| AnalyteName | AnalyteDescr |
| Chemical Group A | Total of (Aldrin,Dieldrin,Endrin,Heptachlor,Heptachlor Epoxide,Chlorine,HCH, Endosulfan,Toxaphene) |
| [(Methylimino)dimethylidyne]di-2,4-xylidine, N,N'- | N,N'-[(Methylimino)dimethylidyne]di-2,4-xylidine (Amitraz) |
| [DAsp3]Microcystin-RR | [Deaspartic acid3] Microcystin-RR |
| 1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane | 1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (DBE-DBCH) |
| 18a-Oleanane | 18a-Oleanane |
| 2,2-bis(chloromethyl)propane-1,3-diyltetrakis(2-chloroethyl) bisphosphate | 2,2-bis(chloromethyl)propane-1,3-diyltetrakis(2-chloroethyl) bisphosphate (V6) |
| 2,4,6-tribromophenyl allyl ether | 2,4,6-tribromophenyl allyl ether (ATE) |
| 2-ethyl-1-hexyl-2,3,4,5-tetrabromobenzoate | 2-ethyl-1-hexyl-2,3,4,5-tetrabromobenzoate (EHTBB) |
| 2-Ethylhexyl-diphenyl phosphate | 2-Ethylhexyl-diphenyl phosphate (EHDPP) |
| 4-Aminophenylsulfonylcarbamic acid methyl ester, N- | N-(4-Aminophenyl)sulfonylcarbamic acid methyl ester (Asulam) |
| 4-chloro-2-methylphenyl-N,N-dimethylmethanimidamide, N'- | N'-(4-chloro-2-methylphenyl)-N,N-dimethylmethanimidamide (Chlordimeform) |
| 6-Pack Ring | 6-Pack Ring |
| 6PPD-quinone | 6PPD-quinone (N-(1,3-dimethylbutyl)-N'-phenyl-p-phenylenediamine-quinone) |
| 6PPD-quinone-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: 6PPD-quinone-13C6 |
| 6PPD-quinone-d5(IsoDilAnalogue) | Isotope Dilution Analogue: 6PPD-quinone-d5 (6PPDQ-d5) |
| Abamectin | Abamectin |
| Abnormality | Abnormality (%) |
| Abundance | Abundance |
| AccesstoWaterbody_BikePath | AccesstoWaterbody_BikePath |
| AccesstoWaterbody_Fence | AccesstoWaterbody_Fence |
| AccesstoWaterbody_HeavyVegetation | AccesstoWaterbody_HeavyVegetation |
| AccesstoWaterbody_ParkingLot | AccesstoWaterbody_ParkingLot |
| AccesstoWaterbody_PicnicArea | AccesstoWaterbody_PicnicArea |
| AccesstoWaterbody_RestrictedAccessMaintenanceRoad | AccesstoWaterbody_RestrictedAccessMaintenanceRoad |
| AccesstoWaterbody_Roadway | AccesstoWaterbody_Roadway |
| AccesstoWaterbody_Walkway | AccesstoWaterbody_Walkway |
| Accumulation | Accumulation using Trash Protocol |
| Acenaphthene | Acenaphthene |
| Acenaphthene-d10(Surrogate) | Surrogate: Acenaphthene-d10 |
| Acenaphthenes, C1- | C1-Acenaphthenes |
| Acenaphthylene | Acenaphthylene |
| Acenaphthylene-d10(Surrogate) | Surrogate: Acenaphthylene-d10 |
| Acenaphthylene-d8(IsoDilAnalogue) | Isotope Dilution Analogue: Acenaphthylene-d8 |
| Acenaphthylene-d8(Surrogate) | Surrogate: Acenaphthylene-d8 |
| Acesulfame potassium | Acesulfame potassium |
| Acetaldehyde | Acetaldehyde (Ethanal) |
| Acetaminophen | Acetaminophen |
| Acetaminophen(Surrogate) | Surrogate: Acetaminophen |
| Acetamiprid | Acetamiprid |
| Acetamiprid-13C6(Surrogate) | Surrogate: Acetamiprid-13C6 |
| Acetamiprid-d3(Surrogate) | Surrogate: Acetamiprid-d3 |
| Acetamiprid-N-Desmethyl | Acetamiprid-N-Desmethyl |
| Acetone | Acetone |
| Acetophenone | Acetophenone |
| Acibenzolar-S-methyl | Acibenzolar-S-methyl |
| Acid Mine Drainage Extent | Acid Mine Drainage Extent |
| Acid Mine Drainage Intensity | Acid Mine Drainage Intensity |
| Acid Mine Drainage Proximity | Acid Mine Drainage Proximity |
| Acid Neutralizing Capacity | Acid Neutralizing Capacity (ANC) |
| Acid Volatile Sulfides | Acid Volatile Sulfides (AVS) |
| Acifluorfen | Acifluorfen |
| Acifluorfen Sodium | Acifluorfen Sodium |
| Acrinathrin | Acrinathrin |
| Acrolein | Acrolein |
| Acrylic fiber | Acrylic fiber, that can be grouped under plastic category |
| Acrylic Fiber Bundle | Acrylic Fiber Bundle |
| Acrylic Film | Acrylic Film |
| Acrylic Foam | Acrylic Foam |
| Acrylic Fragment | Acrylic Fragment |
| Acrylic Sphere | Acrylic Sphere |
| Acrylonitrile | Acrylonitrile |
| Acrylonitrile Butadiene Styrene Fiber | Acrylonitrile butadiene styrene Fiber |
| Acrylonitrile Butadiene Styrene Film | Acrylonitrile butadiene styrene Film |
| Acrylonitrile Butadiene Styrene Fragment | Acrylonitrile butadiene styrene Fragment |
| Actinemys pallida (SWPT) | Actinemys pallida, Assay name: SWPT, 5’ CCATCCCTACTACTACTTCTAGC 3’, 5’ GGCTAAGTTTCCGGCTAATG 3’, 5FAM-TGCCCCTGCTTCGATTCCTGAT-3IABkFQ |
| Adsorbable Organic Fluorine | Adsorbable Organic Fluorine (AOF) [detected as Fluoride] |
| Aesthetic Condition | Aesthetic Condition |
| AFDM_Algae | Ash Free Dry Mass primarily of Algae but other items may be weighed |
| Age | Age |
| Age Diversity and Natural Regeneration Metric | Metric assesses the age diversity and natural regeneration potential of woody species in the riparian and channel zones (excluding low-flow). |
| Age_Pond | Age (in years) of the pond if it is created |
| Agricultural Other Extent | Agricultural Other Extent |
| Agricultural Other Intensity | Agricultural Other Intensity |
| Agricultural Other Proximity | Agricultural Other Proximity |
| Agricultural Runoff Extent | Agricultural Runoff Extent |
| Agricultural Runoff Intensity | Agricultural Runoff Intensity |
| Agricultural Runoff Proximity | Agricultural Runoff Proximity |
| Air Traffic Extent | Air Traffic Extent |
| Air Traffic Intensity | Air Traffic Intensity |
| Air Traffic Proximity | Air Traffic Proximity |
| Alachlor | Alachlor (Lasso) |
| Alachlor ethanesulfonic acid | Alachlor ethanesulfonic acid (ESA) |
| Alachlor oxanilic acid | Alachlor oxanilic acid (OXA) |
| Albuterol | Albuterol |
| Albuterol-d3(Surrogate) | Surrogate: Albuterol-d3 |
| Aldicarb | Aldicarb |
| Aldicarb Sulfone | Aldicarb Sulfone |
| Aldicarb Sulfoxide | Aldicarb Sulfoxide |
| Aldrin | Aldrin |
| Aldrin(Surrogate) | Surrogate: Aldrin |
| Aldrin-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Aldrin-13C12 |
| Aldrin-13C12(Surrogate) | Surrogate: Aldrin-13C12 |
| Algae | Algae for benthics |
| Algae Cover | Percent of stream's water surface upstream of sample location estimated to be covered with algae |
| Algae-attached | Percent of substrate in wetted channel upstream of sample location estimated to be covered with Algae-attached |
| Algae-floating Mats | Percent of stream's water surface upstream of sample location estimated to be covered with Algae-floating Mats |
| Algal Growth Potential as Chlorophyll a | Algal Growth Potential as Chlorophyll a |
| Algal/Surface Mats/Benthic Algal Growth Extent | Algal/Surface Mats/Benthic Algal Growth Extent |
| Algal/Surface Mats/Benthic Algal Growth Intensity | Algal/Surface Mats/Benthic Algal Growth Intensity |
| Algal/Surface Mats/Benthic Algal Growth Proximity | Algal/Surface Mats/Benthic Algal Growth Proximity |
| Alkalinity as CaCO3 | Alkalinity as CaCO3 |
| Allethrin | Allethrin |
| Allyl Chloride | Allyl Chloride (3-Chloropropene) |
| Alpha Linolenic Acid | Alpha Linolenic Acid |
| Alprazolam | Alprazolam |
| Alprazolam-d5(Surrogate) | Surrogate: Alprazolam-d5 |
| Aluminum | Aluminum |
| Aluminum Foil | Aluminum Foil |
| Aluminum Phosphide | Aluminum Phosphide (Phostoxin or Fumitoxin) |
| Aluminum, Organic Monomeric | Organic Monomeric Aluminum (Organic Reactive) |
| Aluminum, Total Monomeric | Total Monomeric Aluminum (Organic + Inorganic Reactive) |
| Aluminum/Steel Can | Aluminum/Steel Can |
| Ametryn | Ametryn |
| Amino-1,2,4-triazole, 3- | 3-Amino-1,2,4-triazole (Amitrole) |
| Amino-2-chloro-4(ethylamino)-s-triazine, 6- | 6-Amino-2-chloro-4(ethylamino)-s-triazine (CEAT) |
| Aminobenzothiazole, 2- | 2-Aminobenzothiazole (ABT) |
| Aminocarb | Aminocarb |
| Aminomethyl Phosphonic Acid | Aminomethyl Phosphonic Acid (AMPA) |
| Aminopyralid | Aminopyralid |
| Aminopyridine, 4- | 4-Aminopyridine |
| Amitriptyline | Amitriptyline |
| Amitriptyline-d5(Surrogate) | Surrogate: Amitriptyline-d5 |
| Amitriptyline-d6(Surrogate) | Surrogate: Amitriptyline-d6 |
| Amlodipine | Amlodipine |
| Ammonia as N | Ammonia as N |
| Ammonia as N, Unionized | Unionized Ammonia as N |
| Ammonia as NH3 | Ammonia as NH3 |
| Ammonia as NH3, Unionized | Unionized Ammonia as NH3 |
| Ammonium as N | Ammonium as N (NH4) |
| Ammonium Chloride | Ammonium Chloride |
| Amoxicillin | Amoxicillin |
| AMPA(Surrogate) | Surrogate: Aminomethyl Phosphonic Acid (AMPA) |
| Amphetamine | Amphetamine |
| Amphetamine-d5(Surrogate) | Surrogate: Amphetamine-d5 |
| AnalysisWeight | Analysis weight of sample |
| Anatoxin-A | Anatoxin-A |
| Anaxyrus californicus (AroT) | Anaxyrus californicus, Assay name: AroT, 5’ CACCAAACTAACTAACTTCTTT 3’, 5’ CATTAGGTATTTCATCATTCCC 3’, 5FAM-AATTTATTGGAGCTATAATGATAGTACCGT-3IABkFQ |
| Andorostenedione | Andorostenedione |
| Androstane, 5-alpha- | 5-alpha-Androstane |
| Angling Pressure | Angling Pressure |
| Anilazine | Anilazine |
| Aniline | Aniline (Aminobenzene)(Phenylamine) |
| Animal Burrows Extent | Animal Burrows Extent |
| Animal Burrows Intensity | Animal Burrows Intensity |
| Animal Burrows Proximity | Animal Burrows Proximity |
| AnimalPresence | describes presence of animals which may include tracks, scat, sounds or physical presence |
| Anion-Cation Balance | Anion-Cation Balance |
| AnoxicTransitionDepth | Depth of the oxic-anoxic transition zone, also called redox potential discontinuity |
| Antennal segment | Antennal segment (#) |
| Anthracene | Anthracene |
| Anthracene-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Anthracene-d10 |
| Anthracene-d10(Surrogate) | Surrogate: Anthracene-d10 |
| Anthraquinone | Anthraquinone |
| Anthropogenic (cellulosic) fiber | Cellulosic fiber (Cotton, Rayon, Modal, or Lyocell), that can be grouped under cellulosic fiber and is dyed or dyed. |
| Anthropogenic (cellulosic) Fiber Bundle | Anthropogenic (cellulosic) Fiber Bundle |
| Anthropogenic (cellulosic) Film | Anthropogenic (cellulosic) Film |
| Anthropogenic (cellulosic) Foam | Anthropogenic (cellulosic) Foam |
| Anthropogenic (cellulosic) Fragment | Anthropogenic (cellulosic) Fragment |
| Anthropogenic (cellulosic) Sphere | Anthropogenic (cellulosic) Sphere |
| Anthropogenic (non-plastic) fragment | Fragment that is anthropogenic, confirmed as non-plastic including asphalt |
| Anthropogenic (plastic) fragment | Fragment that is anthropogenic, confirmed as plastic based on dye spectroscopy, but polymer type could not be identified |
| Anthropogenic (protein base) Fiber | Anthropogenic (protein base) Fiber |
| Anthropogenic (protein) fiber | Wool, hair, or silk fiber that can be grouped under protein fiber and is dyed or undyed |
| Anthropogenic (synthetic) fiber | Synthetic fiber that is dyed (e.g. monomers, polymer degradation products such as aromatic compounds and esters) |
| Anthropogenic (synthetic) Film | Anthropogenic (synthetic) Film |
| Anthropogenic (synthetic) Foam | Anthropogenic (synthetic) Foam |
| Anthropogenic (synthetic) Fragment | Anthropogenic (synthetic) Fragment |
| Anthropogenic (synthetic) Sphere | Anthropogenic (synthetic) Sphere |
| Anthropogenic (unknown base) fiber | Fiber that is anthropogenic because it is DYED, but material type could not be identified as plastic or natural |
| Anthropogenic (unknown base) Fiber Bundle | Anthropogenic (unknown base) Fiber Bundle |
| Anthropogenic (unknown base) Film | Anthropogenic (unknown base) Film |
| Anthropogenic (unknown base) Foam | Anthropogenic (unknown base) Foam |
