanoic Acid-13C2 (PFTeDA-13C2)	2708218828	Organics	PFAS	IDA				All			2025-04-04
Perfluorotridecanoic Acid	Perfluorotridecanoic Acid (PFTrDA)	72629948	Organics	PFAS								2025-01-27
Perfluorotridecanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorotridecanoic Acid-13C2 (PFTrDA-13C2)	0	Organics	PFAS								2025-04-14
Perfluoroundecanoic Acid	Perfluoroundecanoic Acid (PFUnA)	2058948	Organics	PFAS								2025-01-27
Perfluoroundecanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroundecanoic Acid-13C2 (PFUnA-13C2)	960315519	Organics	PFAS	IDA							2026-02-10
Perfluoroundecanoic Acid-13C7(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroundecanoic Acid-13C7 (PFUnA-13C7)	0	Organics	PFAS	IDA				All			2025-04-04
Periphyton Biomass Index	Periphyton Biomass Index	0	FieldObservations	Habitat								2018-02-06
Permethrin, cis-	cis-Permethrin, formerly peak 1	61949766	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Permethrin, cis-(Surrogate)	Surrogate: cis-Permethrin	61949766	Organics	Pesticides	Pyrethroids	Insecticides						2026-05-08
Permethrin, Total	Total Permethrin, sum peaks cis and trans (formerly 1 & 2)	52645531	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Permethrin, trans-	trans-Permethrin formerly peak 2	61949777	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Permethrin, trans-(Surrogate)	Surrogate: trans-Permethrin	61949777	Organics	Pesticides	Pyrethroids	Insecticides						2026-05-08
Permethrin-13C6, cis-(IsoDilAnalogue)	Isotope Dilution Analogue: cis-Permethrin-13C6	0	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Permethrin-13C6, cis-(Surrogate)	Surrogate: cis-Permethrin-13C6	0	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Permethrin-13C6, trans-(IsoDilAnalogue)	Isotope Dilution Analogue: trans-Permethrin-13C6	0	Organics	Pesticides	Pyrethroids	Insecticides			All			2026-05-08
Personal hygiene	Hygiene products	0	Debris	Trash	Plastics							2022-11-02
Perthane	Perthane	72560	Organics	Pesticides	OrganochlorinePesticides	Insecticides						2011-07-15
Perylene	Perylene	198550	Organics	PAHs	SVOCs	HMW_PAH			All			2007-07-27
Perylene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Perylene-d12	1520963	Organics	PAHs	IDA							2023-11-07
Perylene-d12(Surrogate)	Surrogate: Perylene-d12	1520963	Organics	PAHs	SVOCs	HMW_PAH			All			2007-07-27
pH	pH	0	WaterQualityMeasurements	ToxTreatment					All			2009-08-20
pH, Daily Maximum	Daily Maximum pH	0	WaterQualityMeasurements	Conventionals					All			2024-09-06
pH, Daily Minimum	Daily Minimum pH	0	WaterQualityMeasurements	Conventionals					All			2024-09-06
Phenanthrene	Phenanthrene	85018	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors		All			2007-07-27
Phenanthrene/Anthracene, C1-	C1-Phenanthrene/Anthracene	0	Organics	PAHs	SVOCs	LMW_PAH			All			2010-06-21
Phenanthrene/Anthracene, C2-	C2-Phenanthrene/Anthracene	0	Organics	PAHs	SVOCs	LMW_PAH			All			2010-06-21
Phenanthrene/Anthracene, C3-	C3-Phenanthrene/Anthracene	0	Organics	PAHs	SVOCs	LMW_PAH			All			2010-06-21
Phenanthrene/Anthracene, C4-	C4-Phenanthrene/Anthracene	0	Organics	PAHs	SVOCs	LMW_PAH			All			2010-06-21
Phenanthrene-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Phenanthrene-d10	1517222	Organics	PAHs	IDA							2023-11-07
Phenanthrene-d10(Surrogate)	Surrogate: Phenanthrene-d10	1517222	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors		All			2007-07-27
Phenmedipham	Phenmedipham	0	Organics	Pesticides	Herbicides							2017-04-04
Phenol	Phenol	108952	Organics	SVOCs	Phenols	non-Chlorinated Phenols			All			2007-07-27
Phenol, 2-(2H-Benzotriazol-2-yl)-4,6-bis(1-Methyl-1-Phenylethyl)-	2-(2H-Benzotriazol-2-yl)-4,6-bis(1-methyl-1-phenylethyl)phenol (UV-234)	70321867	Organics	Benzotriazoles and Benzothiazoles								2026-02-10
Phenol-d5(Surrogate)	Surrogate: Phenol-d5	4165622	Organics	SVOCs					All			2014-01-29
Phenol-d6(Surrogate)	Surrogate: Phenol-d6	13127883	Organics	VOCs	Phenols	non-Chlorinated Phenols						2007-07-27
Phenolic Resin Fragment	Phenolic resin Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Phenolics, Total	Total Phenolics, classification of phenols	0	Organics	PPCPs					All			2013-05-28
Phenothrin	Phenothrin	26002802	Organics	Pesticides	Insecticides	Pyrethroids			All			2009-06-22
Phenyl-p-phenylenediamine-quinone, N-Isopropyl-N'-	N-Isopropyl-N'-phenyl-p-phenylenediamine-quinone (IPPD-quinone)	68054739	Organics	para-Phenylenediamine (PPD) Derivatives								2025-06-29
Phenylpyrazole, 1-(Surrogate)	Surrogate: 1-Phenylpyrazole	1126007	Organics	Pesticides	Insecticides	Phenylpyrazoles						2024-07-23
Phenytoin	Phenytoin	57410										2018-08-20
Phenytoin-d10(Surrogate)	Surrogate: Phenytoin-d10	65854979	Organics	PPCPs	Pharmaceuticals							2026-06-12
Pheophytin a	Pheophytin a	603178	Inorganics	Conventionals	Benthic				All			2011-11-10
PhiX174	phi X 174 bacteriophage	0	Microbiological									2020-10-29
Phone	Phone	0	Debris	Trash	Plastics	Toxic			All			2014-11-04
Phorate	Phorate	298022	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides		All			2007-07-27
Phorate sulfone	Phorate sulfone	2588047	Organics	Pesticides								2017-04-20
Phorate sulfoxide	Phorate sulfoxide	2588036	Organics	Pesticides								2017-04-20
Phoratoxon	Phoratoxon	0	Organics	Pesticides								2017-04-04
Phoratoxon Sulfone	Phoratoxon Sulfone	0	Organics	Pesticides								2017-04-04
Phoratoxon Sulfoxide	Phoratoxon Sulfoxide	0	Organics	Pesticides								2017-04-04
Phosalone	Phosalone	2310170	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Phosalone Oxon	Phosalone Oxon	0	Organics	Pesticides								2017-04-04
Phosmet	Phosmet	732116	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Phosmet-Oxon	Phosmet-Oxon	3735339	Organics	Pesticides								2017-04-20
Phosphamidon	Phosphamidon	13171216	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Phosphate as P	Phosphate as P	14265442	Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			All			2012-10-31
Phosphorus as P	Phosphorus as P	7723140	Inorganics	Conventionals	Nutrients				All			2012-10-31
Phosphorus as P, Total Organic	Total Organic Phosphorus (P-org)	0	Inorganics	Conventionals	Nutrients				All			2025-01-21
Phosphorus, Inorganic	Inorganic Phosohorus	0	Inorganics	Conventionals								2018-01-18
Phosphorus, Iron Bound	Phosphorus, Iron Bound	0	Inorganics	Conventional	Nutrients							2022-03-01
Phosphorus, loosely bound	Phosphorus, loosely bound	0	Inorganics	Conventional	Nutrients							1900-01-01
Photomirex	Photomirex	39801144	Organics	PCBs								2014-01-22
Phytane	Phytane	0	Organics	Alkanes								2014-01-28
Picarbutrazox	Picarbutrazox	500207045	Organics						All			2022-10-28
Picloram	Picloram	1918021	Organics	Herbicides								2016-05-20
Picoxystrobin	Picoxystrobin	117428225	Organics	Pesticides	Fungicides							2016-03-10
PictureCode	Picture code idenifier	0	FieldObservations	Habitat					All			2009-08-20
Pipe, PVC	Pipe, PVC	0	Debris	Trash	Plastics	Household			All			2014-11-04
Piperalin	Piperalin	0	Organics	Pesticides	Fungicides							2017-04-04
Piperonyl Butoxide	Piperonyl Butoxide	51036	Organics	Pesticides					All			2026-05-08
Piperonyl Butoxide-d9(Surrogate)	Surrogate: Piperonyl Butoxide-d9	0	Organics	Pesticides								2018-08-07
Piperonyl Cyclonene	Piperonyl Cyclonene	0	Organics	Pesticides	Insecticides							2017-04-04
Pipes, Drains	Pipes, Drains	0	Habitat						All			2009-08-20
Pirimicarb	Pirimicarb	0	Organics	Pesticides	Insecticides							2017-04-04
Pirimicarb sulfone	Pirimicarb sulfone	0	Organics	Pesticides								2017-04-10
Pirimicarb sulfoxide	Pirimicarb sulfoxide	0	Organics	Pesticides								2017-04-10
Pirimiphos Methyl	Pirimiphos Methyl	29232937	Organics	Pesticides	Insecticides							2013-05-29
Plastic	Plastic using Trash Protocol	0	Trash						All			2011-05-04
Plastic MicroDebris, > 4.75 mm	Plastic MicroDebris, > 4.75 mm	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, 0.355 mm	Plastic MicroDebris, 0.355 mm	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, 0.500 mm	Plastic MicroDebris, 0.500 mm	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, 1.0 mm	Plastic MicroDebris, 1.0 mm	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, 2.0 mm	Plastic MicroDebris, 2.0 mm	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, 4.75 mm	Plastic MicroDebris, 4.75 mm	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, Black	Plastic MicroDebris, Black	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, Blue	Plastic MicroDebris, Blue	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, Clear	Plastic MicroDebris, Clear	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, Green	Plastic MicroDebris, Green	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, Grey	Plastic MicroDebris, Grey	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, Orange	Plastic MicroDebris, Orange	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, Peach	Plastic MicroDebris, Peach	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, Pink	Plastic MicroDebris, Pink	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, Red	Plastic MicroDebris, Red	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, Tan	Plastic MicroDebris, Tan	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, White	Plastic MicroDebris, White	0	Debris	Plastics					All			2014-11-04
Plastic MicroDebris, Yellow	Plastic MicroDebris, Yellow	0	Debris	Plastics					All			2014-11-04
Plastic, Other	Plastic, Other	0	Debris	Trash	Plastics	Bags/Packaging			All			2014-11-04
Plate, Waxed Paper	Plate, Waxed Paper	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
PMMoV	Pepper mild mottle virus	0	Microbiological									2020-10-29
Point Source Discharges Extent	Point Source Discharges Extent	0	Habitat						All			2019-05-07
Point Source Discharges Intensity	Point Source Discharges Intensity	0	Habitat						All			2019-05-07
Point Source Discharges Proximity	Point Source Discharges Proximity	0	Habitat						All			2019-05-07
Poly(acrylonitrile) fiber	Poly(acrylonitrile) fiber, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fiber						2018-04-26
Poly(Aryletherketone) Film	Poly(Aryletherketone) Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Poly(methylhydrosiloxane) fiber	Poly(methylhydrosiloxane) fiber, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fiber						2018-04-26
Polyacrolein Fiber	Polyacrolein Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyacrolein Fragment	Polyacrolein Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyacrylamide fiber	Polyacrylamide fiber, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fiber						2018-04-26
Polycaprolactone Fiber	Polycaprolactone Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polycarbonate Fragment	Polycarbonate Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyester fiber	Polyester fiber, including polyester blends (blended with cotton or other natural-based fibers), that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fiber						2018-04-26
Polyester Fiber Bundle	Polyester Fiber Bundle	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyether block amide Film	Polyether block amide Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene Co-acrylic Acid Film	Polyethylene co-acrylic acid Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene Co-acrylic Acid Foam	Polyethylene co-acrylic acid Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene Co-acrylic Acid Fragment	Polyethylene co-acrylic acid Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene Co-acrylic Acid Sphere	Polyethylene co-acrylic acid Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene co-polymer fragment	Polyethylene co-polymer, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-06-18
Polyethylene Fiber	Polyethylene Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene Fiber Bundle	Polyethylene Fiber Bundle	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene Film	Polyethylene Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene Foam	Polyethylene Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene fragment	Polyethylene fragment, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-06-18
Polyethylene pellet	Polyethylene pellet, with cylindrical or round shape but not perfectly spherical, that was clearly manufactured at this size (not a fragment), that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Pellet						2018-04-26
Polyethylene sphere	Polyethylene sphere, perfectly spherical shape and smaller than a pellet, that was clearly manufactured at this size (not a fragment), that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Sphere						2018-06-19
Polyethylene Terephthalate Film	Polyethylene terephthalate Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene Terephthalate Foam	Polyethylene terephthalate Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene terephthalate fragment	Polyethylene terephthalate (PET) fragment that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-06-18
Polyethylene Terephthalate/Polyurethane Fiber	Polyethylene terephthalate/polyurethane Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene wax fragment	Polyethylene wax fragment, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-06-18
Polyethylene wax sphere	Polyethylene wax sphere, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Sphere						2018-06-19
Polyethylene/Polypropylene Co-polymer Fiber	Polyethylene/polypropylene copolymer Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene/Polypropylene Co-polymer Film	Polyethylene/polypropylene copolymer Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene/Polypropylene Co-polymer Fragment	Polyethylene/polypropylene copolymer Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylene/Polypropylene Co-polymer Sphere	Polyethylene/polypropylene copolymer Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyethylenimine Fiber	Polyethylenimine Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyoxymethylene fragment	Polyoxymethylene fragment that can be grouped under the plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-06-18
Polypropylene fiber	Polypropylene fiber, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fiber						2018-04-26
Polypropylene Fiber Bundle	Polypropylene Fiber Bundle	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polypropylene film	Polypropylene film that can be grouped under the plastic category	0	Microdebris	Anthropogenic	Plastics	Film						2018-06-18
Polypropylene Foam	Polypropylene Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polypropylene fragment	Polypropylene fragment, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-04-26
Polypropylene Sphere	Polypropylene Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polystyrene Fiber	Polystyrene Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polystyrene Fiber Bundle	Polystyrene Fiber Bundle	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polystyrene Film	Polystyrene Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polystyrene foam	Polystyrene foam fragment, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Foam						2018-04-26
Polystyrene fragment	Polystyrene fragment, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-04-26
Polystyrene Sphere	Polystyrene Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polystyrene/Acrylic Co-polymer Fiber	Polystyrene/Acrylic Co-polymer Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polystyrene/Acrylic Co-polymer Film	Polystyrene/Acrylic Co-polymer Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polystyrene/Acrylic Co-polymer Foam	Polystyrene/Acrylic Co-polymer Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polystyrene/Acrylic Co-polymer Fragment	Polystyrene/Acrylic Co-polymer Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polystyrene/Acrylic Co-polymer Sphere	Polystyrene/Acrylic Co-polymer Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polytetrafluoroethylene fiber	Polytetrafluoroethylene fiber, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fiber						2018-04-26
Polytetrafluoroethylene Fiber Bundle	Polytetrafluoroethylene Fiber Bundle	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polytetrafluoroethylene Film	Polytetrafluoroethylene Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polytetrafluoroethylene Fragment	Polytetrafluoroethylene Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyurethane fiber	Polyurethane fiber, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fiber						2018-04-26
Polyurethane Film	Polyurethane Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyurethane foam	Polyurethane foam fragment, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Foam						2018-04-26
Polyurethane fragment	Polyurethane fragment, not foam, that can be grouped under plastic category	0	Microdebris	Anthropogenic	Plastics	Fragment						2018-04-26
Polyurethane Sphere	Polyurethane Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Acetate Fiber	Polyvinyl Acetate Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Acetate Film	Polyvinyl Acetate Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Acetate Fragment	Polyvinyl Acetate Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Alcohol Fiber	Polyvinyl Alcohol Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Alcohol Film	Polyvinyl Alcohol Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Alcohol Foam	Polyvinyl Alcohol Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Alcohol Fragment	Polyvinyl Alcohol Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Butyral Fiber	Polyvinyl Butyral Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Butyral Film	Polyvinyl Butyral Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Butyral Foam	Polyvinyl Butyral Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Butyral Fragment	Polyvinyl Butyral Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Chloride Fiber	Polyvinyl Chloride Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Chloride Film	Polyvinyl Chloride Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Chloride Foam	Polyvinyl Chloride Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Chloride Fragment	Polyvinyl Chloride Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Ether Fiber	Polyvinyl Ether Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Polyvinyl Ether Film	Polyvinyl Ether Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Ponded	Ponded water that either evaporates and/or infiltrates and does not flow to a surface receiving water	0	Habitat									2014-04-07
Pool	Pool	0	Habitat						All			2009-08-20
Pool Form	Pool Form	0	Habitat						All			2009-08-20
Porosity	Porosity	0	WaterQualityMeasurements	Ancillary								2014-02-05
Position	Position along transect where sample collected	0	Habitat						All			2012-09-13
Potassium	Potassium	7440097	Inorganics	TraceElements	Metals	Conventionals			All			2007-07-27
Potential Non-Stormwater Source	Potential Non-Stormwater Source	0										2016-06-13
Poultry	Poultry	0	Habitat						All			2009-08-20
Power Plants	Power Plants	0	Habitat						All			2009-08-20
Prallethrin	Prallethrin	23031369	Organics	Pesticides	Insecticides	Pyrethroids			All			2009-06-22
Praziquantel	Praziquantel	55268741										2018-08-31
Precipitation	Precipitation	0	FieldObservations	Habitat					All			2009-08-20
PrecipitationLast24hrs	PrecipitationLast24hrs	0	FieldObservations	Habitat					All			2013-05-28
Precipitationlast72hrs	Precipitation within the last 72 hours	0										2016-06-13
Prednisolone	Prednisolone	50248	Organics	PPCPs								2010-04-26
Prednisone	Prednisone	53032	Organics	PPCPs								2010-04-26
Pressure	Pressure	0	WaterQualityMeasurements	Ancillary								2014-02-05
Primidone	Primidone	125337										2018-08-20
Primidone-d5(Surrogate)	Surrogate: Primidone-d5	73738064	Organics	PPCPs	Pharmaceuticals							2026-06-12
Primitive Parks, Camping	Primitive Parks, Camping	0	Habitat						All			2009-08-20
Pristane	Pristane	0	Organics	Alkanes								2014-01-28
Procambarus clarkia (SPY)	Procambarus clarkia, Assay name: SPY, 5’ AACTAGGGGTATAGTTGAGAG 3’, 5’ CAGAAGCTAAAGGAGGATAA 3’, 5HEX-AGGAGTTG AACAGGATGGACT-3IABkFQ	0	Microbiological									2023-12-22
Procymidone	Procymidone	32809168	Organics	Pesticides								2016-10-25
Prodiamine	Prodiamine	29091212	Organics	Herbicides								2016-05-20
Profenofos	Profenofos	41198087	Organics	Pesticides								2016-10-25
Profluralin	Profluralin	26399360	Organics	Pesticides	Herbicides							2016-10-25
Progesterone	Progesterone	57830										2018-08-31
Progesterone-d9(IsoDilAnalogue)	Isotope Dilution Analogue: Progesterone-d9	15775743	Organics									2022-07-22
Progesterone-d9(Surrogate)	Surrogate: Progesterone-d9	15775743	Organics	PPCPs								2026-06-12
Promecarb	Promecarb (3-methyl-5-(1-methylethyl)phenyl methylcarbamate)	2631370	Organics	Pesticides	Pest-Carbamates	Insecticides			All			2013-05-28
Promethazine	Promethazine	60877	Organics	PPCPs								2010-04-26
Promethazine-d4(Surrogate)	Surrogate: Promethazine-d4	0	Organics	PPCPs								2010-04-26
Prometon	Prometon	1610180	Organics	Pesticides	Pest-Triazines	Herbicides			All			2007-07-27
Prometryn	Prometryn	7287196	Organics	Pesticides	Pest-Triazines	Herbicides			All			2007-07-27
Pronamide	Pronamide (Propyzamide)	23950585	Organics	Herbicides					All			2013-05-28
Propachlor	Propachlor	1918167	Organics	Pesticides	Pest-Carbamates	Herbicides			All			2007-07-27
Propanil	Propanil	709988	Organics	Pesticides	Herbicides				All			2007-07-27
Propargite	Propargite	2312358	Organics	Pesticides	Pest-OPs	Acaricides			All			2007-07-27
Propazine	Propazine	139402	Organics	Pesticides	Pest-Triazines	Herbicides			All			2007-07-27
Propetamphos	Propetamphos	0	Organics	Pesticides	Insecticides							2017-04-04
Propham	Propham	122429	Organics	Pesticides	Pest-Carbamates	Herbicides			All			2007-07-27
Propiconazole	Propiconazole	60207901	Organics	Herbicides								2013-05-20
Proportion	Proportion	0	Habitat						All			2009-08-20
Propoxur	Propoxur	114261	Organics	Pesticides	Pest-Carbamates	Insecticides			All			2007-07-27
Propoxyphene	Propoxyphene	0	Organics	PPCPs								2010-04-26
Propoxyphene-d5(Surrogate)	Surrogate: Propoxyphene-d5	0	Organics	PPCPs								2010-04-26
Propranolol	Propranolol	525666	Organics	PPCPs								2010-04-26
Propranolol-d7(Surrogate)	Surrogate: Propranolol-d7	0	Organics	PPCPs								2010-04-26
Propylbenzene, n-	n-Propylbenzene	103651	Organics	VOCs					All			2007-07-27
Propylparaben	Propylparaben	94133										2021-05-07
Propyzamide	Propyzamide	23950585	Organics	Pesticides	Herbicides							2016-03-10
Propyzamide metabolite	Propyzamide metabolite	0	Organics	Pesticides	Herbicides							2017-04-04
Prosulfuron	Prosulfuron	0	Organics	Pesticides	Herbicides							2017-04-04
Pseudo-nitzschia	Pseudo-nitzschia	0	Microbiological	Pathogens								2016-05-20
p-Terphenyl-d14(Surrogate)	Surrogate: p-Terphenyl-d14	0	Organics	SVOCs								2016-05-20
Public Access	Public Access	0	Habitat	Debris					All			2014-11-04
Pydiflumetofen	Pydiflumetofen	1228284647	Organics						All			2022-11-03
Pymetrozin	Pymetrozin	123312890	Organics	Pesticides								2016-10-25
Pymetrozine	Pymetrozine	0	Organics	Pesticides	Insecticides							2017-04-04
Pyraclostrobin	Pyraclostrobin	175013180	Organics	Fungicides								2016-05-20
Pyrazon	Pyrazon (Chloridazon)	0	Organics	Pesticides	Herbicides							2017-04-04
Pyrene	Pyrene	129000	Organics	PAHs	SVOCs	HMW_PAH			All			2007-07-27
Pyrene-d10(Surrogate)	Surrogate: Pyrene-d10	1718521	Organics	PAHs	SVOCs	HMW_PAH			All			2007-07-27
Pyrethrin-1	Pyrethrin-1	121211	Organics	Pesticides	Pyrethrins	Insecticides						2026-05-08
Pyrethrin-2	Pyrethrin-2 (Pyrethrin II)	121299	Organics	Pesticides	Pyrethrins	Insecticides						2026-05-08
Pyridaben	Pyridaben	96489713	Organics	Pesticides	Insecticides							2016-03-10
Pyridine	Pyridine	110861	Organics	SVOCs								2016-09-06
Pyrimethanil	Pyrimethanil	53112280	Organics	Pesticides	Fungicides							2016-03-10
Pyriproxifen	Pyriproxifen	95737681	Organics									2018-07-16
Pyriproxyfen	Pyriproxyfen	95737681	Organics	Pesticides								2017-04-04
Quinoline	Quinoline	91225										2018-08-31
Quinoxyfen	Quinoxyfen	124495187	Organics	Pesticides	Fungicides							2016-03-10
Radium-226	Radium-226	13982633	Radiochemistry									2013-05-20
Radium-228	Radium-228	0	Radiochemistry	NULL								2016-05-20
Railroad Extent	Railroad Extent	0	Habitat						All			2019-05-07
Railroad Intensity	Railroad Intensity	0	Habitat						All			2019-05-07
Railroad Proximity	Railroad Proximity	0	Habitat						All			2019-05-07
Rangeland Extent	Rangeland Extent	0	Habitat						All			2019-05-07
Rangeland Intensity	Rangeland Intensity	0	Habitat						All			2019-05-07
Rangeland Proximity	Rangeland Proximity	0	Habitat						All			2019-05-07
Ranitidine	Ranitidine	66357355	Organics	PPCPs								2010-04-26
Rapid	Rapid	0	Habitat						All			2009-08-20
Ratio of SEM/AVS	Ratio of SEM/AVS	0	Inorganics	Metals								2014-01-29
RBI	Score for the Relative Benthic Index (RBI)	0	Sediment Quality Objectives	Index/Metric								2022-03-18
Rebar	Rebar	0	Debris	Trash	Non-Plastics	Metals			All			2014-11-04
Reburial	Reburial	0	Toxicity						All			2007-07-27
Relative Luminescence	Relative Luminescence	0	Toxicity						All			2013-05-28
Reproduction	Reproduction	0	Toxicity						All			2007-07-27
Residences	Residences	0	Habitat						All			2009-08-20
Residential Dumping	Residential Dumping	0	Habitat						All			2009-08-20
Residual Phosphorus	Residual Phosphorus	0	Inorganics	Conventional	Nutrients							1900-01-01
Resmethrin	Resmethrin	10453868	Organics	Pesticides	Insecticides	Pyrethroids						2014-01-28
Resorcinol bis(Diphenyl Phosphate)	Resorcinol bis(Diphenyl Phosphate)	57583547	Organics	FlameRetardants	PhosphateFlameRetardants							2017-09-19
Retene	Retene	0	Organics	PAHs								2014-01-28
Ribbon, Non-plastic	Ribbon, Non-plastic	0	Debris	Trash	Non-Plastics	Household			All			2014-11-04
Ribbon, Packaging	Ribbon, Packaging	0	Debris	Trash	Plastics	Miscellaneous			All			2014-11-04
Richness	Richness	0	Toxicity						All			2007-07-27
Riffle	Riffle	0	Habitat						All			2009-08-20
Riffle/Run Bank Stability	Riffle/Run Bank Stability (used for EMAP RBP 20-score habitat characterization)	0	Habitat						All			2009-08-20
Riffle/Run Channel Alteration	Riffle/Run Channel Alteration	0	Habitat						All			2009-08-20
Riffle/Run Channel Flow Status	Riffle/Run Channel Flow Status	0	Habitat						All			2009-08-20
Riffle/Run Embeddedness	Riffle/Run Embeddedness	0	Habitat						All			2009-08-20
Riffle/Run Epifaunal Substrate	Riffle/Run Epifaunal Substrate	0	Habitat						All			2009-08-20
Riffle/Run Frequency	Riffle/Run Frequency	0	Habitat						All			2009-08-20
Riffle/Run Riparian Zone Width	Riffle/Run Riparian Zone Width	0	Habitat						All			2009-08-20
Riffle/Run Sediment Deposition	Riffle/Run Sediment Deposition	0	Habitat						All			2009-08-20
Riffle/Run Vegetative Protection	Riffle/Run Vegetative Protection	0	Habitat						All			2009-08-20
Riffle/Run Velocity/Depth Regime	Riffle/Run Velocity/Depth Regime scale data	0	Habitat						All			2009-08-20
Rimsulfuron	Rimsulfuron	0	Organics	Pesticides	Herbicides							2017-04-04
Riparian Bridges/Abutments	Riparian Bridges/Abutments	0	Habitat						All			2009-08-20
Riparian Buildings	Riparian Buildings	0	Habitat						All			2009-08-20
Riparian Canopy Big Trees	EMAP BA Specific - Riparian Canopy Big Trees (Trunk > 0.3m DBH)	0	Habitat						All			2009-08-20
Riparian Canopy Small Trees	EMAP BA Specific - Riparian Canopy Small Trees (Trunk < 0.3 m DBH)	0	Habitat						All			2009-08-20
Riparian Canopy Veg Type	Riparian Canopy Vegetation Type	0	Habitat						All			2009-08-20