| Anthropogenic (unknown base) fragment | Fragment that is anthropogenic, confirmed as plastic , but polymer type could not be identified |
| Anthropogenic (unknown base) Sphere | Anthropogenic (unknown base) Sphere |
| Anthropogenic Alt Channel Modification SubMetric | Metric assesses the impact of anthropogenic alterations based on channel modification |
| Anthropogenic Alt Hydromodification SubMetric | Metric assesses the impact of anthropogenic alterations based on hydromodification and Channel Evolution Models (CEMS) |
| Anthropogenic Alterations to Channel Morph Metric | Metric assesses the impact of anthropogenic alterations to channel morphology through hydromodification and channel modification. Metric is an average of the two previous submetrics. |
| Antimony | Antimony |
| Antipyrine | Antipyrine (Phenazone) |
| Appliance | Appliance |
| AquaticLife | AquaticLife using Trash Protocol |
| Arachidonic | Arachidonic |
| Area | Area |
| Arsenate | Arsenate |
| Arsenic | Arsenic |
| Arsenic, Inorganic | Inorganic Arsenic |
| Arsenite | Arsenite |
| Asbestos, Total | Total Asbestos |
| ASCI_D | Score for the Diatom Algal Stream Condition Index |
| ASCI_D_cnt.spp.most.tol_pct_att | Percent of taxa attributed with tolerance value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_cnt.spp.most.tol_pred | Count of most tolerant algae taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_cnt.spp.most.tol_raw | Count of most tolerant algae taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_cnt.spp.most.tol_scr | Count of most tolerant algae taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_EpiRho.richness_pct_att | Percent of taxa attributed with genus (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_EpiRho.richness_pred | Richness of Epithemia and Rhopalodia taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_EpiRho.richness_raw | Richness of Epithemia and Rhopalodia taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_EpiRho.richness_scr | Richness of Epithemia and Rhopalodia taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_NumberTaxa | Number of diatom taxa |
| ASCI_D_prop.spp.IndicatorClass_TN_low_pct_att | Percent of taxa attributed with nitrogen indicator value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.IndicatorClass_TN_low_pred | Proportion low total nitrogen indicator taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.IndicatorClass_TN_low_raw | Proportion low total nitrogen indicator taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.IndicatorClass_TN_low_scr | Proportion low total nitrogen indicator taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Planktonic_pct_att | Percent of taxa attributed with habitat value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Planktonic_pred | Proportion planktonic taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Planktonic_raw | Proportion planktonic taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Planktonic_scr | Proportion planktonic taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Trophic.E_pct_att | Percent of taxa attributed with trophic indicator value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Trophic.E_pred | Proportion eutrophic taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Trophic.E_raw | Proportion eutrophic taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Trophic.E_scr | Proportion eutrophic taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_Salinity.BF.richness_pct_att | Percent of taxa attributed with salinity value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_Salinity.BF.richness_pred | Richness of brackish/freshwater taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_Salinity.BF.richness_raw | Richness of brackish/freshwater taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_Salinity.BF.richness_scr | Richness of brackish/freshwater taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_ValveCount | Total number of diatom valves reported in the input data (i.e., sum of BAResult) |
| ASCI_H | Score for the Hybrid (diatom and soft-bodied algae) Algal Stream Condition Index |
| ASCI_H_cnt.spp.IndicatorClass_TP_high_pct_att | Percent of taxa attributed phosphorus indicator value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.IndicatorClass_TP_high_pred | Count of high total phosphorus indicator taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.IndicatorClass_TP_high_raw | Count of high total phosphorus indicator taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.IndicatorClass_TP_high_scr | Count of high total phosphorus indicator taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.most.tol_pct_att | Percent of taxa attributed with tolerance value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.most.tol_pred | Count of most tolerant algae taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.most.tol_raw | Count of most tolerant algae taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.most.tol_scr | Count of most tolerant algae taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_EpiRho.richness_pct_att | Percent of taxa attributed with genus (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_EpiRho.richness_pred | Richness of Epithemia and Rhopalodia taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_EpiRho.richness_raw | Richness of Epithemia and Rhopalodia taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_EpiRho.richness_scr | Richness of Epithemia and Rhopalodia taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_NumberTaxa | Number of diatom taxa + soft-bodied algae taxa in Hybrid Algal Stream Condition Index |
| ASCI_H_OxyReD_DO_30.richness_pct_att | Percent of taxa attributed with oxygen tolerance value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_OxyReD_DO_30.richness_pred | Richness of algae species with 30% oxygen tolerance (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_OxyReD_DO_30.richness_raw | Richness of algae species with 30% oxygen tolerance (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_OxyReD_DO_30.richness_scr | Richness of algae species with 30% oxygen tolerance (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Planktonic_pct_att | Percent of taxa attributed with habitat value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Planktonic_pred | Proportion planktonic algae taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Planktonic_raw | Proportion planktonic algae taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Planktonic_scr | Proportion planktonic algae taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Trophic.E_pct_att | Percent of taxa attributed with trophic indicator value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Trophic.E_pred | Proportion eutrophic algae taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Trophic.E_raw | Proportion eutrophic algae taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Trophic.E_scr | Proportion eutrophic algae taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.ZHR_pct_att | Proportion of taxa attributed for the Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa metric for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.ZHR_raw | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (raw) |
| ASCI_H_prop.spp.ZHR_scr | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_Salinity.BF.richness_pct_att | Percent of taxa attributed with salinity value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_Salinity.BF.richness_pred | Richness of brackish/freshwater algae taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_Salinity.BF.richness_raw | Richness of brackish/freshwater algae taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_Salinity.BF.richness_scr | Richness of brackish/freshwater algae taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_S | Score for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_Biovolume | Total soft-bodied algae biovolume reported in the input data (i.e., sum of Result) |
| ASCI_S_EntityCount | Total number of soft-bodied algae entities reported in the input data (i.e., sum of BAResult) |
| ASCI_S_NumberTaxa | Number of soft-bodied algae taxa |
| ASCI_S_prop.spp.IndicatorClass_DOC_high_pct_att | Percent of taxa attributed with dissolved organic carbon indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_DOC_high_raw | Proportion high dissolved organic carbon indicator Algal species (raw) |
| ASCI_S_prop.spp.IndicatorClass_DOC_high_scr | Proportion high dissolved organic carbon indicator Algal species (score) for the Soft-bodied Agae Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_NonRef_pct_att | Percent of taxa attributed with reference/non-reference indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_NonRef_raw | Proportion non-reference indicator algae species (raw) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_NonRef_scr | Proportion non-reference indicator algae species (score) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_TP_high_pct_att | Percent of taxa attributed phosphorus indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_TP_high_raw | Proportion high total phosphorus indicator algae taxa (raw) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_TP_high_scr | Proportion high total phosphorus indicator Algal taxa (score) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.ZHR_pct_att | Proportion of taxa attributed for the Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa metric for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.ZHR_raw | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (raw) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.ZHR_scr | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (score) for the Soft-bodied Algal Stream Condition Index |
| Ash Free Dry Mass | Ash-Free Dry Mass (AFDM, AFDW) |
| Asphalt Fragment | Asphalt Fragment |
| Aspon | Aspon |
| AssemblageIDAlgaeSampleVolume | Volume of material and liquid to produce the soft algae assemblage (taxonomy) sample |
| AssemblageIDDiatomSampleVolume | Volume of material and liquid to produce the diatom assemblage (taxonomy) sample |
| Atenolol | Atenolol |
| Atenolol-d7(Surrogate) | Surrogate: Atenolol-d7 |
| Atorvastatin | Atorvastatin |
| Atraton | Atraton |
| Atrazine | Atrazine |
| Atrazine dealkylated | Atrazine dealkylated |
| Atrazine-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Atrazine-13C3 |
| Atrazine-13C3(Surrogate) | Surrogate: Atrazine-13C3 |
| Atrazine-d5(Surrogate) | Surrogate: Atrazine-d5 |
| Atrazine-Desisopropyl-2-Hydroxy | Atrazine-Desisopropyl-2-Hydroxy |
| ATVs Extent | ATVs Extent |
| ATVs Intensity | ATVs Intensity |
| ATVs Proximity | ATVs Proximity |
| Autopart | Autopart |
| Avoidance | Avoidance (%) |
| Azinphos Ethyl | Azinphos Ethyl |
| Azinphos Methyl | Azinphos Methyl (Guthion) |
| Azinphos Methyl oxon | Azinphos Methyl oxon |
| Azinphos Methyl(Surrogate) | Surrogate: Azinphos Methyl |
| Azinphos-methyl oxygen analog | Azinphos-methyl oxygen analog |
| Azinphos-Methyl-d6(IsoDilAnalogue) | Isotope Dilution Analogue: Azinphos-Methyl-d6 |
| Azithromycin | Azithromycin |
| Azobenzene | Azobenzene (Diphenyl Diimide) |
| Azoxystrobin | Azoxystrobin |
| Back Water | Back Water present |
| Backscatter | Backscatter - CTD casts |
| Bacteriophage MS2 | Bacteriophage MS2 |
| Bacteroidales, Avian (LeeSeaGull) | Avian Bacteroidales, Assay name: LeeSeaGull, 5’ AGGTGCTAATACCGCATAATACAGAG 3’, 5’ GCCGTTACCTCACCGTCTA 3’ |
| Bacteroidales, Canine (BacCan) | Canine Bacteroidales, Assay name: BacCan, 5' GGAGCGCAGACGGGTTTT 3', 5' CAATCGGAGTTCTTCGTGATATCTA 3' |
| Bacteroidales, Canine (DG3) | Canine Bacteroidales, Assay name: DG3, 5' TTTTCAGCCCCGTTGTTTCG 3' , 5' TGAGCGGGCATGGTCATATT 3' |
| Bacteroidales, Canine (DogBact) | Canine Bacteroidales, Assay Name: DogBact |
| Bacteroidales, Cow (BacCow) | Cow Bacteroidales, Assay name: BacCow, 5' CCAACYTTCCCGWTACTC 3', 5' GGACCGTGTCTCAGTTCCAGTG 3' |
| Bacteroidales, Cow (CowM2) | Cow Bacteroidales, Assay name: CowM2, 5' CGGCCAAATACTCCTGATCGT 3', 5' GCTTGTTGCGTTCCTTGAGATAAT 3' |
| Bacteroidales, Horse (HoF597F) | Horse Bacteroidales, Assay name: HoF597F, 5' CCAGCCGTAAAATAGTCGG 3', 5' CAATCGGAGTTCTTCGTG 3' |
| Bacteroidales, Human (BacH) | Human Bacteroidales Marker BacH |
| Bacteroidales, Human (HF183/BacR287) | Human Bacteroidales, Assay name: HF183/BacR287, 5'-ATCATGAGTTCACATGTCCG-3', 5'-CTTCCTCTCAGAACCCCTATCC-3' |
| Bacteroidales, Human (HF183/BFDrev) | Human Bacteroidales, Assay name: HF183/BFDrev, 5' ATCATGAGTTCACATGTCCG 3', 5' CGTAGGAGTTTGGACCGTGT 3' |
| Bacteroidales, Human (HF183TMCaMan) | Human Bacteroidales, Assay name: HF183TMCaMan, 5’ ATCATGAGTTCACATGTCCG 3’, 5’ CTTCCTCTCAGAACCCCTATCC 3’ |
| Bacteroidales, Human (HumM2) | Human Bacteroidales, Assay name: HumM2, 5'-CGTCAGGTTTGTTTCGGTATTG-3', 5'-TCATCACGTAACTTATTTATATGCATTAGC-3' |
| Bacteroidales, Porcine (Pig2Bac) | Porcine Bacteroidales, Assay name: Pig2Bac |
| Bacteroidales, Ruminant (Rum2Bac) | Ruminant Bacteroidales, Asssay name: Rum2Bac, 5' ACAGCCCGCGATTGATACTGGTAA 3', 5' CAATCGGAGTTCTTCGTGAT 3' |
| Bacteroidales, Universal (UniB) | Universal Bacteroidales, Assay name: UniB, 5' GGGGTTCTGAGAGGAAGGT 3', 5' CCGTCATCCTTCACGCTACT 3' |
| Bag, Large/Retail | Bag, Large/Retail |
| Bag, Pet Waste | Bag, Pet Waste |
| Bag, Single Use Plastic | Bag, Single Use Plastic |
| Bag, Takeout | Bag, Takeout |
| Bags/Packaging | Bags/Packaging |
| Balloon, Latex | Balloon, Latex |
| Balloon, Mylar | Balloon, Mylar |
| Bandage/Bandaid | Bandage/Bandaid |
| Bank Angle | Bank Angle |
| Bank Cover | Bank Cover |
| Bank Stability | Bank Stability (score zone 5m up and 5m downstream of transect between bankfull - wetted width) |
| Bankfull Height | Bankfull Height |
| Bankfull Width | Bankfull Width |
| Bankfull Width Reach | Visual estimate of the average bankfull width of the reach |
| Bar Present | Bar Present |
| Bar Width | Bar Width |
| Barban | Barban |
| Barban(Surrogate) | Surrogate: Barban |
| Barium | Barium |
| Barometric Pressure | Barometric Pressure |
| Batteries, Large | Batteries, Large |
| Batteries, Small | Batteries, Small |
| Battery Voltage | Battery Voltage |
| Bearing | Bearing |
| BeaufortScale | BeaufortScale |
| Beaver Flow Modifications | Beaver Flow Modifications |
| Beaver Signs | Beaver Signs |
| Bendiocarb | Bendiocarb |
| Bendroflumethiazide | Bendroflumethiazide |
| Benfluralin | Benfluralin |
| Benomyl | Benomyl |
| Benomyl/Carbendazim | Benomyl/Carbendazim |
| Bensulfuron Methyl | Bensulfuron Methyl |
| Bensulide | Bensulide |
| Bentazon | Bentazon |
| Benz(a)anthracene | Benz(a)anthracene |
| Benz(a)anthracene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benz(a)anthracene-d12 |
| Benz(a)anthracene-d12(Surrogate) | Surrogate: Benz(a)anthracene-d12 |
| Benz(a)anthracene-d12/Chrysene-d12(Surrogate) | Surrogate: Benz(a)anthracene-d12/Chrysene-d12 |
| Benz(a)anthracenes/Chrysenes, C1- | C1-Benz(a)anthracenes/Chrysenes |
| Benz(a)anthracenes/Chrysenes, C2- | C2-Benz(a)anthracenes/Chrysenes |
| Benz(a)anthracenes/Chrysenes, C3- | C3-Benz(a)anthracenes/Chrysenes |
| Benz(a)anthracenes/Chrysenes, C4- | C4-Benz(a)anthracenes/Chrysenes |
| Benz(e)pyrene-d12(Surrogate) | Surrogate: Benz(e)pyrene-d12 |
| Benzaldehyde | Benzaldehyde |
| Benzene | Benzene |
| Benzidine | Benzidine |
| Benzo [a] Pyrene equivalents | Benzo [a] Pyrene equivalents |
| Benzo(a)fluoranthene | Benzo(a)fluoranthene |
| Benzo(a)pyrene | Benzo(a)pyrene |
| Benzo(a)pyrene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benzo(a)pyrene-d12 |
| Benzo(a)pyrene-d12(Surrogate) | Surrogate: Benzo(a)pyrene-d12 |
| Benzo(b)fluoranthene | Benzo(b)fluoranthene |
| Benzo(b)fluoranthene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benzo(b)fluoranthene-d12 |
| Benzo(b)fluoranthene-d12(Surrogate) | Surrogate: Benzo(b)fluoranthene-d12 |
| Benzo(b)fluorene, 11H- | 11H-Benzo(b)fluorene |
| Benzo(b/j/k)fluoranthene | Benzo(b)fluoranthene/Benzo(j)fluoranthene/Benzo(k)fluoranthene |
| Benzo(b/j/k)fluoranthene-d12(Surrogate) | Surrogate: Benzo(b)fluoranthene-d12/Benzo(j)fluoranthene-d12/Benzo(k)fluoranthene-d12 |
| Benzo(b/k)fluoranthene-d12(Surrogate) | Surrogate: Benzo(b)fluoranthene-d12/Benzo(k)fluoranthene-d12 |
| Benzo(e)pyrene | Benzo(e)pyrene |
| Benzo(e)pyrene-d12(Surrogate) | Surrogate: Benzo(e)pyrene-d12 |
| Benzo(g,h,i)perylene | Benzo(g,h,i)perylene |
| Benzo(g,h,i)perylene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benzo(g,h,i)perylene-d12 |
| Benzo(g,h,i)perylene-d12(Surrogate) | Surrogate: Benzo(g,h,i)perylene-d12 |
| Benzo(j)fluoranthene | Benzo(j)fluoranthene |
| Benzo(j/k)fluoranthene | Benzo(j)fluoranthene/Benzo(k)fluoranthene |
| Benzo(j/k)fluoranthene-d12(Surrogate) | Surrogate: Benzo(j)fluoranthene-d12/Benzo(k)fluoranthene-d12 |
| Benzo(k)fluoranthene | Benzo(k)fluoranthene |
| Benzo(k)fluoranthene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benzo(k)fluoranthene-d12 |
| Benzo(k)fluoranthene-d12(Surrogate) | Surrogate: Benzo(k)fluoranthene-d12 |
| Benzobicyclon | Benzobicyclon pesticide |
| Benzofluoranthenes/Benzopyrenes, C1- | C1-Benzofluoranthenes/Benzopyrenes |
| Benzofluoranthenes/Benzopyrenes, C2- | C2-Benzofluoranthenes/Benzopyrenes |
| Benzoic Acid | Benzoic Acid |
| Benzophenone | Benzophenone |
| Benzothiazole, 2-(4-Morpholinyl) | 2-(4-Morpholinyl)Benzothiazole (2,4-MoBT) |
| Benzothiazolone | Benzothiazolone (2-Benzothiazolinone) (2-Hydroxy-Benzothiazole) |
| Benzothiophene | Benzothiophene |
| Benzothiophene, C1- | C1-Benzothiophene |
| Benzothiophene, C2- | C2-Benzothiophene |
| Benzothiophene, C3- | C3-Benzothiophene |
| Benzotriazole, 1H | 1H-Benzotriazole |
| Benzovindiflupyr | Benzovindiflupyr |
| Benzoylecgonine | Benzoylecgonine |
| Benzoylecgonine-d8(Surrogate) | Surrogate: Benzoylecgonine-d8 |
| Benztropine | Benztropine |
| Benztropine-d3(Surrogate) | Surrogate: Benztropine-d3 |
| Benzyl Alcohol | Benzyl Alcohol |
| Beryllium | Beryllium |
| Betamethasone | Betamethasone |
| Bezafibrate | Bezafibrate |
| Bicarbonate | Bicarbonate |
| Bicarbonate Alkalinity as CaCO3 | Bicarbonate Alkalinity as CaCO3 |
| Bifenox | Bifenox |
| Bifenthrin | Bifenthrin |
| Bifenthrin, Total(Surrogate) | Surrogate: Total Bifenthrin |
| Bifenthrin-d5(Surrogate) | Surrogate: Bifenthrin-d5 ((rac-cis)-Z-Bifenthrin-d5) |
| Bifenthrin-d6(Surrogate) | Surrogate: Bifenthrin-d6 |
| Biodegradable | Biodegradeable using Trash Protocol |
| Biodegradable, Other | Biodegradable, Other |
| Biohazard | Biohazard using Trash Protocol |
| Bioluminescence (EC50) | Bioluminescence (EC50) |
| Biomass (wt/orig indiv) | Biomass (weight/original individual) |
| BiomassSampleVolume | Volume of material and liquid filtered to produce the biomass (Ash Free Dry Mass-AFDM) sample |
| Biphenyl | Biphenyl |
| Biphenyl-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Biphenyl-d10 |
| Biphenyl-d10(Surrogate) | Surrogate: Biphenyl-d10 |
| Biphenyls, C1- | C1-Biphenyls |
| Biphenyls, C2- | C2-Biphenyls |
| Bis(1,3-dichloro-2-propyl) phosphate | Bis(1,3-dichloro-2-propyl) phosphate (BDCPP) |
| Bis(1H,1H,2H,2H-Perfluorodecyl) Phosphate-13C4(IsoDilAnalogue) | Isotope Dilution Analogue: Bis(1H,1H,2H,2H-Perfluorodecyl) Phosphate-13C4 (8:2 diPAP-13C4) |
| Bis(1H,1H,2H,2H-perfluorodecyl)phosphate | Bis(1H,1H,2H,2H-perfluorodecyl)phosphate (8:2 diPAP) |
| Bis(1H,1H,2H,2H-perfluorodecyl)phosphate-13C4(Surrogate) | Surrogate: Bis(1H,1H,2H,2H-perfluorodecyl)phosphate-13C4 |
| Bis(1H,1H,2H,2H-Perfluorooctyl) Phosphate-13C4(IsoDilAnalogue) | Isotope Dilution Analogue: Bis(1H,1H,2H,2H-Perfluorooctyl) Phosphate-13C4 (6:2 diPAP-13C4) |
| Bis(1H,1H,2H,2H-perfluorooctyl)phosphate | Bis(1H,1H,2H,2H-perfluorooctyl)phosphate (6:2 diPAP) |
| Bis(1H,1H,2H,2H-perfluorooctyl)phosphate-13C4(Surrogate) | Surrogate: Bis(1H,1H,2H,2H-perfluorooctyl)phosphate-13C4 |
| Bis(2,4,6-tribromophenoxy)ethane-1,2 | 1,2-bis(2,4,6-tribromophenoxy)ethane (BTBPE) |
| Bis(2,4,6-tribromophenoxy)ethane-1,2-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2-bis(2,4,6-tribromophenoxy)ethane-13C12 (BTBPE-13C12) |
| Bis(2,4-Diisopropylphenyl) Phenyl Phosphate | Bis(2,4-Diisopropylphenyl) Phenyl Phosphate (B24DiPPP) |
| Bis(2-chloro-1-methylethyl) ether | Bis(2-chloro-1-methylethyl) ether |
| Bis(2-chloroethoxy)methane | Bis(2-chloroethoxy)methane |
| Bis(2-chloroethyl) phosphate | Bis(2-chloroethyl) phosphate (BCEP) |
| Bis(2-chloroethyl)ether | Bis(2-chloroethyl)ether |
| Bis(2-chloroisopropyl) ether | Bis(2-chloroisopropyl) ether |
| Bis(2-chloroisopropyl) phosphate | Bis(2-chloroisopropyl) phosphate (BCPP) |
| Bis(2-ethly-1-hexyl)tetrabromophthalate | Bis(2-ethly-1-hexyl)tetrabromophthalate (BEHTBP) |
| Bis(2-ethylhexyl)adipate | Bis(2-ethylhexyl)adipate |
| Bis(2-ethylhexyl)phthalate | Bis(2-ethylhexyl)phthalate |
| Bis(2-ethylhexyl)phthalate-d4(Surrogate) | Surrogate: Bis(2-ethylhexyl)phthalate-d4 |
| Bis(2-ethylhexyl)tetrabromophthalate | Bis(2-ethylhexyl)tetrabromophthalate |
| Bis(2-Isopropylphenyl) Phenyl Phosphate | Bis(2-Isopropylphenyl) Phenyl Phosphate (B2IPPP) |
| Bis(2-tert-Butylphenyl) Phenyl Phosphate | Bis(2-tert-Butylphenyl) Phenyl Phosphate (B2tBPPP) |
| Bis(4-Isopropylphenyl) Phenyl Phosphate | Bis(4-Isopropylphenyl) Phenyl Phosphate (B4IPPP) |
| Bis(4-tert-Butylphenyl) Phenyl Phosphate | Bis(4-tert-Butylphenyl) Phenyl Phosphate (B4tBPPP) |
| Bis(alpha,alpha-Dimethylbenzyl)Diphenylamine, 4,4- | 4,4-Bis(alpha,alpha-Dimethylbenzyl)Diphenylamine (SDPA-diAMS) |
| Bis(chloromethyl) Ether | Bis(chloromethyl) Ether (Dichlorodimethyl Ether) |
| Bis(Chloromethyl)Propane-1,3-Diyltetrakis(2-Chloroethyl) Bisphosphate-d16, 2,2-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,2-bis(Chloromethyl)Propane-1,3-Diyltetrakis(2-Chloroethyl) Bisphosphate-d16 (V6-d16) |
| Bis(perfluorohexyl)phosphinate | Bis(perfluorohexyl)phosphinate (6:6 PFPi) |
| Bis(perfluorohexyl)phosphinate-d5(Surrogate) | Surrogate: Bis(perfluorohexyl)phosphinate-d5 |
| Bis(perfluorooctyl)phosphinate | Bis(perfluorooctyl)phosphinate (8:8 PFPi) |
| Bis(perfluorooctyl)phosphinate-d3(Surrogate) | Surrogate: Bis(perfluorooctyl)phosphinate-d3 |
| Bismuth | Bismuth |
| Bisphenol A | Bisphenol A |
| Bisphenol A bis(diphenyl phosphate) | Bisphenol A bis(diphenyl phosphate) |
| Bisphenol A diglycidyl ether | Bisphenol A diglycidyl ether (BPA-DGE) |