Riparian Corridor Shading	Percent of stream's water surface upstream of sample location estimated to be shaded if the sun was directly over the stream	0	FieldObservations	Habitat					All	Constituents		2010-03-03
Riparian Cover Metric	Metric assesses total vegetation cover in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte.	0	Habitat						All			2019-05-13
Riparian Grasses	Riparian Grasses	0	Habitat						All			2019-05-07
Riparian GroundCover Barren	Riparian Ground Cover Barren, Bare Dirt or Duff	0	Habitat						All			2009-08-20
Riparian GroundCover NonWoody Plants	Riparian Ground Cover Non-woody Herbs, Grasses & Forbes	0	Habitat						All			2009-08-20
Riparian GroundCover Woody Shrubs	Riparian Ground Cover Woody Shrubs & Saplings	0	Habitat						All			2009-08-20
Riparian Landfill/Trash	Riparian Landfill/Trash	0	Habitat						All			2009-08-20
Riparian Logging	Riparian Logging Operations	0	Habitat						All			2009-08-20
Riparian Lower Canopy All Vegetation	Riparian Lower Canopy All Vegetation (merge of Riparian Understory Non-Woody Plants and Riparian Understory Woody Shrubs in EMAP BA)	0	Habitat						All			2009-08-20
Riparian Mining	Riparian Mining Activity	0	Habitat						All			2009-08-20
Riparian NonWoody Veg	Riparian NonWoody Veg	0	Habitat						All			2019-05-07
Riparian Orchards/Vineyards	Riparian Orchards/Vineyards	0	Habitat						All			2009-08-20
Riparian Park/Lawn	Riparian Park/Lawn	0	Habitat						All			2009-08-20
Riparian Pasture/Range	Riparian Pasture/Range/Hay field	0	Habitat						All			2009-08-20
Riparian Pavement	Riparian Pavement/Cleared Lot	0	Habitat						All			2009-08-20
Riparian Pipes	Riparian Piles (Inlet/Outlet)	0	Habitat						All			2009-08-20
Riparian Powerline	Human disturbance measure for powerlines	0	Habitat						All			2012-05-22
Riparian Road	Riparian Road/Railroad	0	Habitat						All			2009-08-20
Riparian Row Crops	Riparian Row Crops	0	Habitat						All			2009-08-20
Riparian Sub Condition/Vert Connectivity Metric	Metric assesses riparian substratum condition influencing natural infiltration capacity and vertical connectivity affecting alluvial permeability, subsurface flows and groundwater connectivity.	0	Habitat						All			2019-05-13
Riparian Trail	Human disturbance measure for trails	0	Habitat						All			2012-05-22
Riparian Understory NonWoody Plants	EMAP BA specific - Riparian Understory Non-woody Herbs, Grasses & Forbes	0	Habitat						All			2009-08-20
Riparian Understory Veg Type	Riparian Understory Vegetation Type	0	Habitat						All			2009-08-20
Riparian Understory Woody Shrubs	EMAP BA Specific - Riparian Understory Woody Shrubs & Saplings	0	Habitat						All			2009-08-20
Riparian Upper Canopy All Trees	Riparian Upper Canopy All Trees (merge of Riparian Canopy Big Trees and Small Trees in EMAP BA)	0	Habitat						All			2009-08-20
Riparian Upper Canopy Deciduous	Riparian Upper Canopy Deciduous	0	Habitat						All			2012-05-22
Riparian Upper Canopy Evergreen	Riparian Upper Canopy Evergreen	0	Habitat						All			2012-05-22
Riparian Vegetation Management	Riparian Vegetation Management	0	Habitat						All			2009-08-20
Riparian Vegetation Width Metric	Metric assesses the average width of the defined riparian zone along the assessment area.	0	Habitat						All			2019-05-13
Riparian Wall/Dike	Riparian Wall/Dike/Revetment/Riprap/Dam	0	Habitat						All			2009-08-20
Riparian Woody Veg	Riparian Woody Veg	0	Habitat						All			2019-05-07
RipRAM Index	Riparian Rapid Assessment Method (RAM) for California index score based on the average score of eight component metrics.	0	Habitat						All			2019-05-13
RipRap/Armored Channel bed/bank Extent	RipRap/Armored Channel bed/bank Extent	0	Habitat						All			2019-05-07
RipRap/Armored Channel bed/bank Intensity	RipRap/Armored Channel bed/bank Intensity	0	Habitat						All			2019-05-07
RipRap/Armored Channel bed/bank Proximity	RipRap/Armored Channel bed/bank Proximity	0	Habitat						All			2019-05-07
RisingGroundwater	Rising groundwater (i.e., a spring) that is the source of water in a receiving water and may contribute (or even define) the receiving water quality	0	Habitat									2014-04-07
RIVPACS_BI	Score for River Invertebrate Prediction and Classification System (RIVPACS) Benthic Index	0	Sediment Quality Objectives	Index/Metric								2022-03-18
Roads	Roads	0	Habitat						All			2009-08-20
Rope, Polypropylene	Rope, Polypropylene	0	Debris	Trash	Plastics	Miscellaneous			All			2014-11-04
Rope/Tie	Rope/Tie	0	Debris	Trash	Plastics	Miscellaneous			All			2014-11-04
Rotenolone	Rotenolone	0	Organics	Pesticides								2017-04-04
Rotenone	Rotenone	0	Organics	Pesticides	Insecticides							2017-04-04
Roxithromycin	Roxithromycin	80214831	Organics	PPCPs					All			2012-05-22
Rubber Fiber	Rubber Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Rubber Film	Rubber Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Rubber Foam	Rubber Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Rubber fragment	Rubber fragment, including from tires	0	Microdebris	Anthropogenic	Rubber	Fragment						2018-04-26
Rubber Materials (Non-Specific)	Rubber Materials (Non-Specific)	0	Debris	Trash	Non-Plastics	Construction			All			2014-11-04
Rubber Piece	Rubber Piece	0	Debris	Trash	Plastics	Miscellaneous			All			2014-11-04
Rubber Sphere	Rubber Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Run	Run	0	Habitat						All			2009-08-20
Rural Residential Extent	Rural Residential Extent	0	Habitat						All			2019-05-07
Rural Residential Intensity	Rural Residential Intensity	0	Habitat						All			2019-05-07
Rural Residential Proximity	Rural Residential Proximity	0	Habitat						All			2019-05-07
Sachets, Beverage	Beverage, Sachets/packets, e.g., Caprisuns	0	Debris	Trash	Non-Plastic							2022-11-02
Safrotin	Safrotin	77491306	Organics	Pesticides	Insecticides							2016-10-25
Salicylic Acid	Salicylic Acid	69727										2018-08-31
Salicylic Acid-d4(IsoDilAnalogue)	Isotope Dilution Analogue: Salicylic Acid-d4	78646170	Organics									2022-07-22
Salicylic Acid-d4(Surrogate)	Surrogate: Salicylic Acid-d4	78646170	Organics	PPCPs	Pharmaceuticals							2026-06-12
Salinity	Salinity	0	WaterQualityMeasurements	Conventionals	Inorganics				All			2009-08-20
Salinity, Daily Mean	Daily Mean Salinity (Calculated)	0	WaterQualityMeasurements	Conventionals	Inorganics				All			2024-09-06
Salmonella	Salmonella	0	Microbiological	Pathogens	Conventionals				All			2010-04-21
Salmonella-invA	Salmonella-invA	0	Microbiological	Pathogens	Conventionals				All			2010-04-21
Salmonella-ttr	Salmonella-ttr	0	Microbiological	Pathogens	Conventionals				All			2010-04-21
SampleMassCollected	Mass of sample collected in the field	0	WaterQualityMeasurements	Conventionals								2015-09-29
SampleVolume	Volume of water collected in the field	0	WaterQualityMeasurements	Ancillary								2014-02-05
SamplingCrew	Sampling Crew	0	FieldObservations	Habitat					All			2009-08-20
Sand	Sand	0	Inorganics	Conventionals	GrainSize				All			2011-09-08
Sand + Fine	Sand + Fine	0	Inorganics	Conventionals	GrainSize				All			2014-08-19
Sand, Coarse_AS (2.0 to <4.75 mm)	Coarse Sand_ASTM Scale (2.0 to <4.75 mm)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Sand, Coarse_WS (0.5 to <1.0 mm_Phi 1 to >0)	Coarse Sand_Wentworth Scale (0.5 to <1.0 mm_Phi 1 to >0)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Sand, Fine_AS (0.075 to <0.425 mm)	Fine Sand_ASTM Scale (0.075 to <0.425 mm)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Sand, Fine_WS (0.125 to <0.25 mm_Phi 3 to >2)	Fine Sand_Wentworth Scale (0.125 to <0.25 mm_Phi 3 to >2)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Sand, Medium_AS (0.425 to <2.0 mm)	Medium Sand_ASTM Scale (0.425 to <2.0 mm)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Sand, Medium_WS (0.25 to <0.5 mm_Phi 2 to >1)	Medium Sand_Wentworth Scale (0.25 to <0.5 mm_Phi 2 to >1)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Sand, Very Coarse_WS (1.0 to <2.0 mm_Phi 0 to -1)	Very Coarse Sand_Wentworth Scale (1.0 to <2.0 mm_Phi 0 to -1)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Sand, Very Fine_WS (0.0625 to <0.125 mm_Phi 4 to >3)	Very Fine Sand_Wentworth Scale (0.0625 to <0.125 mm_Phi 4 to >3)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Sand_AS (0.075 to <4.75 mm)	Sand_ASTM Scale (0.075 to <4.75 mm)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Sand_WS (0.0625 to <2.0 mm_Phi 4 to >-1)	Sand_Wentworth Scale (0.0625 to <2.0 mm_Phi 4 to >-1)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Sarafloxacin	Sarafloxacin	98105998	Organics	PPCPs								2010-04-26
Saxitoxins	Saxitoxins	0	Microbiological	Cyanotoxins					All			2012-05-22
Saxitoxins gene, Prokaryotic DNA (sxtA)	Saxitoxins gene, Prokaryotic DNA, Target Gene: (sxtA), Proprietary primer sequences from Bend Genetics LLC	0	Microbiological	Cyanotoxins	Gene Marker				All			2026-05-27
Scandium	Scandium	7440202	Inorganics									2013-05-20
Seagrass	Seagrass	0	Debris	Natural	Non-Plastics	Marine Origin			All			2014-11-04
Sealed Shell Volume	Sealed Shell Volume (weight (in grams) of water displaced by each bivalve)	0	Organics	Inorganics	Metals	Conventionals	Semi-VOAs	VOAs	All			2012-11-08
SeaState	SeaState	0	FieldObservations	Habitat					All			2009-08-20
Secbumeton	Secbumeton	26259450	Organics	Pesticides	Pest-Triazines	Herbicides			All			2007-07-27
Secchi Depth	Measurement of clarity based on the depth at which the Secchi disk can be differentiated	0	WaterQualityMeasurements						All			2007-07-27
Sedaxane	Sedaxane	874967676	Organics	Pesticides	Fungicides							2016-09-06
Sediment Disturbance Other Extent	Sediment Disturbance Other Extent	0	Habitat						All			2019-05-07
Sediment Disturbance Other Intensity	Sediment Disturbance Other Intensity	0	Habitat						All			2019-05-07
Sediment Disturbance Other Proximity	Sediment Disturbance Other Proximity	0	Habitat						All			2019-05-07
Sediment Load Estimate	Sediment Load Estimate	0	Inorganics	Conventionals								2016-07-11
Sediment reworking rate	Sediment reworking rate	0	Toxicity						All			2007-07-27
SedimentExposure	SedimentExposure	0	FieldObservations	Habitat					All			2013-07-24
Selenate as Se	Selenate as Se (Se VI)	0	Inorganics	Conventionals					All			2012-05-30
Selenite as Se	Selenite as Se (Se IV)	0	Inorganics	Conventionals					All			2012-05-30
Selenium	Selenium	7782492	Inorganics	TraceElements	Metals				All			2007-07-27
Selenium, Methyl	Methyl Selenium (Dimethly Selenide)	593793	Inorganics	Metals								2014-01-29
Selenomethionine	Selenomethionine	1464422	Organics	AminoAcid								2025-08-25
SEM	SEM (Simultaneously Extracted Metals)	0	Inorganics	Metals					All			2013-05-28
Sertraline	Sertraline	79617962	Organics	PPCPs								2010-04-26
Sethoxydim	Sethoxydim	0	Organics	Pesticides	Herbicides							2017-04-04
Settleable Solids	Settleable Solids	0	Inorganics	Conventionals								2013-11-11
Sewage Treatment	Sewage Treatment	0	Habitat						All			2009-08-20
Shade	Amount of shade within the algae sampling area (1 m2)	0	Habitat						All			2012-09-13
Shoe	Shoe	0	Debris	Trash	Non-Plastics	Household			All			2014-11-04
Shopping Cart	Shopping Cart	0	Debris	Trash	Non-Plastics	Large			All			2014-11-04
Side Channel	Side Channel present	0	Habitat						All			2009-08-20
Siduron	Siduron	1982496	Organics	Pesticides	Pest-Carbamates	Herbicides			All			2007-07-27
Silica as SiO2	Silica as SiO2	14808607	Inorganics	Conventionals	Habitat				All	Constituents		2010-02-02
Silicate as Si	Silicate as Si (Si(OH)4)	0	Inorganics	Conventionals					All	Constituents		2013-05-28
Silicon	Silicon	7440213	Inorganics	Metals								2009-08-05
Silicone Film	Silicone Film	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Silicone Foam	Silicone Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Silicone Fragment	Silicone Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Silt	Silt	0	Inorganics	Conventionals	GrainSize				All			2011-09-08
Silt + Clay	Silt + Clay	0	Inorganics									2017-04-04
Silt and Clay_WS (<0.0625 mm_Phi >4)	Silt and Clay_Wentworth Scale (<0.0625 mm_Phi >4)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Silt, Coarse_WS (0.031 to <0.0625 mm_Phi 5 to >4)	Coarse Silt_Wentworth Scale (0.031 to <0.0625 mm_Phi 5 to >4)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Silt, Fine_WS (0.0078 to <0.0156 mm_Phi 7 to >6)	Fine Silt_Wentworth Scale (0.0078 to <0.0156 mm_Phi 7 to >6)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Silt, Medium_WS (0.0156 to <0.031 mm_Phi 6 to >5)	Medium Silt_Wentworth Scale (0.0156 to <0.031 mm_Phi 6 to >5)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Silt, Very Fine_WS (0.0039 to <0.0078 mm_Phi 8 to >7)	Very Fine Silt_Wentworth Scale (0.0039 to <0.0078 mm_Phi 8 to >7)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Silt_AS (0.005 to <0.075 mm)	Silt_ASTM Scale (0.005 to <0.075 mm)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Silt_WS (0.0039 to <0.0625 mm_Phi 8 to >4)	Silt_Wentworth Scale (0.0039 to <0.0625 mm_Phi 8 to >4)	0	Inorganics	Conventionals	GrainSize							2026-06-12
Silver	Silver	7440224	Inorganics	TraceElements	Metals				All			2007-07-27
Simazine	Simazine	122349	Organics	Pesticides	Pest-Triazines	Herbicides	Algaecides	Endocrine Disruptors	All			2007-07-27
Simazine(Surrogate)	Surrogate: Simazine	122349	Organics	Pesticides	Pest-Triazines				All			2016-03-02
Simazine-D10(Surrogate)	Surrogate: Simazine-D10	0	Organics	Pesticides	Pest-Triazines	220621-39-6						2016-08-08
Simetone	Simetone	0	Organics	Pesticides	Herbicides							2017-04-04
Simetryn	Simetryn	1014706	Organics	Pesticides	Pest-Triazines	Herbicides			All			2007-07-27
Simulium sp. (Simul)	Simulium sp., Assay name: Simul, 5’ TGGAGGATTTGGTAATTGACTTG 3’, 5’ GTTAAGGAAGGAGGAAGTATTCAAA 3’, 5HEX-AGCACCTGATATGGCATTTCCTCGA-3IABkFQ	0	Microbiological									2023-12-22