| Bisphenol A-13C12(Surrogate) | Surrogate: Bisphenol A-13C12 |
| Bisphenol A-d14(Surrogate) | Surrogate: Bisphenol A-d14 |
| Bisphenol A-d16(IsoDilAnalogue) | Isotope Dilution Analogue: Bisphenol A-d16 |
| Bisphenol A-d6(Surrogate) | Surrogate: Bisphenol A-d6 |
| Bisphenol AF | Bisphenol AF |
| Bisphenol AF-13C12(Surrogate) | Surrogate: Bisphenol AF-13C12 |
| Bisphenol AP | Bisphenol AP |
| Bisphenol B | Bisphenol B |
| Bisphenol B-13C12(Surrogate) | Surrogate: Bisphenol B-13C12 |
| Bisphenol BP | Bisphenol BP |
| Bisphenol C | Bisphenol C |
| Bisphenol C-dichloride | Bisphenol C-dichloride |
| Bisphenol E | Bisphenol E |
| Bisphenol F | Bisphenol F |
| Bisphenol F-13C12(Surrogate) | Surrogate: Bisphenol F-13C12 |
| Bisphenol G | Bisphenol G |
| Bisphenol M | Bisphenol M |
| Bisphenol P | Bisphenol P |
| Bisphenol PH | Bisphenol PH |
| Bisphenol S | Bisphenol S |
| Bisphenol S-13C12(Surrogate) | Surrogate: Bisphenol S-13C12 |
| Bisphenol TMC | Bisphenol TMC |
| Bisphenol Z | Bisphenol Z |
| Bispyribac Sodium | Bispyribac Sodium |
| Bivalve CI Mean | Bivalve Condition Index Mean |
| Bivalve CI SE | Bivalve Condition Index Standard Error |
| Blue-Green Algae Phycocyanin | Blue-Green Algae Phycocyanin (BGA-PC) |
| BOD | Biochemical Oxygen Demand (BOD) - 5 day test |
| BOD10day | Biochemical Oxygen Demand (BOD) - 10 day test |
| Bolstar | Bolstar (Sulprofos) |
| Boron | Boron |
| Boscalid | Boscalid |
| Boscalid-5-hydroxy | 5-Hydroxy-Boscalid |
| Bottle Cap, Metal | Bottle Cap, Metal |
| Bottle Cap, Plastic | Bottle Cap, Plastic |
| Bottle, Beach | Bottle, Beach |
| Bottle, Cleaning | Bottle, Cleaning |
| Bottle, Glass | Bottle, Glass |
| Bottle, Plastic | Bottle, Plastic Beverage |
| Bottle, Shampoo | Bottle, Shampoo |
| Bottle, Soda | Bottle, Soda |
| Bottle, Sport | Bottle, Sport |
| Bottle, Water | Bottle, Water |
| Boulder | Boulder |
| BRI | Score for the Benthic Response Index (BRI) |
| Brick | Brick |
| Bridge | Bridge |
| Bridge Fence | Bridge Fence |
| Bridge Fence Height | Bridge Fence Height |
| Bridges, Culverts | Bridges, Culverts |
| Broflanilide | Broflanilide |
| Bromacil | Bromacil |
| Bromate | Bromate |
| Bromide | Bromide |
| Bromo-2-Nitrobenzene, 1- | 1-Bromo-2-Nitrobenzene |
| Bromo-2-Nitrobenzene, 1-(Surrogate) | Surrogate: 1-Bromo-2-Nitrobenzene |
| Bromo-3,5-dimethylphenyl-N-methylcarbamate, 4-(Surrogate) | Surrogate: 4-Bromo-3,5-dimethylphenyl-N-methylcarbamate (BDMC) |
| Bromoacetic Acid | Bromoacetic Acid (Monobromoacetic Acid)(MBAA) |
| Bromobenzene | Bromobenzene (Phenyl Bromide) |
| Bromochloromethane | Bromochloromethane |
| Bromodichloromethane | Bromodichloromethane (Dichlorobromomethane) |
| Bromofluorobenzene, 4- | 4-Bromofluorobenzene |
| Bromofluorobenzene, 4-(Surrogate) | Surrogate: 4-Bromofluorobenzene |
| Bromoform | Bromoform (Tribromomethane) |
| Bromomethane | Bromomethane (Methyl Bromide) |
| Bromophenyl Phenyl Ether, 4- | 4-Bromophenyl Phenyl Ether |
| Bromophenyl Phenyl Ether, 4-(Surrogate) | Surrogate: 4-Bromophenyl Phenyl Ether |
| Bromuconazole | Bromuconazole (Bromoconazole) |
| Bufencarb | Bufencarb |
| Bulk Density | Bulk Density |
| Bumetrizole | Bumetrizole (UV-326) (2-tert-butyl-6-(5-Chloro-2H-1,2,3-Benzotriazol-2-yl)-4-Methylphenol) |
| Burial | Burial |
| Burns Extent | Burns Extent |
| Burns Intensity | Burns Intensity |
| Burns Proximity | Burns Proximity |
| Butachlor | Butachlor |
| Butalbital | Butalbital |
| Butanone, 2- | 2-Butanone (Methyl Ethyl Ketone) |
| Butralin | Butralin |
| Butyl Benzyl Phthalate | Butyl Benzyl Phthalate |
| Butyl Benzyl Phthalate-d4(Surrogate) | Surrogate: Butyl Benzyl Phthalate-d4 |
| Butylate | Butylate |
| Butylbenzene, n- | n-Butylbenzene |
| Butylbenzene, sec- | sec-Butylbenzene |
| Butylbenzene, tert- | tert-Butylbenzene |
| Butylhydroxytoluene-d21(Surrogate) | Surrogate: Butylhydroxytoluene-d21 (BHT-d21) |
| Butylparaben | Butylparaben |
| Butylphenyl Diphenyl Phosphate, 2-tert- | 2-tert-Butylphenyl Diphenyl Phosphate (2TBPDPP) |
| Butylphenyl Diphenyl Phosphate, p-tert- | p-tert-Butylphenyl Diphenyl Phosphate (4-tert-Butylphenyl Diphenyl Phosphate) (4tBPDPP) |
| Butylphenyl Diphenyl Phosphate-d10, p-tert-(IsoDilAnalogue) | Isotope Dilution Analogue: p-tert-Butylphenyl Diphenyl Phosphate-d10 (4-tert-Butylphenyl Diphenyl Phosphate-d10) (4tBPDPP-d10) |
| Butyltin as Sn | Butyltin as Sn |
| C. coli | |
| C. jejuni | |
| CA_LRM | Score for the California Logistic Regression Model (CA LRM) |
| Cadmium | Cadmium |
| Caffeine | Caffeine |
| Caffeine-13C3(Surrogate) | Surrogate: Caffeine-13C3 |
| CAFOs Extent | CAFOs Extent |
| CAFOs Intensity | CAFOs Intensity |
| CAFOs Proximity | CAFOs Proximity |
| Calcium | Calcium |
| Calcium bis(methylarsonate) | Calcium bis(methylarsonate) |
| Calcium Bound Phosphorus | Calcium Bound Phosphorus |
| Camphor | Camphor |
| Campylobacter | Campylobacter |
| Canopy Cover | Canopy Cover |
| Caprolactam | Caprolactam (Azepan-2-one) |
| Captafol | Captafol |
| Captan | Captan |
| Carbadox | Carbadox |
| Carbamazepine | Carbamazepine |
| Carbamazepine(Surrogate) | Surrogate: Carbamazepine |
| Carbamazepine-d10(Surrogate) | Surrogate: Carbamazepine-d10 |
| Carbaryl | Carbaryl |
| Carbaryl-D7(Surrogate) | Surrogate: Carbaryl-D7 |
| Carbazole | Carbazole |
| Carbazole(Surrogate) | Surrogate: Carbazole |
| Carbendazim | Carbendazim |
| Carbofuran | Carbofuran |
| Carbofuran Phenol | Carbofuran Phenol |
| Carbon Dioxide, Daily Mean | Daily Mean Carbon Dioxide (Calculated) |
| Carbon dioxide, free | Carbon dioxide, free |
| Carbon Dioxide, total | Carbon Dioxide, total |
| Carbon Disulfide | Carbon Disulfide |
| Carbon Tetrachloride | Carbon Tetrachloride |
| Carbon, Total | Total Carbon |
| Carbon-13 | Carbon-13 |
| Carbon-13/Carbon-12 Ratio | Carbon-13/Carbon-12 Ratio |
| Carbon-14 | Carbon-14 |
| Carbon-14 Counting Error | Carbon-14 Counting Error |
| Carbonate | Carbonate |
| Carbonate Alkalinity as CaCO3 | Carbonate Alkalinity as CaCO3 |
| Carbophenothion | Carbophenothion (Trithion) |
| Carbophenothion-Methyl | Carbophenothion-Methyl |
| Carboxin | Carboxin (6-methyl-N-phenyl-2,3-dihydro-1,4-oxathiine-5-carboxamide) |
| Carfentrazone Ethyl | Carfentrazone Ethyl |
| Carisoprodol | Carisoprodol |
| Cascade/Falls | Cascade/Falls |
| Catellicoccus, Gull (Gull2) | Gull Catellicoccus marimammalium, Assay name: Gull2, 5'-TGCATCGACCTAAAGTTTTGAG-3', 5'-GTCAAAGAGCGAGCAGTTACTA-3' |
| Cattle Grazing Intensity | Cattle Grazing Intensity |
| Cattle GrazingExtent | Cattle GrazingExtent |
| Cattle GrazingProximity | Cattle GrazingProximity |
| CBOD5 | Carbonaceous Biological Oxygen Demand (CBOD) - 5 day test |
| CD/DVD | CD/DVD |
| CDOM | Colored Dissolved Organic Matter |
| Cefotaxime | Cefotaxime |
| Celestolide | Celestolide |
| Cellulose Acetate Fiber | Cellulose acetate Fiber |
| Cellulose Acetate Fiber Bundle | Cellulose acetate Fiber Bundle |
| Cellulose Acetate Film | Cellulose acetate Film |
| Cellulose Acetate Fragment | Cellulose acetate Fragment |
| Cellulose Acetate Sphere | Cellulose acetate Sphere |
| Cellulosic Fiber | Cellulosic Fiber |
| Cellulosic Fiber Bundle | Cellulosic Fiber Bundle |
| Cellulosic Film | Cellulosic Film |
| Cellulosic Foam | Cellulosic Foam |
| Cellulosic Fragment | Cellulosic Fragment |
| Ceramic Pot/Shard | Ceramic Pot/Shard |
| Cerium | Cerium |
| Cesium | Cesium |
| Cetirizine | Cetirizine |
| Chamber biomass | Chamber biomass |
| Channel Constraining Feature | Channel Constraining Feature |
| Channel Constraint | Channel Constraint |
| Channel Engineered | Channel has been modified/engineered |
| Channel Grasses | Channel Grasses |
| Channel Margin in Contact | Channel Margin in Contact |
| Channel NonWoody Veg | Channel NonWoody Veg |
| Channel Pattern | Channel Pattern |
| Channel Unit | Channel Unit |
| Channel Width Reach | Channel width used to define reach |
| Channel Woody Veg | Channel Woody Veg |
| Channelization | Channelization |
| Chemical Concentration | Chemical Concentration |
| Chemical Group A | Total of (Aldrin,Dieldrin,Endrin,Heptachlor,Heptachlor Epoxide,Chlorine,HCH, Endosulfan,Toxaphene) |
| Chemical Group B | Total of (1,2-Dichloropropane, 1,3-Dichloropropene and related C3 Compounds) |
| Chemical Treatment | Chemical Treatment |
| Chicken/Duck, Mitochondrial DNA (cytb) | Chicken/Duck Mitochondrial DNA, Target gene: Cytochrome b, 5′-AAATCCCACCCCCTACTAAAAATAAT-3′, 5′-CAGATGAAGAAGAATGAGGCG-3′, 5′-FAM-ACAACTCCCTAATCGACCT-NFQ-MGB-3′ |
| Chloramben | Chloramben |
| Chloramben, ammonium salt | Chloramben, ammonium salt |
| Chloramphenicol | Chloramphenicol |
| Chlorantraniliprole | Chlorantraniliprole |
| Chlorate | Chlorate |
| Chlorbenside | Chlorbenside |
| Chlordane | Chlordane, not otherwise specified |
| Chlordane, cis- | cis-Chlordane (alpha-Chlordane) |
| Chlordane, cis-(Surrogate) | Surrogate: cis-Chlordane (alpha-Chlordane) |
| Chlordane, Technical | Chlordane, mixture of many related chemicals, of which 10 are major components |
| Chlordane, Total | Total Chlordane, sum of cis-chlordane and trans-chlordane |
| Chlordane, trans- | trans-Chlordane (gamma-Chlordane) |
| Chlordane, trans-(Surrogate) | Surrogate: trans-Chlordane (gamma-Chlordane) |
| Chlordane-13C10, trans-(IsoDilAnalogue) | Isotope Dilution Analogue: trans-Chlordane-13C10 (gamma-Chlordane) |
| Chlordene | Chlordene |
| Chlordene Plus | Chlordene Plus (CP) |
| Chlordene, cis- | cis-Chlordene (alpha-Chlordene) |
| Chlordene, trans- | trans-Chlordene (gamma-Chlordene) |
| Chlorfenac | Chlorfenac (Fenac) |
| Chlorfenapyr | Chlorfenapyr |
| Chlorfenvinphos | Chlorfenvinphos |
| Chloride | Chloride |
| Chlorimuron Ethyl | Chlorimuron Ethyl |
| Chlorine, Free | Free Chlorine |
| Chlorine, Total Residual | Total Residual Chlorine |
| Chlorite | Chlorite |
| Chlormefos | Chlormefos |
| Chloro-2-methylphenol, 4- | 4-Chloro-2-methylphenol |
| Chloro-2-methylphenoxy) Butanoic Acid Sodium Salt, 4-(4- | 4-(4-Chloro-2-methylphenoxy) Butanoic Acid sodium salt (MCPB, sodium salt) |
| Chloro-2-methylphenoxy) Butanoic Acid, 4-(4- | 4-(4-Chloro-2-methylphenoxy) Butanoic Acid (MCPB) |
| Chloro-3-methylphenol, 4- | 4-Chloro-3-methylphenol |
| Chloro-3-methylphenol, 4-(Surrogate) | Surrogate: 4-Chloro-3-methylphenol |
| Chloro-4-isopropylamine-6-amino-s-triazine, 2- | 2-Chloro-4-isopropylamine-6-amino-s-triazine (CIAT) |
| Chloroacetic Acid | Chloroacetic Acid (Monochloracetic Acid)(MCAA) |
| Chloroallyl alcohol, total | Total Chloroallyl alcohol |
| Chloroaniline, 4- | 4-Chloroaniline |
| Chlorobenzene | Chlorobenzene |
| Chlorobenzene-d5(Surrogate) | Surrogate: Chlorobenzene-d5 |
| Chlorobenzilate | Chlorobenzilate |
| Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid, 11- | 11-Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid (11Cl-PF3OUdS) |
| Chloroethane | Chlorethane (Ethyl Chloride) |
| Chloroethyl Vinyl Ether, 2 | 2-Chloroethyl Vinyl Ether |
| Chloroethyl Vinyl Ether, 2- | 2-Chloroethyl Vinyl Ether |
| Chloroethyl Vinyl Ether, 2-(Surrogate) | Surrogate: 2-Chloroethyl Vinyl Ether |
| Chloroform | Chloroform |
| Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid, 9- | 9-Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid (9Cl-PF3ONS) |