Simvastatin	Simvastatin	79902639	Organics	PPCPs								2010-04-26
Sinuosity	Ratio of the curvilinear length along a stream and the Euclidean (straight line) distance between two points along the stream	0	Habitat						All			2015-08-21
Site Length	Site Length	0	Habitat	Debris					All			2014-11-04
Site Width	Site Width	0	Habitat	Debris					All			2014-11-04
Sitosterol, beta-	beta-Sitosterol	83465	Organics									2018-07-16
SkyCode	SkyCode	0	FieldObservations	Habitat					All			2009-08-20
Slope	Slope	0	Habitat						All			2009-08-20
SOD	Sediment Oxygen Demand (SOD)	0	Inorganics	Conventionals								2020-03-30
Sodium	Sodium	7440235	Inorganics	Conventionals	Metals				All	Constituents		2007-07-27
Sodium Cacodylate	Sodium Cacodylate	0	Organics	Pesticides	Herbicides							2017-04-04
Sodium chlorate	Sodium chlorate	7775099	Inorganics	Pesticides								2017-04-20
Sodium cyanide	Sodium cyanide	143339	Inorganics	Pesticides								2017-04-20
Sodium Fluoroacetate (1080)	Sodium Fluoroacetate (1080)	0	Organics	Pesticides								2017-04-04
Sodium methylarsonate	Sodium methylarsonate	2163806	Organics	Pesticides								2017-04-20
Sodium tetraborate decahydrate	Sodium tetraborate decahydrate (Sodium borate)	0	Organics	Pesticides								2017-04-04
Sodium Trichloroacetate	Sodium Trichloroacetate	0	Organics	Pesticides	Herbicides							2017-04-04
Soft Plastic Piece, non-specific	Soft Plastic Piece, non-specific	0	Debris	Trash	Plastics	Bags/Packaging			All			2014-11-04
Soft Sediment	Soft Sediment; indicates presence/absence of soft/small sediment at the point where depth is measured	0	Habitat						All			2009-08-20
Somatic Coliphage (E. coli CN-13)	Somatic Coliphage Plaques, Host Bacterium Strain: E. coli CN-13	0										2022-02-11
Soot	Soot/Black Carbon	0										2019-05-17
SpecificConductivity	Specific Conductivity	0	WaterQualityMeasurements	Conventionals	Inorganics				All			2013-05-28
Sports Ball	Sports Ball	0	Debris	Trash	Plastics	Household			All			2014-11-04
Spray Paint Can	Spray Paint Can	0	Debris	Trash	Non-Plastics	Toxic			All			2014-11-04
Spring Boxes Extent	Spring Boxes Extent	0	Habitat						All			2019-05-07
Spring Boxes Intensity	Spring Boxes Intensity	0	Habitat						All			2019-05-07
Spring Boxes Proximity	Spring Boxes Proximity	0	Habitat						All			2019-05-07
SQO_CSI	Sediment Quality Objectives (SQO) Chemical Score Index (CSI)	0	Sediment Quality Objectives	Index/Metric								2022-03-18
SQO_LOE_Cat_Benthic	Sediment Quality Objectives Line of Evidence (SQO LOE) Benthic Community Condition Category Score. The score represents the disturbance levels of the benthic communities at a station in a bay/estuary compared to reference conditions.	0	Sediment Quality Objectives	Index/Metric								2022-03-18
SQO_LOE_Cat_Chemistry	Sediment Quality Objectives Line of Evidence (SQO LOE) Chemistry Category Score. The score represents the concentration of chemicals in sediments and potential risks the benthic organisms have from the pollutants in sediment at a station in a bay/estuary.	0	Sediment Quality Objectives	Index/Metric								2022-03-18
SQO_LOE_Cat_Toxicity	Sediment Quality Objectives Line of Evidence (SQO LOE) Toxicity Category Score. The score represents the response of invertebrates to bay/estuary sediment samples collected at a station but exposed in a controlled laboratory.	0	Sediment Quality Objectives	Index/Metric								2022-03-18
SQO_SA_Cat	Sediment Quality Objectives (SQO) Station Assessment Category. Overall SQO score for the station. The score represents the impact of pollutants in sediment to the aquatic life living in the sediment in bays/estuaries.	0	Sediment Quality Objectives	Index/Metric								2022-03-18
StationWaterDepth	Depth of waterbody where sample was collected	0	Habitat						All			2011-04-06
StationWaterDepth_Avg	Estimated average depth of the waterbody at the time of sampling	0	Habitat						All			2012-09-13
StationWaterDepth_Max	Estimated maximum depth of the waterbody at the time of sampling	0	Habitat						All			2012-09-13
Stearates, Lubricants, Waxes Film	Stearates, Lubricants, Waxes Film	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Stearates, Lubricants, Waxes Foam	Stearates, Lubricants, Waxes Foam	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Stearates, Lubricants, Waxes Fragment	Stearates, Lubricants, Waxes Fragment	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Stick/Branch/Driftwood	Stick/Branch/Driftwood	0	Debris	Natural	Non-Plastics	Marine Origin			All			2014-11-04
Stigmastanol, beta	beta-Stigmastanol	19466478	Organics									2018-07-16
Strapping bands, Plastic	Plastic bands used to strap things in place or together	0	Debris	Trash	Plastics							2022-11-02
Straw	Straw	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
Stream Confinement	Confinement based upon the valley width in relation to average bankfull width which the riverine system can migrate without encountering a hillside, terrace or other feature	0	Habitat						All			2019-05-13
Stream Gradient	Steepness of the stream	0	FieldObservations	Habitat					All			2009-08-20
StreamBankCharacteristics_Concrete	StreamBankCharacteristics_Concrete	0	Habitat	Debris					All			2014-11-04
StreamBankCharacteristics_Earthen	StreamBankCharacteristics_Earthen	0	Habitat	Debris					All			2014-11-04
StreamBankCharacteristics_RipRap	StreamBankCharacteristics_RipRap	0	Habitat	Debris					All			2014-11-04
StreamBankCharacteristics_Sloped	StreamBankCharacteristics_Sloped	0	Habitat	Debris					All			2014-11-04
StreamBankCharacteristics_Vegetated	StreamBankCharacteristics_Vegetated	0	Habitat	Debris					All			2014-11-04
StreamBankCharacteristics_Vertical	StreamBankCharacteristics_Vertical	0	Habitat	Debris					All			2014-11-04
StreamBedCharacteristics_Concrete	StreamBedCharacteristics_Concrete	0	Habitat	Debris					All			2014-11-04
StreamBedCharacteristics_Earthen	StreamBedCharacteristics_Earthen	0	Habitat	Debris					All			2014-11-04
StreamBedCharacteristics_Rock	StreamBedCharacteristics_Rock	0	Habitat	Debris					All			2014-11-04
StreamBedCharacteristics_SubPlants	StreamBedCharacteristics_SubPlants	0	Habitat	Debris					All			2014-11-04
StreamMixing	Classification of stream mixing by stratification, well-mixed or poorly mixed	0	FieldObservations	Habitat					All			2009-08-20
Streptococcus, Fecal	Fecal Streptococcus	0	Microbiological	Pathogens	Conventional				All			2026-04-03
Stretch	refers to stretch measurement in gillnet	0	Tissue	Habitat					All	CollectionDevice		2009-08-20
Strontium	Strontium	7440246	Inorganics	Metals					All			2007-07-27
Strontium-87/Strontium-86 Ratio	Strontium-87/Strontium-86 Ratio	0	Isotopes									2013-05-20
Strontium-90	Strontium-90	0										2016-12-23
Strychnine	Strychnine	0	Organics	Pesticides								2017-04-04
Strychnine Sulfate	Strychnine Sulfate	0	Organics	Pesticides								2017-04-04
Styrene	Styrene	100425	Organics	VOCs					All			2007-07-27
Styrene Co-polymer Fiber	Styrene copolymer Fiber	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Styrene Co-polymer Foam	Styrene copolymer Foam	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Styrene Co-polymer Fragment	Styrene copolymer Fragment	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Styrene Co-polymer Sphere	Styrene copolymer Sphere	0	Microdebris	Anthropogenic	Plastic							1900-01-01
Styrofoam Pellet	Styrofoam Pellet	0	Debris	Trash	Plastics	Bags/Packaging			All			2014-11-04
SubreachesFished	Subreaches fished within a given waterbody	0	Habitat						All			2012-09-13
Substrate Modifier	Substrate Modifier	0	Habitat						All			2012-05-22
Substrate Size Class	Substrate Size Class	0	Habitat						All			2009-08-20
Suburban Residential Extent	Suburban Residential Extent	0	Habitat						All			2019-05-07
Suburban Residential Intensity	Suburban Residential Intensity	0	Habitat						All			2019-05-07
Suburban Residential Proximity	Suburban Residential Proximity	0	Habitat						All			2019-05-07
Sucralose	Sucralose	56038132										2018-08-20
Sulfachloropyridazine	Sulfachloropyridazine	80320	Organics	PPCPs					All			2012-05-22
Sulfadiazine	Sulfadiazine	68359	Organics	PPCPs								2010-04-26
Sulfadimethoxine	Sulfadimethoxine	122112	Organics	PPCPs					All			2012-05-22
Sulfallate	Sulfallate (CDEC)	95067	Organics	Pesticides	Herbicides							2016-10-25
Sulfamerazine	Sulfamerazine	127797	Organics	PPCPs					All			2012-05-22
Sulfamethazine	Sulfamethazine	57681	Organics	PPCPs					All			2012-05-22
Sulfamethazine-13C6(Surrogate)	Surrogate: Sulfamethazine-13C6	77643915	Organics	PPCPs					All			2012-05-22
Sulfamethizole	Sulfamethizole	144821	Organics	PPCPs					All			2012-05-22
Sulfamethoxazole	Sulfamethoxazole	723466	Organics	PPCPs					All			2012-05-22
Sulfamethoxazole-13C6(Surrogate)	Surrogate: Sulfamethoxazole-13C6	0	Organics	PPCPs								2010-04-26
Sulfanilamide	Sulfanilamide	63741	Organics	PPCPs								2010-04-26
Sulfate	Sulfate	14808798	Inorganics	Conventionals	Nutrients				All	Constituents		2007-07-27
Sulfathiazole	Sulfathiazole	72140	Organics	PPCPs					All			2012-05-22
Sulfide, Dissolved	Dissolved Sulfide	0										2017-05-25
Sulfide, Total	Total Sulfide	0	WaterQualityMeasurements						All			2013-05-28
Sulfite as SO3	Sulfite as SO3	0	Inorganics									2017-03-29
Sulfometuron Methyl	Sulfometuron Methyl	7422972	Organics	Herbicides								2013-05-20
Sulfotep	Sulfotepp	3689245	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Sulfoxaflor	Sulfoxaflor	946578003	Organics	Pesticides	Insecticides							2018-01-03
Sulfoxaflor-A	Sulfoxaflor Peak A	946578003	Organics	Pesticides								2018-08-07
Sulfoxaflor-B	Sulfoxaflor Peak B	946578003	Organics	Pesticides								2018-08-07
Sulfur	Sulfur	7704349	Inorganics									2013-05-20
Sulfur-34	Sulfur-34	13965974	Organics	Radiochemistry								2014-11-05
Sum of 12 HPAHs (SFEI)	Sum of 12 HPAHs (SFEI)	0	Organics	PAHs								2012-04-04
Sum of 13 LPAHs (SFEI)	Sum of 13 LPAHs (SFEI)	0	Organics	PAHs								2012-04-04
Sum of 208 PCBs (SFEI)	Sum of 208 PCBs (SFEI)	0	Organics	PCBs								2010-11-04
Sum of 209 PCBs (SFEI)	Sum of 209 PCBs (SFEI)	0	Organics	PCBs								2010-06-22
Sum of 25 PAHs (SFEI)	Sum of 25 PAHs (SFEI)	0	Organics	PAHs								2012-04-04
Sum of 40 PCBs (SFEI)	Sum of 40 PCBs (SFEI)	0	Organics	PCBs								2010-06-22
Sum of Aroclors (SFEI)	Sum of Aroclors (SFEI)	0	Organics	PCBs								2014-01-22
Sum of Chlordanes (SFEI)	Sum of Chlordanes (SFEI)	0	Organics	Pesticides								2008-06-27
Sum of Cyclopentadienes (SFEI)	Sum of Cyclopentadienes (SFEI)	0	Organics	VOCs								2014-01-29
Sum of DDTs (RWQCB3)	Sum of DDTs (RWQCB3)	0	Organics									2016-09-23
Sum of DDTs (SFEI)	Sum of DDTs (SFEI)	0	Organics	Pesticides								2008-06-27
Sum of Dioxin-Furan TEQs (WHO 2005;ND=0 SFEI)	Sum of Dioxin-Furan TEQs (WHO 2005;ND=0 SFEI)	0	Organics	DioxinsDibenzofurans					All			2011-01-20
Sum of Dioxin-Furan TEQs (WHO 2005;ND=MDL SFEI)	Sum of Dioxin-Furan TEQs (WHO 2005;ND=MDL SFEI)	0	Organics	DioxinsDibenzofurans	TEQs				All			2016-08-25
Sum of Dioxins (SFEI)	Sum of Dioxins (SFEI)	0	Organics	DioxinsDibenzofurans								2010-08-30
Sum of Dioxins-Furans (SFEI)	Sum of Dioxins-Furans (SFEI)	0	Organics	DioxinsDibenzofurans					All			2011-01-20
Sum of Furans (SFEI)	Sum of Furans (SFEI)	0	Organics	DioxinsDibenzofurans								2010-08-30
Sum of HCHs (SFEI)	Sum of HCHs (SFEI)	0	Organics	Pesticides								2008-06-27
Sum of Hexa-PBDE	Sum of Hexa-PBDE	0	Organics	FlameRetardants								2014-01-27
Sum of Hexa-PBDEs (SFEI)	Sum of Hexa-PBDEs (SFEI)	0	Organics	FlameRetardants								2014-01-27
Sum of HPAHs (Integral)	Sum of HPAHs (Integral)	0										2019-05-17
Sum of HPAHs (OCEAN)	Sum of HPAHs (OCEAN)	0	Organics	PAHs								2014-06-03
Sum of LPAHs (Integral)	Sum of LPAHs (Integral)	0										2019-05-17
Sum of LPAHs (OCEAN)	Sum of LPAHs (OCEAN)	0	Organics	PAHs								2014-06-03
Sum of PAHs (OCEAN)	Sum of PAHs (OCEAN)	0	Organics	PAHs								2014-06-03
Sum of PBDEs (SFEI)	Sum of PBDEs (SFEI)	0	Organics	FlameRetardants								2008-06-27
Sum of PCBs (NOAA)	Sum of PCBs (NOAA)	0	Organics	PCBs								2014-01-22
Sum of PCBs (SFEI)	Sum of PCBs (SFEI)	0	Organics	PCBs								2014-01-22
Sum of Penta-PBDEs (SFEI)	Sum of Penta-PBDEs (SFEI)	0	Organics	FlameRetardants								2008-06-27
Sum of PFCs (SFEI)	Sum of PFCs (SFEI)	0	Organics	PFAS								2011-02-02
Sum of Pyrethroids (SFEI)	Sum of Pyrethroids (SFEI)	0	Organics	Pesticides	Insecticides	Pyrethroids			All			2014-01-29
Sum of SEM	Sum of SEM	0	Inorganics	Metals								2014-01-29
Sum of Tetra-PBDEs (SFEI)	Sum of Tetra-PBDEs (SFEI)	0	Organics	FlameRetardants								2008-06-27
Sum of Tri-PBDEs (SFEI)	Sum of Tri-PBDEs (SFEI)	0	Organics	FlameRetardants								2008-06-27
Surface Films	Surface Films	0	Habitat						All			2009-08-20
SurfaceAreaOfMax	Estimate of the current surface area size as a fraction of the total surface area the waterbody would have at high water stage	0	Habitat						All			2012-09-13
SurfacewaterConnect	Discharge from an outfall that does or does not flow to and have hydrologic continuity with a surface receiving water and has or does not have the potential to contribute to the quality of the surface receiving water quality	0	Habitat									2014-04-07
Survival	Survival (%)	0	Toxicity						All			2007-07-27
Suspended Sediment Concentration	Suspended Sediment Concentration (SSC)	0	Inorganics	Conventionals					All			2007-07-27
Suspended Sediment Discharge	Suspended Sediment Discharge	0	Inorganics									2013-05-20
Swim Normally	Swim Normally (Num/Rep)	0	Toxicity						All			2014-04-11
Syringe/Pipette	Syringe/Pipette	0	Debris	Trash	Plastics	Toxic			All			2014-11-04
Tampon/Applicator	Tampon/Applicator	0	Debris	Trash	Plastics							2022-11-02
Tantalum	Tantalum	7440257	Inorganics									2013-05-20
Tape	Tape	0	Debris	Trash	Plastics	Household			All			2014-11-04
Taricha torosa (CalN)	Taricha torosa, Assay name: CalN, 5’ ACTGTTGCTCTGACAGTTATT 3’, 5’ TCCCTTCTGTGAACTCATAATC 3’, 5FAM-AAGATGGAACAGCCAATGCAGGGT-3IABkFQ	0	Microbiological									2023-12-22
Tarp	Tarp	0	Debris	Trash	Plastics	Household			All			2014-11-04
TCDD, 2,3,7,8-	2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)	1746016	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
TCDD, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)	1746016	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
TCDD-13C12, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-13C12 (TCDD-13C12)	76523405	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
TCDD-13C6, 1,2,3,4-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4-TCDD-13C6	116865588	Organics	Dioxins/Dibenzofurans	IDA							2023-11-20
TCDD-13C6, 1,2,3,4-(Surrogate)	Surrogate: 1,2,3,4-Tetrachlorodibenzo-p-dioxin-13C6 (TCDD)	0	Organics	DioxinsDibenzofurans								2013-06-05
TCDD-13C6,1,2,3,4-(Surrogate)	Surrogate: 1,2,3,4-Tetrachlorodibenzo-p-dioxin-13C6 (TCDD)	0	Organics	DioxinsDibenzofurans								2010-07-15
TCDD-37Cl4, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-37Cl4 (TCDD-37Cl4)	85508505	Organics	Dioxins/Dibenzofurans	IDA							2025-10-27
TCDF, 2,3,7,8-	2,3,7,8-Tetrachlorodibenzofuran (TCDF)	51207319	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-05-28
TCDF, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzofuran (TCDF)	51207319	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
TCDF-13C12, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzofuran-13C12 (TCDF-13C12)	89059461	Organics	Dioxins/Dibenzofurans	IDA							2025-08-25
TCDF-2C, 2,3,7,8-	2,3,7,8-TCDF-2C	0	Organics									2017-03-06
TCDF-2C, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzofuran-2C (TCDF)	0	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				All			2013-06-02
TCDF-C13, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzofuran-C13 (TCDF)	0	Organics	DioxinsDibenzofurans								2010-07-14
Tebuconazole	Tebuconazole (Folicur)	107534963	Organics	Fungicides								2016-05-20
Tebuconazole-13C3(Surrogate)	Surrogate: Tebuconazole-13C3	1313734836	Organics						All			2022-11-03
Tebuconazole-tert-Butylhydroxy	Tebuconazole-tert-Butylhydroxy	212267646	Organics						All			2022-10-28
Tebufenozide	Tebufenozide	112410238	Organics	Pesticides	Insecticides							2017-04-04
Tebupirimfos	Tebupirimfos	96182535	Organics	Pesticides	Insecticides							2016-03-10
Tebupirimfos oxon	Tebupirimfos oxon	1035330369	Organics	Pesticides								2016-03-10
Tebuthiuron	Tebuthiuron	34014181	Organics	Pesticides	Pest-OPs				All			2007-07-27
Tebuthiuron(Surrogate)	Surrogate: Tebuthiuron	0	Organics	Pesticides	Herbicides	Herbicides						2017-02-27
Tecnazene	Tecnazene	117180	Organics	Pesticides	Fungicides							2011-07-15
Tedion	Tedion (Tetradifon)	116290	Organics	Pesticides	Pest-OCHs				All			2013-05-28
Tefluthrin	Tefluthrin	79538322	Pyrethroid Pesticides									2015-07-02
Television	Television	0	Debris	Trash	Non-Plastics	Large			All			2014-11-04
Temephos	Temephos	3383968	Organics	PPCPs					All			2012-09-13
Temperature	Temperature	0	WaterQualityMeasurements	Conventionals					All			2009-08-20
Temperature, Daily Mean	Daily Mean Temperature (Calculated)	0	WaterQualityMeasurements	Conventionals					All			2024-09-06
Terbacil	Terbacil	5902512	Organics	Herbicides								2016-05-20
Terbium	Terbium	7440279	Inorganics	Metals								2017-05-03
Terbium(Surrogate)	Surrogate: Terbium	7440279	Inorganics	Metals								2017-08-10
Terbufos	Terbufos	13071799	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides	Nematocides	All			2007-07-27
Terbufos oxon sulfone	Terbufos oxon sulfone	0	Organics	Pesticides								2017-04-20
Terbufos Sulfone	Terbufos Sulfone	0	Organics	Pesticides								2014-01-28
Terbuthylazine	Terbuthylazine	5915413	Organics	Pesticides	Pest-Triazines	Herbicides			All			2007-07-27
Terbutryn	Terbutryn	886500	Organics	Pesticides	Pest-Triazines	Herbicides			All			2007-07-27
Terphenyl-d14	Terphenyl-d14	0										2017-01-12
Terphenyl-d14(Surrogate)	Surrogate: Terphenyl-d14	1718510	Organics	VOCs								2016-03-02
Terpineol, alpha-	alpha-Terpineol	0	Organics	PPCPs								2014-01-28
Terrazole	Terrazole (Etridiazole)	0	Organics	Pesticides	Fungicides							2017-04-04
Tert-amyl Methyl Ether	Tert-amyl Methyl Ether	994058	Organics	VOCs					All			2013-05-28
Tert-butyl Alcohol	Tert-butyl Alcohol	75650	Organics	VOCs					All			2025-08-25
Tertbutylphenyl Diphenyl Phosphate	Tertbutylphenyl Diphenyl Phosphate	56803373	Organics	FlameRetardants	PhosphateFlameRetardants							2017-09-19
Testosterone	Testosterone	58220										2018-08-31
Testosterone-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Testosterone-d3	77546395	Organics									2022-07-29
Testosterone-d3(Surrogate)	Surrogate: Testosterone-d3	77546395										2022-05-24
Tetrabromobisphenyl A	Tetrabromobisphenyl A	0	Organics	FlameRetardants								2014-01-28
Tetrabromocyclooctane, alpha-1,2,5,6-	alpha-1,2,5,6-Tetrabromocyclooctane (alpha-TBCO)	3194578	Organics	FlameRetardants								2015-07-16
Tetrabromocyclooctane, beta-1,2,5,6-	beta-1,2,5,6-Tetrabromocyclooctane (beta-TBCO)	3194578	Organics	FlameRetardants								2015-07-16
Tetrabromo-o-chlorotoluene	Tetrabromo-o-chlorotoluene (TBCT)	39569216	Organics	FlameRetardants					All			2014-03-13
Tetrabromo-p-xylene	Tetrabromo-p-xylene (pTBX)	23488382	Organics	FlameRetardants					All			2014-03-13
Tetrabutyltin as Sn	Tetrabutyltin as Sn	0	Organics	Organotins					All			2012-03-29
Tetrachlorobenzene, 1,2,3,4-	1,2,3,4-Tetrachlorobenzene	634662	Organics	SVOCs					All			2014-01-29
Tetrachlorobenzene, 1,2,3,4-(Surrogate)	Surrogate: 1,2,3,4-Tetrachlorobenzene	0	Organics	SVOCs					All			2014-01-29
Tetrachlorobenzene, 1,2,3,5/1,2,4,5-	1,2,3,5-Tetrachlorobenzene/1,2,4,5-Tetrachlorobenzene	0	Organics	SVOCs					All			2014-01-29
Tetrachlorobenzene, 1,2,4,5-	1,2,4,5-Tetrachlorobenzene	95943	Organics	SVOCs								2014-01-29
Tetrachlorobenzene-13C6,1,2,3,4-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4-Tetrachlorobenzene-13C6	2483735528										2024-01-19
Tetrachloroethane, 1,1,1,2-	1,1,1,2-Tetrachloroethane	630206	Organics	VOCs					All			2007-07-27
Tetrachloroethane, 1,1,2,2-	1,1,2,2-Tetrachloroethane	76345	Organics	VOCs					All			2007-07-27
Tetrachloroethylene	Tetrachloroethylene, Tetrachloroethene	127184	Organics	VOCs	Insecticides				All			2007-07-27
Tetrachloro-m-xylene	Tetrachlorometaxylene (TCMX)	877098	Organics	Pesticides								2011-08-09
Tetrachloro-m-xylene(Surrogate)	Surrogate: Tetrachloro-m-xylene (TCMX)	877098	Organics	Pesticides	Pest-OCHs				All			2016-03-02
Tetrachlorophenol	Tetrachlorophenol	0	Organics	SVOCs								2014-01-29
Tetrachlorophenol, 2,3,4,5-	2,3,4,5-Tetrachlorophenol	4901513	Organics	SVOCs	Phenols	Chlorinated Phenols			All			2010-05-18
Tetrachlorophenol, 2,3,4,6-	2,3,4,6-Tetrachlorophenol	58902	Organics	SVOCs	Phenols	Chlorinated Phenols			All			2010-05-18
Tetrachlorophenol, 2,3,5,6-	2,3,5,6-Tetrachlorophenol	935955	Organics	SVOCs	Phenols	Chlorinated Phenols			All			2010-05-18
Tetrachlorophenyl-hexachloro-norbornene	Tetrachlorophenyl-hexachloro-norbornene (Cl4-DEC604)	34571158	Organics	FlameRetardants								2015-07-16
Tetrachloroterephthalic acid	Tetrachloroterephthalic acid	2136790										2017-01-12
Tetrachlorvinphos	Tetrachlorvinphos (Stirofos)	22248799	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Tetraconazole	Tetraconazole (1-[2-(2,4-Dichlorophenyl)-3-(1,1,2,2-tetrafluoroethoxy)propyl]- 1H-1,2,4-triazole)	112281773	Organics	Fungicides								2016-05-20
Tetracosane, n-	n-Tetracosane	0	Organics	Alkanes								2014-01-28
Tetracosane, n-(Surrogate)	Surrogate: n-Tetracosane	0	Organics	SVOCs								2016-05-20
Tetracycline	Tetracycline	60548	Organics	PPCPs					All			2012-05-22
Tetradecane, 2-phenyl-	2-Phenyl-tetradecane	0	Organics	SVOCs								2016-05-20
Tetradecane, 3-phenyl-	3-Phenyl-tetradecane	0	Organics	SVOCs								2016-05-20
Tetradecane, 4-phenyl-	4-Phenyl-tetradecane	0	Organics	SVOCs								2016-05-20
Tetradecane, 5-phenyl-	5-Phenyl-tetradecane	0	Organics	SVOCs								2016-05-20
Tetradecane, 6-phenyl-	6-Phenyl-tetradecane	0	Organics	SVOCs								2016-05-20
Tetradecane, 7-phenyl-	7-Phenyl-tetradecane	0	Organics	SVOCs								2016-05-20
Tetradecane, n-	n-Tetradecane	0	Organics	Alkanes								2014-01-28
Tetradifon	Tetradifon	0	Organics	Pesticides								2008-06-27
Tetraethyl Pyrophosphate	Tetraethyl Pyrophosphate (TEPP)	107493	Organics	Pesticides	OrganophosphatePest.							2013-06-27
Tetraethyl pyrophosphate, TEPP	Tetraethyl pyrophosphate, TEPP	107493										2016-08-11
Tetrafluoro-2-[(1,1,1,2,3,3,4,4-Octafluorobutan-2-yl)oxy]Ethane-1-Sulfonic Acid, 1,1,2,2-	1,1,2,2-Tetrafluoro-2-[(1,1,1,2,3,3,4,4-Octafluorobutan-2-yl)oxy]Ethane-1-Sulfonic Acid (R-PSDCA) (Nafion Byproduct 6)	2416366215	Organics	PFAS								2026-02-10
Tetramethrin	Tetramethrin	7696120	Organics	Pesticides	Insecticides	Pyrethroids			All			2009-06-22
Tetramethylnaphthalene, 1,4,6,7-	1,4,6,7-Tetramethylnaphthalene	13764186	Organics	PAHs	Semi-VOAs				All			2010-07-08
Tetratriacontane, n-	n-Tetratriacontane	14167590	Organics	Alkanes								2013-05-01
Tetryl	Tetryl	479458	Organics									2019-12-18
T-Fluvalinate	T-Fluvalinate	102851069	Organics	Pesticides	Insecticides	Pyrethroids						2014-01-28
Thallium	Thallium	7440280	Inorganics	Metals					All			2007-07-27
Thanite	Thanite	0	Organics	Pesticides	Insecticides							2017-04-04
Theobromine	Theobromine	83670										2021-05-07
Theophylline	Theophylline	58559	Organics	PPCPs								2010-04-26
Theophylline-13C1-15N2(Surrogate)	Surrogate: Theophylline-13C1-15N2	0	Organics	PPCPs								2010-04-26
Thiabendazole	Thiabendazole	148798	Organics	PPCPs								2010-04-26
Thiabendazole, hypophosphite salt	Thiabendazole, hypophosphite salt	28558329	Organics	Pesticides								2017-04-20
Thiabendazole-d6(Surrogate)	Surrogate: Thiabendazole-d6	0	Organics	PPCPs								2010-04-26
Thiacloprid	Thiacloprid	111988499	Organics	Pesticides	Insecticides							2016-03-10
Thiacloprid-13C6(Surrogate)	Surrogate: Thiacloprid-13C6	0	Organics	Pesticides								2018-08-07
Thiacloprid-amide	Thiacloprid-amide	676228914	Organics	Pesticides								2018-08-07
Thiamethoxam	Thiamethoxam	153719234	Pesticides	Insecticides								2012-06-21
Thiamethoxam Degradate (CGA-355190)	Thiamethoxam Degradate (CGA-355190)	0	Organics	Pesticides								2026-04-03
Thiamethoxam Degradate (NOA-407475)	Thiamethoxam Degradate (NOA-407475)	0	Organics	Pesticides								2026-04-03
Thiamethoxam-d3(Surrogate)	Surrogate: Thiamethoxam-d3	1294048820								Organics		2021-02-01
Thiamethoxam-d4(Surrogate)	Surrogate: Thiamethoxam-d4	0	Organics	Pesticides								2018-08-07
Thiamethoxan	Thiamethoxan	153719234	Organics	Pesticides	Insecticides	Neonics						2017-10-05
Thiazopyr	Thiazopyr	117718602	Organics	Pesticides	Herbicides							2016-03-10
Thidiazuron	Thidiazuron	0	Organics	Pesticides	Herbicides							2017-04-04
Thiobencarb	Thiobencarb (Benthiocarb) (Bolero)	28249776	Organics	Pesticides	Pest-OPs				All			2013-06-24
Thiobencarb sulfoxide	Thiobencarb sulfoxide	51954768	Organics	Pesticides								2017-04-20
Thiobencarb(Surrogate)	Surrogate: Thiobencarb (Benthiocarb) (Bolero)	28249776	Organics	Herbicides								2016-05-20
Thiodicarb	Thiodicarb	0	Organics	Pesticides	Insecticides							2017-04-04
Thiofanox	Thiofanox	0	Organics	Pesticides	Insecticides							2017-04-04
Thionazin	Thionazin (Thionzin)	297972	Organics	Pesticides	Pest-OPs				All			2007-07-27
Thiophanate	Thiophanate	0	Organics	Pesticides	Fungicides							2017-04-04
Thiophanate-Methyl	Thiophanate-Methyl	0	Organics	Pesticides	Fungicides							2017-04-04
Thiram	Thiram	0	Organics	Pesticides	Fungicides							2017-04-04
Thorium	Thorium	7440291	Inorganics	Metals								2009-08-05
Tidal Height	Tidal Height	0	Habitat	NULL						Constituents		2016-05-20
Tidal State	Tidal State	0	FieldObservations	Habitat					All	Constituents		2012-09-13
TidalDirection	TidalDirection	0	Habitat						All			2014-11-04
Timber Harvest Extent	Timber Harvest Extent	0	Habitat						All			2019-05-07
Timber Harvest Intensity	Timber Harvest Intensity	0	Habitat						All			2019-05-07
Timber Harvest Proximity	Timber Harvest Proximity	0	Habitat						All			2019-05-07
Time	Time	0	Habitat						All			2009-08-20
Time to maturity	Time to maturity (days)	0	Toxicity						All			2007-07-27
Time, Fishing	Time spent fishing within a given waterbody	0	Habitat						All			2012-09-13
Time, Shock	Time spent electroshocking within a given waterbody	0	Habitat						All			2012-09-13
TimeToSpinTest	Time the velocity meter spins during QA/QC calibration checks	0	WaterQualityMeasurements						All			2012-05-22
TimeZone	Time Zone time was recorded in	0	Habitat	NULL						Field		2016-05-20
Tin	Tin	7440315	Inorganics	Metals					All			2007-07-27
Tire	Tire	0	Debris	Trash	Non-Plastics	Construction			All			2014-11-04
Titanium	Titanium	7440326	Inorganics	Metals					All			2007-07-27
Tokuthion	Tokuthion (Prothiofos)	34643464	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Tolfenpyrad	Tolfenpyrad	129558765	Organics	Pesticides	Insecticides							2016-03-10
Toluene	Toluene	108883	Organics	VOCs	MTBE_BTEX				All			2007-07-27
Toluene-d8(Surrogate)	Surrogate: Toluene-d8	2037265	Organics	VOCs	MTBE_BTEX				All			2007-07-27
Tonalide	Tonalide	0	Organics	Musk								2008-06-27
Toothbrush	Toothbrush	0	Debris	Trash	Plastics	Household			All			2014-11-04
Torrent 01	Torrent 01 - Recently devegetated corridor two or more times the width of the low flow channel	0	Habitat						All			2013-05-17
Torrent 02	Torrent 02 - Substrate cobbles or large gravel particles are not imbricated	0	Habitat						All			2013-05-17
Torrent 03	Torrent 03 - Channel has little evidence of pool-riffle structure	0	Habitat						All			2013-05-17