| Chloromethane | Chloromethane (Methyl Chloride) |
| Chloro-N-(2,6-diethylphenyl) acetamide, 2- | 2-chloro-N-(2,6-diethylphenyl) acetamide |
| Chloro-N-(ethoxymethyl)-N-(2-ethyl-6-methylphenyl)acetamide, 2- | 2-Chloro-N-(ethoxymethyl)-N-(2-ethyl-6-methylphenyl)acetamide (Acetochlor) |
| Chloronaphthalene, 2- | 2-Chloronaphthalene |
| Chloronaphthalene, 2-(Surrogate) | Surrogate: 2-Chloronaphthalene |
| Chloroneb | Chloroneb |
| Chloroneb(Surrogate) | Surrogate: Chloroneb |
| Chloronicotinic acid, 6- | 6-Chloronicotinic acid |
| Chlorophenol, 2- | 2-Chlorophenol |
| Chlorophenol, 2-(Surrogate) | Surrogate: 2-Chlorophenol |
| Chlorophenol-d4, 2- (Surrogate) | 2-Chlorophenol-d4 (Surrogate) |
| Chlorophenyl Phenyl Ether, 4- | 4-Chlorophenyl Phenyl Ether |
| Chlorophenyl Phenyl Ether, 4-(Surrogate) | Surrogate: 4-Chlorophenyl Phenyl Ether |
| Chlorophenyl)-N'-methylurea, N-(4- | N-(4-Chlorophenyl)-N'-methylurea |
| Chlorophyll a | Chlorophyll a |
| Chlorophyll a & b | Chlorophyll a & b |
| Chlorophyll b | Chlorophyll b |
| Chlorophyll c | Chlorophyll c |
| Chlorophyll, Total | Total Chlorophyll |
| ChlorophyllSampleVolume | Volume of material and liquid filtered to produce the chlorophyll a sample |
| Chloropicrin | Chloropicrin |
| Chloroprene | Chloroprene (Chlorobutadiene) |
| Chloropropylate | Chloropropylate |
| Chloro-p-toluidine hydrochloride, 3- | 3-chloro-p-toluidine hydrochloride |
| Chlorothalonil | Chlorothalonil |
| Chlorotoluene, 2- | 2-Chlorotoluene |
| Chlorotoluene, 4- | 4-Chlorotoluene |
| Chlorotoluron | Chlorotoluron |
| Chloroxuron | Chloroxuron (Chloroxyfenidim) (Norex) |
| Chloroxuron(Surrogate) | Surrogate: Chloroxuron (Chloroxyfenidim) (Norex) |
| Chlorpropham | Chlorpropham |
| Chlorpyrifos | Chlorpyrifos |
| Chlorpyrifos Methyl | Chlorpyrifos Methyl |
| Chlorpyrifos Methyl(Surrogate) | Surrogate: Chlorpyrifos Methyl |
| Chlorpyrifos Methyl/Fenchlorphos | Chlorpyrifos Methyl/Fenchlorphos |
| Chlorpyrifos Oxon | Chlorpyrifos Oxon |
| Chlorpyrifos(Surrogate) | Surrogate: Chlorpyrifos |
| Chlorsulfuron | Chlorsulfuron |
| Chlortetracycline | Chlortetracycline |
| Chlorthal-Dimethyl, Total | Total Chlorthal-Dimethyl |
| Chlorzoxazone | Chlorzoxazone |
| Cholesterol | Cholesterol |
| Chromium | Chromium |
| Chromium III | Chromium III (Trivalent Chromium) |
| Chromium VI | Chromium VI |
| Chrysene | Chrysene |
| Chrysene/Triphenylene | Chrysene/Triphenylene (CAS #EDF-359) |
| Chrysene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Chrysene-d12 |
| Chrysene-d12(Surrogate) | Surrogate: Chrysene-d12 |
| Chrysenes, C1- | C1-Chrysenes |
| Chrysenes, C2- | C2-Chrysenes |
| Chrysenes, C3- | C3-Chrysenes |
| Chrysenes, C4- | C4-Chrysenes |
| Cigarette Box/Wrapper | Cigarette Box/Wrapper |
| Cigarette Butt | Cigarette Butt |
| Cimetidine | Cimetidine |
| Cimetidine-d3(Surrogate) | Surrogate: Cimetidine-d3 |
| Cinerin-1 | Cinerin-1 |
| Cinerin-2 | Cinerin-2 (Cinerin II) |
| Ciodrin | Ciodrin (Crotoxyphos) |
| Ciprofloxacin | Ciprofloxacin |
| Ciprofloxacin-13C3-N15(Surrogate) | Surrogate: Ciprofloxacin-13C3-N15 |
| Circumference | Circumference |
| Clarithromycin | Clarithromycin |
| Clay | Clay |
| Clinafloxacin | Clinafloxacin |
| Clofibric acid | Clofibric acid |
| Clomazone | Clomazone (Dimethazone) |
| Clonidine | Clonidine |
| Clonidine-d4(Surrogate) | Surrogate: Clonidine-d4 |
| Clostridiales, Human (LACHNO3) | Human Clostridiales, Assay Name: LACHNO3 |
| Clothianidin | Clothianidin |
| Clothianidin-d3(Surrogate) | Surrogate: Clothianidin-d3 |
| Clothianidin-Desmethyl | Clothianidin-Desmethyl |
| Clothing, synthetic fabric | Clothing, synthetic fabric |
| CloudCover | Cloud cover at the time of sampling |
| Cloxacillin | Cloxacillin |
| Cobalt | Cobalt |
| Cobble | Cobble |
| Cocaine | Cocaine |
| Cocaine-d3(Surrogate) | Surrogate: Cocaine-d3 |
| Cocoons | Cocoons (#) |
| COD | Chemical Oxygen Demand (COD) |
| Codeine | Codeine |
| Codeine-d6(Surrogate) | Surrogate: Codeine-d6 |
| Coliform Ratio | The ratio of fecal/total coliform bacteria exceeds 0.1 and the total coliform bacteria exceeds 1000 |
| Coliform, Fecal | Fecal Coliform |
| Coliform, Total | Total Coliform |
| CollectionDepth | Depth at which sample was collected |
| Colloid | Colloid |
| CollSub_PlantDead | Algae collected from dead plant (including wood) substratum |
| CollSub_PlantLive | Algae collected from live plant (including wood) substratum |
| CollSub_Rock | Algae collected from rock (including concrete and consolidated sediment) substratum |
| CollSub_SedSoft | Algae collected from soft sediment substratum |
| Color | Color |
| Color, True | Color of water from which turbidity has been removed |
| Commercial | Commercial |
| CompositeVolume | Volume of material and liquid in Composite sample |
| Composition | Composition |
| Computer | Computer |
| Concrete/Asphalt | Concrete/Asphalt |
| Condom | Condom |
| Construction | Construction |
| Construction Debris | Construction debris such as brick, wood, sheetrock using Trash Protocol |
| Construction Other | Construction Other |
| Construction Wood/Pellets | Construction Wood/Pellets |
| Container, Chemical | Container, Chemical |
| Container, Juice | Container, Juice |
| Container, Plastic | Container, Plastic |
| Container, Storage | Container, Storage |
| Container, Styrofoam | Container, Styrofoam |
| Copper | Copper |
| Coprostanol, beta-3- | 3-beta-Coprostanol |
| Coronene | Coronene |
| Cotinine | Cotinine |
| Cotinine-d3(Surrogate) | Surrogate: Cotinine-d3 |
| Cotton fiber | When cotton is obviously the top hit and cellulose is several hits down. Then we can say it is specifically Cotton. For DYED or CLEAR anthropogenic cotton only and should just be called cotton. |
| Cotton Fiber Bundle | Cotton Fiber Bundle |
| Cotton Film | Cotton Film |
| Cotton Foam | Cotton Foam |
| Cotton Fragment | Cotton Fragment |
| Coumaphos | Coumaphos |
| CPOM | Coarse particulate organic matter |
| Cresyl Diphenyl Phosphate | Cresyl Diphenyl Phosphate |
| Cropland | Cropland |
| Crops Irrigated Extent | Crops Irrigated Extent |
| Crops Irrigated Intensity | Crops Irrigated Intensity |
| Crops Irrigated Proximity | Crops Irrigated Proximity |
| Crops NonIrrigated Extent | Crops NonIrrigated Extent |
| Crops NonIrrigated Intensity | Crops NonIrrigated Intensity |
| Crops NonIrrigated Proximity | Crops NonIrrigated Proximity |
| Crutomate | Crutomate |
| Cryptosporidium | Cryptosporidium |
| Cryptosporidium Oocysts Fluorescence | Cryptosporidium Oocysts Fluorescence |
| Cryptosporidium Oocysts/Amorphous Structure | Cryptosporidium Oocysts/Amorphous Structure |
| Cryptosporidium Oocysts/DAPI & DIC Positive | Cryptosporidium Oocysts/DAPI & DIC Positive |
| Cryptosporidium Oocysts/Empty | Cryptosporidium Oocysts/Empty |
| Cryptosporidium Oocysts/Flourescence Antibody | Cryptosporidium Oocysts/Flourescence Antibody |
| Cryptosporidium Oocysts/Internal Structure | Cryptosporidium Oocysts/Internal Structure |
| Cryptosporidium Oocysts/Internal Structure (One) | Cryptosporidium Oocysts/Internal Structure (One) |
| Cryptosporidium Oocysts/Negative | Cryptosporidium Oocysts/Negative |
| Cryptosporidium Oocysts/Positive | Cryptosporidium Oocysts/Positive |
| Cryptosporidium Oocysts/Positive (Internal Staining) | Cryptosporidium Oocysts/Positive (Internal Staining) |
| Cryptosporidium Oocysts/Positive (Stained Nuclei) | Cryptosporidium Oocysts/Positive (Stained Nuclei) |
| Cryptosporidium Oocysts/Total IFA Count | Cryptosporidium Oocysts/Total IFA Count |
| CSCI | California Stream Condition Index score, calculated as the average of the O/E and pMMI |
| CSCI_CaptureProb_Abedus | Probability of capturing Abedus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Acari | Probability of capturing Acari calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Acentrella | Probability of capturing Acentrella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Acneus | Probability of capturing Acneus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Aeshna_Rhionaeshna | Probability of capturing Aeshna or Rhionaeshna calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Agabinus | Probability of capturing Agabinus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Agabus | Probability of capturing Agabus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Agapetus | Probability of capturing Agapetus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Allocosmoecus | Probability of capturing Allocosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ambrysus | Probability of capturing Ambrysus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ameletus | Probability of capturing Ameletus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ametor | Probability of capturing Ametor calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Amiocentrus | Probability of capturing Amiocentrus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Amphicosmoecus | Probability of capturing Amphicosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ampumixis | Probability of capturing Ampumixis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Anacaena | Probability of capturing Anacaena calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Anagapetus | Probability of capturing Anagapetus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Anax | Probability of capturing Anax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Anchycteis | Probability of capturing Anchycteis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Antocha | Probability of capturing Antocha calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Apatania | Probability of capturing Apatania calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Archilestes | Probability of capturing Archilestes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Arctopsyche | Probability of capturing Arctopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Argia | Probability of capturing Argia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Asellidae | Probability of capturing Asellidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Asioplax | Probability of capturing Asioplax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Astacidae | Probability of capturing Astacidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Atherix | Probability of capturing Atherix calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Atractelmis | Probability of capturing Atractelmis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Atrichopogon | Probability of capturing Atrichopogon calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Attenella | Probability of capturing Attenella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Baetis | Probability of capturing Baetis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Berosus | Probability of capturing Berosus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Bezzia_Palpomyia | Probability of capturing Bezzia or Palpomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Blephariceridae | Probability of capturing Blephariceridae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Brachycentrus | Probability of