Torrent 04	Torrent 04 - Stream channel is scoured down to bedrock	0	Habitat						All			2013-05-17
Torrent 05	Torrent 05 - Gravel and cobble berms above bankfull level	0	Habitat						All			2013-05-17
Torrent 06	Torrent 06 - Massive deposits downstream of reach	0	Habitat						All			2013-05-17
Torrent 07	Torrent 07 - Riparian trees have fresh bark scars	0	Habitat						All			2013-05-17
Torrent 08	Torrent 08 - Riparian trees have fallen into channel as a result of scouring near their roots	0	Habitat						All			2013-05-17
Torrent 09	Torrent 09 - Massive deposits of sediment, logs and debris within reach	0	Habitat						All			2013-05-17
Torrent 10	Torrent 10 - Newly erroded deposites show evidence that the deposites are matrix supported	0	Habitat						All			2013-05-17
Torrent 11	Torrent 11 - No evidence of torrent scouring or torrent deposits	0	Habitat						All			2013-05-17
Total Alkanes	Total Alkanes	0	Organics	PAHs								2013-04-16
Total Anions	Total Anions	0	Inorganics									2016-12-21
Total Cations	Total Cations	0	Inorganics									2016-12-21
Total Cell Count	Total Cell Count	0	Toxicity						All			2007-07-27
Total Chlordanes	Total Chlordanes	0	Organics	Pesticides								2008-11-07
Total DDDs	Total DDDs	0	Organics	Pesticides								2016-09-19
Total DDEs	Total DDEs	0	Organics	Pesticides								2016-09-19
Total DDTs	Total DDTs	0	Organics	Pesticides								2008-11-07
Total DDTs - Lipid Basis	Total DDTs - Lipid Basis	0	Organics	Pesticides								2008-11-07
Total DDTs(Surrogate)	Surrogate: Total DDTs	0	Organics	Pesticides								2016-05-20
Total Debris, >2.5 cm	Total Debris >2.5 cm	0	Debris	Debris	Trash	Plastics			All			2014-11-04
Total Debris, 2.5 cm - 5 mm	Total Debris 2.5 cm - 5 mm	0	Debris	Debris	Trash	Plastics			All			2014-11-04
Total Dichlorobiphenyls	Total Dichlorobiphenyls	0	Organics	PCBs								2013-05-29
Total Di-ester Organophosphate Flame Retardants	Total Di-ester Organophosphate Flame Retardants	0	Organics	FlameRetardants								2016-06-23
Total Di-PCB	Total Di-PCB	0	Organics	PCBs								2014-01-22
Total Dissolved Solids	Total Dissolved Solids	0	Inorganics	Conventionals					All			2012-12-11
Total Endosulfans	Total Endosulfans	0	Organics	Pesticides								2008-11-07
Total Endosulfans - Lipid Basis	Total Endosulfans - Lipid Basis	0	Organics	Pesticides								2008-11-07
Total HCHs	Total HCHs	0	Organics	Pesticides								2008-11-07
Total Heptachlorobiphenyls	Total Heptachlorobiphenyls	0	Organics	PCBs								2013-05-29
Total Hepta-Dioxins	Total Hepta-Dioxins	0	Organics	DioxinsDibenzofurans								2008-06-27
Total Hepta-Furans	Total Hepta-Furans	0	Organics	DioxinsDibenzofurans								2008-06-27
Total Hepta-PCB	Total Hepta-PCB	0	Organics	PCBs								2014-01-22
Total Hexachlorobiphenyls	Total Hexachlorobiphenyls	0	Organics	PCBs								2008-11-07
Total Hexa-Dioxins	Total Hexa-Dioxins	0	Organics	DioxinsDibenzofurans								2008-06-27
Total Hexa-Furans	Total Hexa-Furans	0	Organics	DioxinsDibenzofurans								2008-06-27
Total Hexa-PCB	Total Hexa-PCB	0	Organics	PCBs								2014-01-22
Total Hydrogen	Total Hydrogen	0	Inorganics	Conventionals								2009-10-26
Total Inorganic Carbon	Total Inorganic Carbon (TIC)	0	Inorganics	Conventionals								2013-05-20
Total MirexHCBChlorpy (SFEI)	Total MirexHCBChlorpy (SFEI)	0	Organics	Pesticides								2014-01-28
Total Monochlorobiphenyls	Total Monochlorobiphenyls	0	Organics	PCBs								2013-05-29
Total Mono-PCB	Total Mono-PCB	0	Organics	PCBs								2014-01-22
Total Nonachlorobiphenyls	Total Nonachlorobiphenyls	0	Organics	PCBs								2013-05-29
Total Nonachlors	Total Nonachlors	0	Organics	Pesticides								2017-04-20
Total Nona-PCB	Total Nona-PCB	0	Organics	PCBs								2014-01-22
Total Normal	Total Normal	0	Toxicity						All			2007-07-27
Total Octachlorobiphenyls	Total Octachlorobiphenyls	0	Organics	PCBs								2013-05-29
Total Octa-PCB	Total Octa-PCB	0	Organics	PCBs								2014-01-22
Total Organic Carbon	Total Organic Carbon (TOC)	0	Inorganics	Conventionals					All			2007-07-27
Total Organic Matter	Includes all the elements (hydrogen, oxygen, nitrogen, etc) that are components of organic compounds, not just carbon.	0										2019-11-19
Total PAHs	Total PAHs	0	Organics	PAHs								2008-11-07
Total PAHs - Lipid Basis	Total PAHs - Lipid Basis	0	Organics	PAHs								2008-11-07
Total PBDEs	Total PBDEs	0	Organics	FlameRetardants								2008-06-27
Total PCBs	Total PCBs	0	Organics	PCBs								2008-11-07
Total PCBs (Aroclors)	Total PCBs (Aroclors)	0	Organics	PCBs								2008-11-07
Total PCBs (Aroclors) - Lipid Basis	Total PCBs (Aroclors) - Lipid Basis	0	Organics	PCBs								2008-11-07
Total Pentachlorobiphenyls	Total Pentachlorobiphenyls	0	Organics	PCBs								2013-05-29
Total Penta-Dioxins	Total Penta-Dioxins	0	Organics	DioxinsDibenzofurans								2008-06-27
Total Penta-Furans	Total Penta-Furans	0	Organics	DioxinsDibenzofurans								2008-06-27
Total Penta-PBDE	Total Penta-PBDE	0	Organics	FlameRetardants								2008-06-27
Total Penta-PCB	Total Penta-PCB	0	Organics	PCBs								2014-01-22
Total Pyrethrins	Total Pyrethrins	0	Organics	Pesticides								2016-10-25
Total Solids	Total Solids	0	Inorganics	Conventionals					All			2012-12-11
Total Suspended Solids	Total Suspended Solids	0	Inorganics	Conventionals					All			2012-12-11
Total Suspended Solids and Salts	Total Suspended Solids and Dissolved Salts	0	Inorganics	Conventionals					All			2014-02-13
Total TEQ (WHO 2005; ND=0)	Total TEQ (WHO 2005; ND=0)	0	Organics	DioxinsDibenzofurans								2008-06-27
Total TEQ (WHO 2005; ND=1/2DL)	Total TEQ (WHO 2005; ND=1/2DL)	0	Organics	DioxinsDibenzofurans								2008-06-27
Total Terphenyls	Total Terphenyls	0	Organics	PCBs								1900-01-01
Total Tetrachlorobiphenyls	Total Tetrachlorobiphenyls	0	Organics	PCBs								2013-05-29
Total Tetra-Dioxins	Total Tetra-Dioxins	0	Organics	DioxinsDibenzofurans								2008-06-27
Total Tetra-Furans	Total Tetra-Furans	0	Organics	DioxinsDibenzofurans								2008-06-27
Total Tetra-PBDE	Total Tetra-PBDE	0	Organics	FlameRetardants								2008-06-27
Total Tetra-PCB	Total Tetra-PCB	0	Organics	PCBs								2014-01-22
Total Trichlorobiphenyls	Total Trichlorobiphenyls	0	Organics	PCBs								2013-05-29
Total Tri-ester Organophosphate Flame Retardants	Total Tri-ester Organophosphate Flame Retardants	0	Organics	FlameRetardants								2016-06-23
Total Tri-PBDE	Total Tri-PBDE	0	Organics	FlameRetardants								2008-06-27
Total Tri-PCB	Total Tri-PCB	0	Organics	PCBs								2014-01-22
TotalPieces	Total Pieces of Trash using Trash Protocol	0	Trash						All			2011-05-04
Tox_Amphipod	Sediment Quality Objectives Line of Evidence (SQO LOE) short-term amphipod survival toxicity test result. The result represents the response of amphipods to bay/estuary sediment samples collected at a station but exposed in a controlled laboratory.	0	Sediment Quality Objectives	Index/Metric								2024-05-31
Tox_Mussel	Sediment Quality Objectives Line of Evidence (SQO LOE) sublethal mussel toxicity test result. The result represents the response of mussel embryos to bay/estuary sediment samples collected at a station but exposed in a controlled laboratory.	0	Sediment Quality Objectives	Index/Metric								2024-05-31
Tox_Polychaete	Sediment Quality Objectives Line of Evidence (SQO LOE) polychaete growth in sediment toxicity test result. The result represents the response of worms exposed to bay/estuary sediment samples collected at a station under controlled laboratory conditions.	0	Sediment Quality Objectives	Index/Metric								2024-05-31
Toxaphene	Toxaphene	8001352	Organics	Pesticides	Pest-OCHs	Insecticides			All			2007-07-27
Toxic	Toxic using Trash Protocol	0	Trash						All			2011-05-04
Toxic, Other	Toxic, Other	0	Debris	Trash	Plastics	Toxic			All			2014-11-04
Toy	Toy	0	Debris	Trash	Plastics	Household			All			2014-11-04
TPH as Diesel C10-C22	TPH as Diesel C10-C22	0	Organics	SVOCs								2014-05-01
TPH as Diesel C10-C23	TPH as Diesel C10-C23	0										2017-03-17
TPH as Diesel C10-C24	TPH as Diesel C10-C24	0	Organics									2015-06-25
TPH as Diesel C10-C25	TPH as Diesel C10-C25	0	Organics	PAHs								2016-05-20
TPH as Diesel C10-C28	TPH as Diesel C10-C28	0	Organics	SVOCs					All			2013-07-01
TPH as Diesel C11-C12	TPH as Diesel C11-C12	0	Organics	SVOCs								2016-08-19
TPH as Diesel C11-C25	TPH as Diesel C11-C25	0	Organics	PAHs								2016-05-20
TPH as Diesel C11-C28	TPH as Diesel C11-C28	0	Organics	PAHs								2016-05-20
TPH as Diesel C12-C24	TPH as Diesel C12-C24	0	Organics	SVOCs					All			2014-01-29
TPH as Diesel C12-C25	TPH as Diesel C12-C25	0	Organics	PAHs								2016-05-20
TPH as Diesel C13-C14	TPH as Diesel C13-C14	0	Organics	SVOCs								2016-08-19
TPH as Diesel C13-C22	TPH as Diesel C13-C22	0	Organics	SVOCs								2016-07-11
TPH as Diesel C13-C28	TPH as Diesel C13-C28	0	Organics	SVOCs								2022-05-26
TPH as Diesel C15-C16	TPH as Diesel C15-C16	0	Organics	SVOCs								2016-08-19
TPH as Diesel C17-C18	TPH as Diesel C17-C18	0	Organics	SVOCs								2016-08-19
TPH as Diesel C19-C20	TPH as Diesel C19-C20	0	Organics	SVOCs								2016-08-19
TPH as Diesel C21-C22	TPH as Diesel C21-C22	0	Organics	SVOCs								2016-08-19
TPH as Diesel C23-C24	TPH as Diesel C23-C24	0	Organics	SVOCs								2016-08-19
TPH as Diesel C23-C40	TPH as Diesel C23-C40	0	Organics	SVOCs								2016-07-11
TPH as Diesel C25-C28	TPH as Diesel C25-C28	0	Organics	SVOCs								2016-08-19
TPH as Diesel C29-C40	TPH as Diesel C29-C40	0										2017-01-12
TPH as Diesel C8-C21	TPH as Diesel C8-C21	0	Organics	SVOCs					All			2014-01-29
TPH as Gasoline C11-C12	TPH as Gasoline C11-C12	0										2020-06-19
TPH as Gasoline C3-C13	TPH as Gasoline C3-C13	0	Organics	SVOCs								2018-03-08
TPH as Gasoline C4-C12	TPH as Gasoline C4-C12	0	Organics	SVOCs								2016-07-11
TPH as Gasoline C4-C13	TPH as Gasoline C4-C13	0										2020-08-07
TPH as Gasoline C4-C5	TPH as Gasoline C4-C5	0										2020-06-19
TPH as Gasoline C5-C12	TPH as Gasoline C5-C12	0	Organics	SVOCs								2017-10-13
TPH as Gasoline C6	TPH as Gasoline C6	0	Organics	SVOCs								2016-08-19
TPH as Gasoline C6-C10	TPH as Gasoline C6-C10	0	Organics	SVOCs								2014-01-29
TPH as Gasoline C6-C12	TPH as Gasoline C6-C12	0	Organics	SVOCs								2016-07-11
TPH as Gasoline C6-C8	TPH as Gasoline C6-C8	0	Organics	PAHs								2016-05-20
TPH as Gasoline C7	TPH as Gasoline C7	0	Organics	SVOCs								2016-08-19
TPH as Gasoline C7-C9	TPH as Gasoline C7-C9	0	Organics	PAHs								2016-05-20
TPH as Gasoline C8	TPH as Gasoline C8	0	Organics	SVOCs								2016-08-19
TPH as Gasoline C8-C10	TPH as Gasoline C8-C10	0	ORGANICS	SVOCs								2019-06-28
TPH as Gasoline C9-C10	TPH as Gasoline C9-C10	0	Organics	SVOCs								2016-08-19
TPH as Heavy Fuel C28-C40	TPH as Heavy Fuel C28-C40	0	ORGANICS	SVOCs								2019-06-28
TPH as Heavy Fuel Oils C22-C36	TPH as Heavy Fuel Oils C22-C36	0	Organics	SVOCs								2014-05-01
TPH as JP4 C4-C14	TPH as JP-4 C4-C14 (Jet Fuel 4)	0	Organics	PAHs								2016-05-20
TPH as JP8 C7-C18	TPH as JP8 C7-C18 (Jet Fuel 8)	0	Organics	PAHs								2016-05-20
TPH as Motor Oil / Diesel C13-C44	TPH as Motor Oil / Diesel C13-C44	0										2020-06-19
TPH as Motor Oil C14-C44	TPH as Motor Oil C14-C44	0	Organics	PAHs								2016-07-05
TPH as Motor Oil C17-C44	TPH as Motor Oil C17-C44	0										2020-08-07
TPH as Motor Oil C18-C26	TPH as Motor Oil C18-C26	0	Organics	PAHs								2016-05-20
TPH as Motor Oil C18-C36	TPH as Motor Oil C18-C36	0	Organics	SVOCs								2016-09-22
TPH as Motor Oil C18-C40	TPH as Motor Oil C18-C40	0	Organics									2025-05-29
TPH as Motor Oil C21-C32	TPH as Motor Oil C21-C32	0	Organics	SVOCs								2014-01-29
TPH as Motor Oil C22-C36	TPH as Motor Oil C22-C36	0	Organics	PAHs								2016-05-20
TPH as Motor Oil C23-C36	TPH as Motor Oil C23-C36	0	Organics									2019-05-01
TPH as Motor Oil C23-C40	TPH as Motor Oil C23-C40	0	Organics	SVOCs								2016-10-26
TPH as Motor Oil C23-C44	TPH as Motor Oil C23-C44	0										2020-06-19
TPH as Motor Oil C24-C36	TPH as Motor Oil C24-C36	0	Organics	SVOCs								2017-04-19
TPH as Motor Oil C24-C40	TPH as Motor Oil C24-C40	0	Organics									2015-06-25
TPH as Motor Oil C25-C36	TPH as Motor Oil C25-C36	0	Organics	PAHs								2016-05-20
TPH as Motor Oil C28-C44	TPH as Motor Oil C28-C44	0										2023-03-06
TPH as Motor Oil C29-C40	TPH as Motor Oil C29-C40	0	Organics	SVOCs								2024-05-31
TPH as Oil C29-C44	TPH as Oil C29-C44	0	Organics	SVOCs								2018-03-08
TPH as Residual C25-C36	TPH as Residual C25-C36	0	Organics	SVOCs					All			2014-01-29
TPH as Residual C29-C32	TPH as Residual C29-C32	0	Organics	SVOCs								2016-08-19
TPH as Residual C33-C36	TPH as Residual C33-C36	0	Organics	SVOCs								2016-08-19
TPH as Residual C37-C40	TPH as Residual C37-C40	0	Organics	SVOCs								2016-08-19
TPH as Residual C41-C44	TPH as Residual C41-C44	0	Organics	SVOCs								2016-08-19
TPH as Residual C6-C44	TPH as Residual C6-C44	0										2017-05-25
Tralomethrin	Tralomethrin	66841256	Organics	Pesticides	Insecticides							2014-01-28
TransectsSampled	Number of transects sampled to attain sample material	0	Habitat						All			2009-10-29
Transfluthrin	Transfluthrin	118712893	Organics	Pesticides	Pyrethroids	Insecticides						2026-05-08
Transmittance	Transmittance	0	Inorganics	Conventionals	WaterQualityMeasurements				All			2007-07-27
Transparency	Transparency	0	FieldObservations									2015-06-26
Transportation Other Extent	Transportation Other Extent	0	Habitat						All			2019-05-07
Transportation Other Intensity	Transportation Other Intensity	0	Habitat						All			2019-05-07
Transportation Other Proximity	Transportation Other Proximity	0	Habitat						All			2019-05-07
Trash at >96" Drain	Trash at >96" Drain	0	Debris						All			2014-11-04
Trash at 12" Drain	Trash at 12" Drain	0	Debris						All			2014-11-04
Trash at 18" Drain	Trash at 18" Drain	0	Debris						All			2014-11-04
Trash at 24" Drain	Trash at 24" Drain	0	Debris						All			2014-11-04
Trash at 30" Drain	Trash at 30" Drain	0	Debris						All			2014-11-04
Trash at 36" Drain	Trash at 36" Drain	0	Debris						All			2014-11-04
Trash at 48" Drain	Trash at 48" Drain	0	Debris						All			2014-11-04
Trash at 60" Drain	Trash at 60" Drain	0	Debris						All			2014-11-04
Trash, Litter	Trash, Litter	0	Habitat						All			2009-08-20
Trash/Dumping Extent	Trash/Dumping Extent	0	Habitat						All			2019-05-07
Trash/Dumping Intensity	Trash/Dumping Intensity	0	Habitat						All			2019-05-07
Trash/Dumping Proximity	Trash/Dumping Proximity	0	Habitat						All			2019-05-07
TrashAssessment	RWQCB Trash Assessment	0	Trash						All			2007-07-27
Tree_Diameter	Diameter at breast height of the largest potential legacy tree visible from the location	0	Habitat						All			2012-09-05
Tree_Distance	Distance from the wetted edge to the largest potential legacy tree visible from the location	0	Habitat						All			2012-09-05
Tree_Height	Height of the largest potential legacy tree visible from the location	0	Habitat						All			2012-09-05
Tree_TaxonomicCategoryCode	Taxonomic Category Code of the largest potential legacy tree visible from the location	0	Habitat						All			2012-09-05
Trenbolone	Trenbolone	10161338	Organics	PPCPs								2010-04-26
Trenbolone Acetate	Trenbolone Acetate	0	Organics	PPCPs								2013-05-29
Triacontane, n-	n-Triacontane	0	Organics	Alkanes								2014-01-28
Triacontane, n-(Surrogate)	Surrogate: n-Triacontane	0	Organics	VOCs								2016-05-20
Triadimefon	Triadimefon	43121433	Organics	Pesticides	Fungicides							2016-03-10
Triadimenol	Triadimenol	55219653	Organics	Pesticides	Fungicides							2016-03-10
Triaholomethanes, Total	Total Triaholomethanes	0	Organics	VOCs								2014-01-29
Triallate	Triallate	2303175	Organics	Pesticides	Herbicides							2016-03-10
Triamterene	Triamterene	396010	Organics	PPCPs								2010-04-26
Triasulfuron	Triasulfuron	0	Organics	Pesticides	Herbicides							2017-04-04
Tribromobenzene, 1,3,5-	1,3,5-Tribromobenzene (TBBZ)	626391	Organics	FlameRetardants								2015-07-16
Tribromophenol, 2,4,6-	2,4,6-Tribromophenol	118796	Organics	SVOCs								2016-05-20
Tribromophenol, 2,4,6-(Surrogate)	Surrogate: 2,4,6-Tribromophenol	118796	Organics	VOCs	Phenols	non-Chlorinated Phenols	Brominated Phenols					2016-03-02
Tributyl Phosphate-d27(IsoDilAnalogue)	Isotope Dilution Analogue: Tributyl Phosphate-d27 (TBP-d27)	61196267	Organics	FlameRetardants	PhosphateFlameRetardants	IDA						2026-02-10
Tributyl Phosphorotrithioate, S,S,S-	S,S,S-Tributyl Phosphorotrithioate (Def) (Butifos) (Merphos)	78488	Organics	Pesticides	Pest-OPs				All			2013-05-28
Tributylphosphate	Tributylphosphate (TBP)	126738	Organics	FlameRetardants					All			2014-03-13
Tributylphosphate(Surrogate)	Surrogate: Tributylphosphate (Butyl Phosphate)	126738	Organics	Pesticides	Pest-OPs				All			2016-03-02
Tributyltin as Sn	Tributyltin as Sn (TBT)	688733	Organics	Organotins	Biocide				All			2010-06-21
Tributyltin as Sn-d27(Surrogate)	Surrogate: Tributyltin as Sn-d27	0	Organics	Organotins	Biocide				All			2010-06-21
Trichlorfon	Trichlorfon	52686	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Trichloro-1,2,2-trifluoroethane, 1,1,2-	1,1,2-Trichloro-1,2,2-trifluoroethane	79131	Organics	VOCs					All			2007-12-14
Trichloroacetic Acid	Trichloroacetic Acid (TCAA)	76039	Organics	Haloacetic acids (HAAs)								2025-11-05
Trichlorobenzene, 1,2,3-	1,2,3-Trichlorobenzene	87616	Organics	VOCs					All			2007-07-27
Trichlorobenzene, 1,2,3-(Surrogate)	Surrogate: 1,2,3-Trichlorobenzene	0	Organics	SVOCs					All			2014-01-29
Trichlorobenzene, 1,2,4-	1,2,4-Trichlorobenzene	120821	Organics	SVOCs					All			2007-07-27
Trichlorobenzene, 1,2,4-(Surrogate)	Surrogate: 1,2,4-Trichlorobenzene	0	Organics	SVOCs								2016-05-20
Trichlorobenzene, 1,3,5-	1,3,5-Trichlorobenzene	108703	Organics	SVOCs					All			2014-01-29
Trichlorobenzene-13C6, 1,2,3-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3-Trichlorobenzene-13C6	0	Organics	Pest-OCHs	IDA							2023-10-26
Trichloroethane, 1,1,1-	1,1,1-Trichloroethane	71556	Organics	VOCs					All			2007-07-27
Trichloroethane, 1,1,2-	1,1,2-Trichloroethane	79005	Organics	VOCs					All			2007-07-27
Trichloroethylene	Trichloroethylene (Trichloroethene)	79016	Organics	VOCs					All			2013-05-28
Trichlorofluoromethane	Trichlorofluoromethane	75694	Organics	VOCs					All			2007-07-27
Trichloronate	Trichloronate	327980	Organics	Pesticides	Pest-OPs	Insecticides			All			2007-07-27
Trichlorophenol, 2,3,6-	2,3,6-Trichlorophenol	0	Organics	SVOCs								2014-01-29
Trichlorophenol, 2,4,5-	2,4,5-Trichlorophenol	95954	Organics	SVOCs	Phenols	Chlorinated Phenols			All			2007-07-27
Trichlorophenol, 2,4,5-(Surrogate)	Surrogate: 2,4,5-Trichlorophenol	0	Organics	SVOCs								2016-05-20
Trichlorophenol, 2,4,6-	2,4,6-Trichlorophenol	88062	Organics	SVOCs	Phenols	Chlorinated Phenols			All			2007-07-27
Trichlorophenol, 2,4,6-(Surrogate)	Surrogate: 2,4,6-Trichlorophenol	0	Organics	SVOCs								2016-05-20
Trichlorophenoxy)propionic Acid, 2-(2,4,5-	2-(2,4,5-Trichlorophenoxy)propionic Acid (2,4,5-TP) (Silvex) (Fenoprop)	93721	Organics	Herbicides								2016-05-20
Trichlorophenoxy)propionic Acid, 2-(2,4,5-(Surrogate)	Surrogate: 2-(2,4,5-trichlorophenoxy)propionic Acid (2,4,5-TP) (Silvex) (Fenoprop)	0	Organics	Herbicides								2016-05-20
Trichlorophenoxyacetic Acid, 2,4,5-	2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T)	93765	Organics	Herbicides					All			2013-06-03
Trichlorophenoxyacetic Acid, 2,4,5-(Surrogate)	Surrogate: 2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T)	93765	Organics	Herbicides								2016-03-02
Trichloropropane, 1,2,3-	1,2,3-Tricloropropane	96184	Organics	VOCs					All			2007-07-27
Triclocarban	Triclocarban	101202	Organics	PPCPs								2010-04-26
Triclocarban-13C6(Surrogate)	Surrogate: Triclocarban-13C6	0	Organics	PPCPs								2010-04-26
Triclopyr	Triclopyr	55335063	Organics	Pesticides								2008-11-17
Triclopyr, butoxyethyl ester	Triclopyr, butoxyethyl ester	64700567	Organics	Pesticides								2017-04-20
Triclosan	Triclosan	3380345	Organics	PPCPs					All			2012-05-22
Triclosan-13C12(Surrogate)	Surrogate: Triclosan-13C12	0	Organics	PPCPs								2010-04-26
Triclosan-13C6(Surrogate)	Surrogate: Triclosan-13C6	0	Organics	PPCPs								2012-05-22
Triclosan-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Triclosan-d3	1020719985	Organics									2022-07-22
Triclosan-d3(Surrogate)	Surrogate: Triclosan-d3	0	Organics	PPCPs								2018-08-07
Tricosane, n-	n-Tricosane	638675	Organics	Alkanes								2013-05-01
Tricresyl Phosphate	Tricresyl Phosphate (TCrP)	1330785	Organics	FlameRetardants					All			2014-03-13
Tricyclazole	Tricyclazole (5-methyl-1,2,4-triazolo[3,4-b]benzothiazole)	0										2017-01-12
Tridecane, 2-phenyl-	2-Phenyl-tridecane	0	Organics	VOCs								2016-05-20
Tridecane, 3-phenyl-	3-Phenyl-tridecane	0	Organics	VOCs								2016-05-20
Tridecane, 4-phenyl-	4-Phenyl-tridecane	0	Organics	VOCs								2016-05-20
Tridecane, 5-phenyl-	5-Phenyl-tridecane	0	Organics	VOCs								2016-05-20
Tridecane, 6/7-phenyl-	6-Phenyltridecane/7-Phenyltridecane	0	Organics	VOCs								2016-05-20
Tridecane, n-	n-Tetratriacontane	629505	Organics	Alkanes								2013-05-01
Tridimephon	Triadimefon	43121433	Organics	Pesticides	Fungicides							2016-10-25
Triethyl citrate	Triethyl citrate (ethyl citrate)	77930	Organics									2018-07-16
Triethyl Phosphate	Triethyl Phosphate (TEP)	78400	Organics	FlameRetardants								2015-07-16
Triethyl Phosphate-d15(IsoDilAnalogue)	Isotope Dilution Analogue: Triethyl Phosphate-d15 (TEP-d15)	135942119	Organics	FlameRetardants	PhosphateFlameRetardants	IDA						2026-02-10
Trifloxystrobin	Trifloxystrobin	141517217	Organics	Fungicides								2016-05-20
Triflumizole	Triflumizole	68694111	Organics	Fungicides								2016-05-20
Trifluorotolunene, a,a,a-(Surrogate)	Surrogate: a,a,a-Trifluorotoluene	0	Organics	VOCs								2016-05-20
Trifluralin	Trifluralin	1582098	Organics	Herbicides					All			2007-07-27
Trifluralin-d14(Surrogate)	Surrogate: Trifluralin-d14	0	Organics	Pesticides								2018-03-04
Triforine	Triforine	0	Organics	Pesticides								2017-04-04
Trihalomethanes, Total	Total Trihalomethanes	0	Organics	VOCs					All			2010-06-23
Triisobutyl Phosphate	Triisobutyl Phosphate (TIBP)	126716	Organics	FlameRetardants								2015-07-16
Trimethoprim	Trimethoprim	738705	Organics	PPCPs					All			2012-05-22
Trimethoprim-13C3(Surrogate)	Surrogate: Trimethoprim-13C3	0	Organics	PPCPs								2010-04-26
Trimethylbenzene, 1,2,4-	1,2,4-Trimethylbenzene	95636	Organics	VOCs	Herbicides				All			2007-07-27
Trimethylbenzene, 1,3,5-	1,3,5-Trimethylbenzene	108678	Organics	VOCs					All			2007-07-27
Trimethylnaphthalene, 1,6,7-	1,6,7-Trimethylnaphthalene	0	Organics	PAHs					All			2012-05-22
Trimethylnaphthalene, 2,3,5-	2,3,5-Trimethylnaphthalene	2245387	Organics	PAHs	SVOCs	LMW_PAH			All			2007-07-27
Trimethylnaphthalene, 2,3,6-	2,3,6-Trimethylnaphthalene	829265	Organics	PAHs	Semi-VOAs				All			2010-07-08
Trimethylphenanthrene, 1,2,6-	1,2,6-Trimethylphenanthrene	0	Organics	PAHs								2014-01-28
Trimethylphenol, 2,4,6-(Surrogate)	Surrogate: 2,4,6-Trimethylphenol	527606	Organics	PAHs	SVOCs	Phenols	Surfactants		All			2010-05-18
Trinitrophenylnitramine, Methyl-2,4,6-	Methyl-2,4,6-trinitrophenylnitramine (Tetryl)	479458	Organics									2026-04-08
Trinitrotoluene, 2,4,6-	2,4,6-Trinitrotoluene (TNT)	118967	Organics									2019-12-18
Tripentyl Phosphate	Tripentyl Phosphate (TPeP)	2528383	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Tripentyltin(Surrogate)	Surrogate: Tripentyltin	0	Inorganics	Metals					All			2015-10-19
Triphenyl Phosphate	Triphenyl Phosphate	0	Organics	FlameRetardants								2013-05-29
Triphenyl Phosphate(Surrogate)	Surrogate: Triphenyl Phosphate	115866	Organics	Pesticides	Pest-OPs				All			2016-03-02
Triphenyl Phosphate-13C18(IsoDilAnalogue)	Isotope Dilution Analogue: Triphenyl Phosphate-13C18 (TPhP-13C18) (TPP-13C18)	0	Organics	FlameRetardants	PhosphateFlameRetardants	IDA						2026-02-10
Triphenylene	Triphenylene	0	Organics	PAHs								2014-01-28
Tripropyl Phosphate	Tripropyl Phosphate (TPrP)	513086	Organics	FlameRetardants					All			2014-03-13
Tripropyl Phosphate-d21(IsoDilAnalogue)	Isotope Dilution Analogue: Tripropyl Phosphate-d21 (TPrP-d21)	1219794929	Organics	FlameRetardants	PhosphateFlameRetardants	IDA						2026-02-10
Tripropyltin as Sn-d27(Surrogate)	Surrogate: Tripropyltin as Sn-d27	0	Organics	Organotins								2016-05-20
Tripropyltin(Surrogate)	Surrogate: Tripropyltin	0	Organics	Organotins								2014-01-28
Tris(1,1-dimethylethyl)phenol, 2,4,6-	2,4,6-Tris(1,1-dimethylethyl)phenol	0	Organics	Phenols								2010-07-14
Tris(1,3-dichloroisopropyl)phosphate	Tris(1,3-dichloroisopropyl)phosphate (TDCPP)	13674878	Organics	FlameRetardants					All			2014-03-20
Tris(1,3-Dichloroisopropyl)Phosphate-d15(IsoDilAnalogue)	Isotope Dilution Analogue: Tris(1,3-Dichloroisopropyl)Phosphate-d15 (TDCPP-d15)	1447569778	Organics	FlameRetardants	PhosphateFlameRetardants	IDA						2026-04-16
Tris(1,3-dichloroisopropyl)phosphate-d15(Surrogate)	Surrogate: Tris(1,3-dichloroisopropyl)phosphate-D15 (TDCPP-d15)	1447569778	Organics	FlameRetardants								2026-06-12
Tris(1,3-dichloropropyl)phosphate	Tris(1,3-dichloropropyl)phosphate	13674878	Organics	FlameRetardants								2009-11-10
Tris(1-Chloro-2-Propyl) Phosphate-d18(IsoDilAnalogue)	Isotope Dilution Analogue: Tris(1-Chloro-2-Propyl) Phosphate-d18 (TCPP-d18)	1447569789	Organics	FlameRetardants	PhosphateFlameRetardants	IDA						2026-02-10
Tris(1-chloro-2-propyl)phosphate	Tris(1-chloro-2-propyl)phosphate (TCPP, multiple isomers)	13674845	Organics	FlameRetardants								2009-11-10
Tris(2,3-dibromopropyl) phosphate	Tris(2,3-dibromopropyl) phosphate (TDBPP)	126727	Organics	FlameRetardants					All			2014-03-13
Tris(2,3-Dibromopropyl) Phosphate-d15(IsoDilAnalogue)	Isotope Dilution Analogue: Tris(2,3-Dibromopropyl) Phosphate-d15 (TDBPP-d15)	157801779	Organics	FlameRetardants	PhosphateFlameRetardants	IDA						2026-02-10
Tris(2-bromo-4-methylphenyl) phosphate	Tris(2-bromo-4-methylphenyl) phosphate (TBMPP)	0	Organics	FlameRetardants					All			2014-03-13
Tris(2-Butoxyethyl) Phosphate-d27(IsoDilAnalogue)	Isotope Dilution Analogue: Tris(2-Butoxyethyl) Phosphate-d27 (TBEP-d27)	0	Organics	FlameRetardants	PhosphateFlameRetardants	IDA						2026-02-10
Tris(2-butoxyethyl)phosphate	Tris(2-butoxyethyl)phosphate (TBEP)	78513	Organics	FlameRetardants					All			2014-03-13
Tris(2-Chloroethyl) Phosphate-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Tris(2-Chloroethyl) Phosphate-d12 (TCEP-d12)	1276500470	Organics	FlameRetardants	PhosphateFlameRetardants	IDA						2026-02-10
Tris(2-chloroethyl)phosphate	Tris(2-chloroethyl)phosphate (TCEP)	115968	Organics	FlameRetardants					All			2014-03-13
Tris(2-ethylhexyl) phosphate	Tris(2-ethylhexyl) phosphate (TEHP)	78422	Organics	FlameRetardants					All			2014-03-13
Tris(2-Ethylhexyl) Phosphate-d51(IsoDilAnalogue)	Isotope Dilution Analogue: Tris(2-Ethylhexyl) Phosphate-d51 (TEHP-d51)	1259188378	Organics	FlameRetardants	PhosphateFlameRetardants	IDA						2026-02-10
Tris(2-isopropylphenyl)phosphate	Tris(2-isopropylphenyl)phosphate (TiPPP)	64532952	Organics	FlameRetardants								2015-07-16
Tris(3,5-dimethylphenyl)phosphate	Tris(3,5-dimethylphenyl)phosphate (T35DMPP)	25653161	Organics	FlameRetardants								2015-07-16
Tris(3-Isopropylphenyl) Phosphate	Tris(3-Isopropylphenyl) Phosphate (T3IPPP)	72668270	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Tris(4-Chlorophenyl)Methane	Tris(4-Chlorophenyl)Methane (TCPM, T4CPM)	27575786	Organics									2026-03-12