capturing Brachycentrus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Brechmorhoga | Probability of capturing Brechmorhoga calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Caenis | Probability of capturing Caenis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Calineuria | Probability of capturing Calineuria calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Callibaetis | Probability of capturing Callibaetis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Callicorixa | Probability of capturing Callicorixa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Calliperla | Probability of capturing Calliperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Caloparyphus_Euparyphus | Probability of capturing Caloparyphus or Euparyphus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Calopterygidae | Probability of capturing Calopterygidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Camelobaetidius | Probability of capturing Camelobaetidius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Capniidae | Probability of capturing Capniidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Caudatella | Probability of capturing Caudatella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Centroptilum | Probability of capturing Centroptilum calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ceraclea | Probability of capturing Ceraclea calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ceratopogon | Probability of capturing Ceratopogon calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ceratopsyche_Hydropsyche | Probability of capturing Ceratopsyche or Hydropsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Chelifera_Metachela | Probability of capturing Chelifera or Metachela calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cheumatopsyche | Probability of capturing Cheumatopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Chimarra | Probability of capturing Chimarra calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Chironominae | Probability of capturing Chironominae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Choroterpes | Probability of capturing Choroterpes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Chrysops | Probability of capturing Chrysops calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Chyranda | Probability of capturing Chyranda calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cinygma | Probability of capturing Cinygma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cinygmula | Probability of capturing Cinygmula calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Claassenia | Probability of capturing Claassenia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cleptelmis | Probability of capturing Cleptelmis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Clinocera | Probability of capturing Clinocera calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cloeodes | Probability of capturing Cloeodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Clostoeca | Probability of capturing Clostoeca calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cordulegaster | Probability of capturing Cordulegaster calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Corduliidae | Probability of capturing Corduliidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Corydalus | Probability of capturing Corydalus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Crangonyx | Probability of capturing Crangonyx calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cryptochia | Probability of capturing Cryptochia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cryptolabis | Probability of capturing Cryptolabis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Culicidae | Probability of capturing Culicidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Culicoides | Probability of capturing Culicoides calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cultus | Probability of capturing Cultus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cymbiodyta | Probability of capturing Cymbiodyta calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dasyhelea | Probability of capturing Dasyhelea calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Desmona | Probability of capturing Desmona calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Despaxia | Probability of capturing Despaxia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Deuterophlebia | Probability of capturing Deuterophlebia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Diamesinae | Probability of capturing Diamesinae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dicosmoecus | Probability of capturing Dicosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dicranota | Probability of capturing Dicranota calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Diphetor | Probability of capturing Diphetor calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Diplectrona | Probability of capturing Diplectrona calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Diura | Probability of capturing Diura calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dixa | Probability of capturing Dixa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dixella | Probability of capturing Dixella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dolichopodidae | Probability of capturing Dolichopodidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dolophilodes | Probability of capturing Dolophilodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Doroneuria | Probability of capturing Doroneuria calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Drunella | Probability of capturing Drunella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dubiraphia | Probability of capturing Dubiraphia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dysmicohermes | Probability of capturing Dysmicohermes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ecclisomyia | Probability of capturing Ecclisomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ecdyonurus | Probability of capturing Ecdyonurus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Enallagma | Probability of capturing Enallagma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Enochrus | Probability of capturing Enochrus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Epeorus | Probability of capturing Epeorus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ephemerella | Probability of capturing Ephemerella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ephydridae | Probability of capturing Ephydridae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Eubrianax | Probability of capturing Eubrianax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Eurylophella | Probability of capturing Eurylophella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Fallceon | Probability of capturing Fallceon calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Farula | Probability of capturing Farula calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ferrissia | Probability of capturing Ferrissia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Forcipomyia | Probability of capturing Forcipomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Fossaria | Probability of capturing Fossaria calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Frisonia | Probability of capturing Frisonia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Gammarus | Probability of capturing Gammarus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Glossiphoniidae | Probability of capturing Glossiphoniidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Glossosoma | Probability of capturing Glossosoma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Glutops | Probability of capturing Glutops calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Goera | Probability of capturing Goera calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Gomphus | Probability of capturing Gomphus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Gonomyia | Probability of capturing Gonomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Graptocorixa | Probability of capturing Graptocorixa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Gumaga | Probability of capturing Gumaga calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Gyraulus | Probability of capturing Gyraulus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Gyrinus | Probability of capturing Gyrinus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Haliplus | Probability of capturing Haliplus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Haploperla | Probability of capturing Haploperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hedriodiscus_Odontomyia | Probability of capturing Hedriodiscus or Odontomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Helichus | Probability of capturing Helichus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Helicopsyche | Probability of capturing Helicopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Helisoma | Probability of capturing Helisoma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Helodon_Prosimulium | Probability of capturing Helodon or Prosimulium calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Helophorus | Probability of capturing Helophorus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hemerodromia | Probability of capturing Hemerodromia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Heptagenia | Probability of capturing Heptagenia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hesperoconopa | Probability of capturing Hesperoconopa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hesperoperla | Probability of capturing Hesperoperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hesperophylax | Probability of capturing Hesperophylax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Heterelmis | Probability of capturing Heterelmis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Heterlimnius | Probability of capturing Heterlimnius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Heteroplectron | Probability of capturing Heteroplectron calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hexatoma | Probability of capturing Hexatoma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Himalopsyche | Probability of capturing Himalopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Homoleptohyphes | Probability of capturing Homoleptohyphes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hyalella | Probability of capturing Hyalella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydatophylax | Probability of capturing Hydatophylax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydra | Probability of capturing Hydra calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydraena | Probability of capturing Hydraena calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydrobiidae | Probability of capturing Hydrobiidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydrobius | Probability of capturing Hydrobius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydrochus | Probability of capturing