Tris(4-Isopropylphenyl) Phosphate	Tris(3-Isopropylphenyl) Phosphate (T4IPPP)	2502150	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Tris(4-tert-Butylphenyl) Phosphate	Tris(4-tert-Butylphenyl) Phosphate (T4tBPP)	78331	Organics	FlameRetardants	PhosphateFlameRetardants							2026-02-10
Tris(tribromoneopentyl) Phosphate	Tris(tribromoneopentyl) Phosphate	19186971	Organics	FlameRetardants	PhosphateFlameRetardants							2017-09-19
Tris-Methane	Tris-Methane	0	Organics	VOCs								2014-02-05
Tris-Methanol	Tris-Methanol	0	Organics	VOCs								2014-02-05
Trithion, Methyl	Methyl Trithion	953173	Organics	Pesticides	Insecticides				All			2016-06-07
Triticonazole	Triticonazole	131983727	Organics	Pesticides	Fungicides							2016-03-10
Tritium	Tritium	15086109	Inorganics									2013-05-20
Tritium 2scu	Tritium 2-sigma Combined Uncertainty	0	Inorganics									2013-06-03
Tritriacontane, n-	n-Tritriacontane	630057	Organics	Alkanes								2013-05-01
TrophicStatus	General classification of trophic status based on observed algae and herbaceous plant levels	0	Habitat						All			2012-09-13
TRPH	Total Recoverable Petroleum Hydrocarbons (TRPH)	0	Organics	PAHs								2016-05-20
Tungsten	Tungsten	0	Metals									2015-07-02
Turbidity	Turbidity	0	Inorganics	Conventionals	WaterQualityMeasurements	Habitat			All			2009-08-20
Tylosin	Tylosin	1401690	Organics	PPCPs					All			2012-05-22
Ultraviolet Absorption (254nm)	Ultraviolet Absorption (254nm)	0	Inorganics									2016-04-26
Undecane, 2-phenyl-	2-Phenyl-undecane	0	Organics	VOCs								2016-05-20
Undecane, 3-phenyl-	3-Phenyl-undecane	0	Organics	VOCs								2016-05-20
Undecane, 4-phenyl-	4-Phenyl-undecane	0	Organics	VOCs								2016-05-20
Undecane, 5-phenyl-	5-Phenyl-undecane	0	Organics	VOCs								2016-05-20
Undecane, 6-phenyl-	6-Phenyl-undecane	0	Organics	VOCs								2016-05-20
Undecane, n-	n-Undecane	1120214	Organics	Alkanes								2013-05-01
Undercut Distance	Undercut Distance	0	Habitat						All			2009-08-20
Unknown Fiber	Fiber particle unable to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown							1900-01-01
Unknown Fiber Bundle	Fiber Bundle particle unable to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown							1900-01-01
Unknown Film	Film particle unable to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown							1900-01-01
Unknown Foam	Foam particle unable to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown							1900-01-01
Unknown Fragment	Fragment particle unable to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown							1900-01-01
Unknown Macro Foam	Foam of unknown origin, not analyzed in a lab	0	Debris	Trash								2022-12-02
Unknown Potentially Rubber Foam	Foam particle not definitively but potentially characterized as rubber	0	Microdebris	Unknown	Unknown							1900-01-01
Unknown Potentially Rubber Fragment	Fragment particle not definitively but potentially characterized as rubber	0	Microdebris	Unknown	Unknown							1900-01-01
Unknown Sphere	Sphere particle unable to be characterized by spectroscopy	0	Microdebris	Unknown	Unknown							1900-01-01
Unnatural Inflows Extent	Unnatural Inflows Extent	0	Habitat						All			2019-05-07
Unnatural Inflows Intensity	Unnatural Inflows Intensity	0	Habitat						All			2019-05-07
Unnatural Inflows Proximity	Unnatural Inflows Proximity	0	Habitat						All			2019-05-07
Unpaved Roads Extent	Unpaved Roads Extent	0	Habitat						All			2019-05-07
Unpaved Roads Intensity	Unpaved Roads Intensity	0	Habitat						All			2019-05-07
Unpaved Roads Proximity	Unpaved Roads Proximity	0	Habitat						All			2019-05-07
UplandSlope	Slope of bank or upland area	0	Habitat						All			2012-09-13
Uranium	Uranium	0	Inorganics	Metals								2014-01-29
Urban Commercial Extent	Urban Commercial Extent	0	Habitat						All			2019-05-07
Urban Commercial Intensity	Urban Commercial Intensity	0	Habitat						All			2019-05-07
Urban Commercial Proximity	Urban Commercial Proximity	0	Habitat						All			2019-05-07
Urban Residential Extent	Urban Residential Extent	0	Habitat						All			2019-05-07
Urban Residential Intensity	Urban Residential Intensity	0	Habitat						All			2019-05-07
Urban Residential Proximity	Urban Residential Proximity	0	Habitat						All			2019-05-07
Urban Water Quality Other Extent	Urban Water Quality Other Extent	0	Habitat						All			2019-05-07
Urban Water Quality Other Intensity	Urban Water Quality Other Intensity	0	Habitat						All			2019-05-07
Urban Water Quality Other Proximity	Urban Water Quality Other Proximity	0	Habitat						All			2019-05-07
Urea	Urea	0	Organics	Carbamide								2011-11-02
Utensil	Utensil	0	Debris	Trash	Plastics	FoodService			All			2014-11-04
Valifenalate	Valifenalate	283159900	Organics						All			2022-10-28
Valley Width	Valley Width	0	Habitat						All			2009-08-20
Valsartan	Valsartan	137862534	Organics	PPCPs								2010-04-26
Vanadium	Vanadium	7440622	Inorganics	Metals					All			2007-07-27
Vector Control Extent	Vector Control Extent	0	Habitat						All			2019-05-07
Vector Control Intensity	Vector Control Intensity	0	Habitat						All			2019-05-07
Vector Control Proximity	Vector Control Proximity	0	Habitat						All			2019-05-07
VectorControl_Bs	Vector Control through Bs (Bacillus sphaericus) within waterbody	0	Habitat						All			2012-09-13
VectorControl_Bti	Vector Control through Bti (Bacillus Thuringensis Israelensis) within waterbody	0	Habitat						All			2012-09-13
VectorControl_Methoprene	Vector Control through Methoprene within waterbody	0	Habitat						All			2012-09-13
VectorControl_Mosquitofish	Vector Control through Mosquitofish within waterbody	0	Habitat						All			2012-09-13
VectorControl_Oil	Vector Control through Oil within waterbody	0	Habitat						All			2012-09-13
Veg_Emergent	Percent cover of emergent vegetation within a given area	0	Habitat						All			2012-09-13
Veg_Open	Percent cover of open space within a given area	0	Habitat						All			2012-09-13
Veg_SubmergedAlgae	Percent cover of submerged algae within a given area	0	Habitat						All			2012-09-13
Veg_SubmergedOther	Percent cover of submerged other (non-algae) within a given area	0	Habitat						All			2012-09-13
Veg_SurfaceAlgae	Percent cover of surface algae within a given area	0	Habitat						All			2012-09-13
Veg_SurfaceOther	Percent cover of surface other (non-algae) within a given area	0	Habitat						All			2012-09-13
Vegetation Cover Bank	Percent of both bank surfaces upstream of sample location estimated to be covered by vegetation (plants & roots at water's edge)	0	FieldObservations	Habitat					All	Constituents		2010-03-03
Vegetation Cover Instream	Percent of stream's water surface upstream of sample location estimated to be covered by aquatic vegetation	0	FieldObservations	Habitat					All	Constituents		2010-03-03
Vegetation Cover Quality Metric	Metric assesses the quality of vegetation cover in the riparian and channel zones	0	Habitat						All			2019-05-13
Vegetation Cover Structure Metric	Metric assesses structural complexity of the riparian environment in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte. Grasses are excluded.	0	Habitat						All			2019-05-13
Velocity	Velocity	0	WaterQualityMeasurements						All			2009-08-20
Venlafaxine	Venlafaxine	93413695										2021-05-07
Verapamil	Verapamil	52539	Organics	PPCPs								2010-04-26
Vernolate	S-propyl N,N-dipropylcarbamothioate	0										2017-01-12
Versalide	Versalide	0	Organics	Musk								2008-06-27
Vinclozolin	Vinclozolin	50471448	Organics	Pesticides	Fungicides							2016-10-25
Vineyards Extent	Vineyards Extent	0	Habitat						All			2019-05-07
Vineyards Intensity	Vineyards Intensity	0	Habitat						All			2019-05-07
Vineyards Proximity	Vineyards Proximity	0	Habitat						All			2019-05-07
Vinyl Acetate	Vinyl Acetate	108054								Organics	Polymer	2016-09-06
Vinyl Chloride	Vinyl Chloride	75014	Organics	VOCs					All			2007-07-27
Virginiamycin	Virginiamycin	11006761	Organics	PPCPs								2010-04-26
Virginiamycin M1	Virginiamycin M1	21411530	Organics	PPCPs								2018-01-18
Volume	Volume	0	Habitat						All			2009-08-20
W1_HALL_SWAMP	Riparian human disturbance index, all types, proximity-weighted sum	0	Bioassessment						All			2021-01-28
Wadeability	Wadeability	0	FieldObservations	Habitat					All			2009-08-20
Walking Path Extent	Walking Path Extent	0	Habitat						All			2019-05-07
Walking Path Intensity	Walking Path Intensity	0	Habitat						All			2019-05-07
Walking Path Proximity	Walking Path Proximity	0	Habitat						All			2019-05-07
Warfarin	Warfarin	81812	Organics	PPCPs								2010-04-26
Warfarin-d5(Surrogate)	Surrogate: Warfarin-d5	0	Organics	PPCPs								2010-04-26
Waste, Food	Waste, Food	0	Debris	Natural	Non-Plastics	Biodegradable	Marine Origin		All			2014-11-04
Waste, Pet	Waste, Pet	0	Debris	Natural	Non-Plastics	Toxic			All			2014-11-04
Waste, Yard	Waste, Yard	0	Debris	Natural	Non-Plastics	Biodegradable	Marine Origin		All			2014-11-04
Water Control Actions Other Extent	Water Control Actions Other Extent	0	Habitat						All			2019-05-07
Water Control Actions Other Intensity	Water Control Actions Other Intensity	0	Habitat						All			2019-05-07
Water Control Actions Other Proximity	Water Control Actions Other Proximity	0	Habitat						All			2019-05-07
Water Control Features Other Extent	Water Control Features Other Extent	0	Habitat						All			2019-05-07
Water Control Features Other Intensity	Water Control Features Other Intensity	0	Habitat						All			2019-05-07
Water Control Features Other Proximity	Water Control Features Other Proximity	0	Habitat						All			2019-05-07
Water level below Reference Point	Distance from reference point to water surface	0	Habitat						All			2015-01-26
Water Level Fluctuations	Water Level Fluctuations	0	Habitat						All			2009-08-20
Water Withdrawal	Water Withdrawal	0	Habitat						All			2009-08-20
Waterbody Appeal	Waterbody Appeal	0	Habitat						All			2009-08-20
Waterbody Disturbance	Waterbody Disturbance	0	Habitat						All			2009-08-20
WaterbodyOrigin	Origin of the waterbody	0	Habitat						All			2012-09-13
WaterClarity	WaterClarity	0	FieldObservations	Habitat					All			2009-08-20
Wave Height	Wave Height	0	Habitat	NULL								2016-05-20
WaveAction	Wind Movement of Water on Surface	0	FieldObservations	Habitat					All			2022-02-25
Weight	Weight	0	Toxicity						All			2011-12-13
Weight using UV light	Weight using UV light (%)	0	Toxicity						All			2007-07-27
Weirs Extent	Weirs Extent	0	Habitat						All			2019-05-07
Weirs Intensity	Weirs Intensity	0	Habitat						All			2019-05-07
Weirs Proximity	Weirs Proximity	0	Habitat						All			2019-05-07
WetlandClass	Class or type of wetland	0	Habitat						All			2012-09-13
WetlandFunction_FloodControl	Function of the wetland for flood control use	0	Habitat						All			2012-09-13
WetlandFunction_HumanUse	Function of the wetland for human use	0	Habitat						All			2012-09-13
WetlandFunction_Stormwater	Function of the wetland for stormwater use	0	Habitat						All			2012-09-13
WetlandFunction_Wildlife	Function of the wetland for wildlife use	0	Habitat						All			2012-09-13
Wetted habitat	Wetted habitat (standing or flowing surface water)	0	Habitat						All			2019-05-07
Wetted Width	Wetted Width	0	Habitat						All			2009-08-20
Width	Width	0	Habitat						All			2009-08-20
WindDirection	WindDirection	0	FieldObservations	Habitat					All			2009-08-20
WindIntensity	Intensity of wind at the time of sampling	0	Habitat						All			2012-09-13
WindSpeed	WindSpeed	0	FieldObservations	Habitat					All			2009-08-20
Wire	Wire	0	Debris	Trash	Non-Plastics	Metals			All			2014-11-04
Wood Debris	Wood Debris	0	Debris	Natural	Non-Plastics	Construction	Marine Origin		All			2014-11-04
Wool Fiber	Wool Fiber	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Wool Fiber Bundle	Wool Fiber Bundle	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Wool Film	Wool Film	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Wool Foam	Wool Foam	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Wool Fragment	Wool Fragment	0	Microdebris	Anthropogenic	Non-Plastic							1900-01-01
Wrapper, Food	Wrapper, Food	0	Debris	Trash	Plastics	Bags/Packaging			All			2014-11-04
Wrapper, Other	Wrapper, Other	0	Debris	Trash	Plastics	Bags/Packaging			All			2014-11-04
Wrapper, Plastic Straw	Wrapper, Plastic Straw	0	Debris	Trash	Plastics	Bags/Packaging			All			2014-11-04
XBKF_W	Mean bankfull width of reach	0	Bioassessment						All			2021-01-28
XCDENMID	Mean percent mid-channel canopy density	0	Bioassessment						All			2021-01-28
XCMG	Riparian cover as sum of three layers physical-habitat metric	0	Bioassessment						All			2021-01-28
XCMGW	Mean riparian woody cover as sum of three layers	0	Bioassessment						All			2021-01-28
XFC_NAT_SWAMP	Mean sum of natural instream cover types	0	Bioassessment						All			2021-01-28
XSLOPE	Mean slope (water surface gradient) of reach	0	Bioassessment						All			2021-01-28
Xylene, m/p-	m-Xylene/p-Xylene	179601231	Organics	VOCs	MTBE_BTEX	Xylenes			All			2013-04-10
Xylene, o-	o-Xylene	95476	Organics	VOCs	MTBE_BTEX	Xylenes			All			2007-07-27
Xylene, p-	p-Xylene	106423	Organics	VOCs	MTBE_BTEX	Xylenes			All			2007-07-27
Xylenes, Total	Total Xylenes	1330207	Organics	VOCs	MTBE_BTEX	Xylenes			All			2013-05-28
Young/female	Young/female (#)	0	Toxicity						All			2007-07-27
Ytterbium	Ytterbium	7440644	Inorganics									2013-05-20
Yttrium	Yttrium	7440655	Inorganics	Metals					All			2014-01-29
Zinc	Zinc	7440666	Inorganics	TraceElements	Metals				All			2007-07-27
Zinc Phosphide	Zinc Phosphide	0	Inorganics	Pesticides								2017-04-04
Zineb	Zineb	0	Organics	Pesticides	Fungicides							2017-04-04
Ziram	Ziram	137304	Organics	Pesticides	Fungicides							2008-03-17
Zirconium	Zirconium	0	Metals									2015-07-02
Zoxamide	Zoxamide	156052685	Organics	Pesticides	Fungicides							2016-03-10

CEDEN Data Checker Lookup Lists

CEDEN LookUp List: AnalyteLookUp