Hydrochus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydroporus | Probability of capturing Hydroporus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydroptila | Probability of capturing Hydroptila calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydrotrupes | Probability of capturing Hydrotrupes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ilybius | Probability of capturing Ilybius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ironodes | Probability of capturing Ironodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ischnura | Probability of capturing Ischnura calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Isogenoides | Probability of capturing Isogenoides calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Isonychia | Probability of capturing Isonychia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Isoperla | Probability of capturing Isoperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Juga | Probability of capturing Juga calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Kathroperla | Probability of capturing Kathroperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Kogotus | Probability of capturing Kogotus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Laccobius | Probability of capturing Laccobius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Lara | Probability of capturing Lara calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Lepidostoma | Probability of capturing Lepidostoma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Lestes | Probability of capturing Lestes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Lethocerus | Probability of capturing Lethocerus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Leucotrichia | Probability of capturing Leucotrichia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Leucrocuta | Probability of capturing Leucrocuta calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Libellula | Probability of capturing Libellula calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Limnophila | Probability of capturing Limnophila calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Limonia | Probability of capturing Limonia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Liodessus | Probability of capturing Liodessus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Lymnaea | Probability of capturing Lymnaea calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Malenka | Probability of capturing Malenka calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Marilia | Probability of capturing Marilia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Maruina | Probability of capturing Maruina calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Matriella_Serratella | Probability of capturing Matriella or Serratella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Megarcys | Probability of capturing Megarcys calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Menetus | Probability of capturing Menetus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Meringodixa | Probability of capturing Meringodixa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Micrasema | Probability of capturing Micrasema calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Microcylloepus | Probability of capturing Microcylloepus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Molophilus | Probability of capturing Molophilus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Moselia | Probability of capturing Moselia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Muscidae | Probability of capturing Muscidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Mystacides | Probability of capturing Mystacides calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Namamyia | Probability of capturing Namamyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Narpus | Probability of capturing Narpus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nectopsyche | Probability of capturing Nectopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nematoda | Probability of capturing Nematoda calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nematomorpha | Probability of capturing Nematomorpha calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nemotelus | Probability of capturing Nemotelus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nemoura | Probability of capturing Nemoura calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Neohermes | Probability of capturing Neohermes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Neophylax | Probability of capturing Neophylax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Neoplasta | Probability of capturing Neoplasta calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Neothremma | Probability of capturing Neothremma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Neotrichia | Probability of capturing Neotrichia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nerophilus | Probability of capturing Nerophilus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nixe | Probability of capturing Nixe calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nothotrichia | Probability of capturing Nothotrichia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ochrotrichia | Probability of capturing Ochrotrichia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ochthebius | Probability of capturing Ochthebius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Octogomphus_specularis | Probability of capturing Octogomphus or specularis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oecetis | Probability of capturing Oecetis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oemopteryx | Probability of capturing Oemopteryx calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oligochaeta | Probability of capturing Oligochaeta calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oligophlebodes | Probability of capturing Oligophlebodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Onocosmoecus | Probability of capturing Onocosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ophiogomphus | Probability of capturing Ophiogomphus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Optioservus | Probability of capturing Optioservus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ordobrevia | Probability of capturing Ordobrevia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oreodytes | Probability of capturing Oreodytes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oreogeton | Probability of capturing Oreogeton calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ormosia | Probability of capturing Ormosia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Orohermes | Probability of capturing Orohermes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oroperla | Probability of capturing Oroperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Orthocladiinae | Probability of capturing Orthocladiinae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Osobenus | Probability of capturing Osobenus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ostracoda | Probability of capturing Ostracoda calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ostrocada | Probability of capturing Ostrocada calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oxyethira | Probability of capturing Oxyethira calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Palaeagapetus | Probability of capturing Palaeagapetus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Paltothemis | Probability of capturing Paltothemis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Paraleptophlebia | Probability of capturing Paraleptophlebia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Paraleuctra | Probability of capturing Paraleuctra calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Paraperla | Probability of capturing Paraperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Parapsyche | Probability of capturing Parapsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Parthina | Probability of capturing Parthina calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Pedicia | Probability of capturing Pedicia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Pedomoecus | Probability of capturing Pedomoecus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Peltodytes | Probability of capturing Peltodytes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Pericoma_Telmatoscopus | Probability of capturing Pericoma or Telmatoscopus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Perlinodes | Probability of capturing Perlinodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Perlomyia | Probability of capturing Perlomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Petrophila | Probability of capturing Petrophila calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Physa_Physella | Probability of capturing Physa or Physella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Plumiperla | Probability of capturing Plumiperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Podmosta | Probability of capturing Podmosta calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Podonominae | Probability of capturing Podonominae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Polycentropus | Probability of capturing Polycentropus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Postelichus | Probability of capturing Postelichus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Probezzia | Probability of capturing Probezzia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Procloeon | Probability of capturing Procloeon calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Prodiamesinae | Probability of capturing Prodiamesinae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Progomphus | Probability of capturing Progomphus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Prostoia | Probability of capturing Prostoia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Prostoma | Probability of capturing Prostoma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Protoptila | Probability of capturing Protoptila calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Psephenus | Probability of capturing Psephenus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Pseudolimnophila | Probability of capturing Pseudolimnophila calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Psychoda | Probability of capturing Psychoda calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Psychoglypha | Probability of capturing Psychoglypha calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Psychomyia | Probability of capturing Psychomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Pteronarcella | Probability of capturing Pteronarcella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Pteronarcys | Probability of capturing Pteronarcys calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ptychopteridae | Probability of capturing Ptychopteridae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Rhabdomastix | Probability of capturing Rhabdomastix calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Rhithrogena | Probability of capturing Rhithrogena calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Rhizelmis | Probability of capturing Rhizelmis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Rhyacophila | Probability of capturing Rhyacophila calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Rickera | Probability of capturing Rickera calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sanfilippodytes | Probability of capturing Sanfilippodytes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sciomyzidae | Probability of capturing Sciomyzidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Scirtidae | Probability of capturing Scirtidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sialis | Probability of capturing Sialis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sierraperla | Probability of capturing Sierraperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sigara | Probability of capturing Sigara calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Silvius | Probability of capturing Silvius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Simulium | Probability of capturing Simulium calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Siphlonurus | Probability of capturing Siphlonurus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Skwala | Probability of capturing Skwala calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Soliperla | Probability of capturing Soliperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Soyedina | Probability of capturing Soyedina calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sphaeriidae | Probability of capturing Sphaeriidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sphaeromatidae | Probability of capturing Sphaeromatidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sphaeromias | Probability of capturing Sphaeromias calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Staphylinidae | Probability of capturing Staphylinidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Stenocolus | Probability of capturing Stenocolus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Stictotarsus | Probability of capturing Stictotarsus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Stilobezzia | Probability of capturing Stilobezzia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Stratiomys | Probability of capturing Stratiomys calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Stygobromus | Probability of capturing Stygobromus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Suwallia | Probability of capturing Suwallia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sweltsa | Probability of capturing Sweltsa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sympetrum | Probability of capturing Sympetrum calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Syrphidae | Probability of capturing Syrphidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tabanus_Atylotus | Probability of capturing Tabanus or Atylotus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Taenionema | Probability of capturing Taenionema calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tanypodinae | Probability of capturing Tanypodinae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Thaumaleidae | Probability of capturing Thaumaleidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Timpanoga | Probability of capturing Timpanoga calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tinodes | Probability of capturing Tinodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tipula | Probability of capturing Tipula calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Triaenodes | Probability of capturing Triaenodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Trichoclinocera | Probability of capturing Trichoclinocera calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Trichocorixa | Probability of capturing Trichocorixa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tricoryhyphes | Probability of capturing Tricoryhyphes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tricorythodes | Probability of capturing Tricorythodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Triznaka | Probability of capturing Triznaka calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tropisternus | Probability of capturing Tropisternus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Turbellaria | Probability of capturing Turbellaria calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Uvarus_subtilis | Probability of capturing Uvarus or subtilis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Visoka | Probability of capturing Visoka calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Wiedemannia | Probability of capturing Wiedemannia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Wormaldia | Probability of capturing Wormaldia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Yoraperla | Probability of capturing Yoraperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Yphria | Probability of capturing Yphria calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Zaitzevia | Probability of capturing Zaitzevia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Zapada | Probability of capturing Zapada calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Zoniagrion | Probability of capturing Zoniagrion calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_Clinger_PercentTaxa | Observed percent clinger taxa |
| CSCI_Clinger_PercentTaxa_predicted | Predicted percent clinger taxa |
| CSCI_Clinger_PercentTaxa_score | Score for percent clinger taxa metric |
| CSCI_Coleoptera_PercentTaxa | Observed percent Coleoptera taxa |
| CSCI_Coleoptera_PercentTaxa_predicted | Predicted percent Coleoptera taxa |
| CSCI_Coleoptera_PercentTaxa_score | Score for percent Coleoptera taxa metric |
| CSCI_Count | Total number of organisms in the sample. If purge=T, the post-purge number is shown. A minimum number has not been established, but samples with low values should be evaluated with caution. |
| CSCI_E | The sum of all capture probabilities greater than 0.5 at a site. Interpreted as the total number of common taxa expected at a site. |
| CSCI_EPT_PercentTaxa | Observed percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa |
| CSCI_EPT_PercentTaxa_predicted | Predicted percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa |
| CSCI_EPT_PercentTaxa_score | Scored percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa |
| CSCI_Intolerant_Percent | Observed percent intolerant individuals (CTV<3) |
| CSCI_Intolerant_Percent_predicted | Predicted percent intolerant individuals |
| CSCI_Intolerant_Percent_score | Score for percent intolerant individuals metric |
| CSCI_Mean_O | The number of common taxa (i.e., capture probability greater than 0.5) observed at a site, averaged across iterations. |
| CSCI_MMI | The pMMI score, averaged across 20 iterations. A minimum threshold has not been established, but low values should be considered indicative of degradation. |
| CSCI_MMI_Percentile | The percentile of the pMMI score, relative to the reference distribution. A minimum threshold has not been established, but low values should be considered indicative of degradation. |
| CSCI_Number_of_MMI_Iterations | Number of subsamples used to calculate the pMMI. If the count is less than 500, no subsampling is performed, and this field will show 1. Otherwise, 20 subsamples are performed. |
| CSCI_Number_of_OE_Iterations | Number of subsamples used to calculate the O/E. If the total number of unambiguous taxa is less than 500, no subsampling is performed, and this field will show 1. Otherwise, 20 subsamples are performed. |
| CSCI_OoverE | O/E, calculated as Mean_O divided by E. |
| CSCI_OoverE_Percentile | The percentile of the O/E score, relative to the reference distribution. A minimum threshold has not been established, but low values should be considered indicative of degradation. |
| CSCI_Pcnt_Ambiguous_Individuals | Percent of the total number of individuals excluded from O/E calculation. A maximum number has not been established, but samples with high values should be evaluated with caution. |
| CSCI_Pcnt_Ambiguous_Taxa | Percent of the total number of FinalIDs excluded from O/E calculation. A maximum number has not been established, but samples with high values should be evaluated with caution. |
| CSCI_Percentile | The percentile of CSCI score, relative to the reference distribution |
| CSCI_ProbGroup1 | Probability of membership in Group 1 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup10 | Probability of membership in Group 10 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup11 | Probability of membership in Group 11 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup2 | Probability of membership in Group 2 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup3 | Probability of membership in Group 3 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup4 | Probability of membership in Group 4 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup5 | Probability of membership in Group 5 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup6 | Probability of membership in Group 6 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup7 | Probability of membership in Group 7 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup8 | Probability of membership in Group 8 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup9 | Probability of membership in Group 9 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_Shredder_Taxa | Observed number of shredder taxa |
| CSCI_Shredder_Taxa_predicted | Predicted number of shredder taxa |
| CSCI_Shredder_Taxa_score | Score for shredder taxa metric |
| CSCI_Taxonomic_Richness | Observed taxonomic richness |
| CSCI_Taxonomic_Richness_predicted | Predicted taxonomic richness |
| CSCI_Taxonomic_Richness_score | Score for taxonomic richness metric |
| Cumylphenol, 4- | 4-Cumylphenol |
| Cup | Cup |
| Cup, Styrofoam | Cup, Styrofoam |
| Cup, Waxed Paper | Cup, Waxed Paper |
| Cup/Plate, Plastic | Cups/plates, Plastic |
| Cup/Plate, Polystryene Foam | Cup/plate, Polystyrene Foam, e.g., Styrofoam |
| Cup/Plate, Waxed Paper | Cup/plate, Waxed Paper |
| Cyanazine | Cyanazine |
| Cyanide | Cyanide |
| Cyanobacteria | Potentially toxigenic (PTOX) genera of cyanobacteria |
| CyanotoxinSampleVolume | Volume of material and liquid in Cyanotoxin sample |
| Cyantraniliprole | Cyantraniliprole |
| Cyazofamid | Cyazofamid |
| Cybutryne | Cybutryne |
| Cyclaniliprole | Cyclaniliprole |
| Cycloate | Cycloate |
| Cyclohexyl-2-Benzothiazol-Amine, N- | N-Cyclohexyl-2-Benzothiazol-Amine (N-Cyclohexyl-1,3-Benzothiazol-2-Amine) (NCBA) |
| Cyfluthrin, beta- | beta-Cyfluthrin |
| Cyfluthrin, gamma- | gamma-Cyfluthrin |
| Cyfluthrin, total | Total Cyfluthrin |
| Cyfluthrin-1 | Cyfluthrin peak 1 |
| Cyfluthrin-2 | Cyfluthrin peak 2 |
| Cyfluthrin-2/Cyflurthrin-4 | Cyfluthrin-2/Cyflurthrin-4 |
| Cyfluthrin-3 | Cyfluthrin peak 3 |
| Cyfluthrin-4 | Cyfluthrin peak 4 |
| Cyhalofop-butyl | Cyhalofop-butyl |
| Cyhalothrin, gamma- | gamma-Cyhalothrin |
| Cyhalothrin, lambda-1 | lambda-Cyhalothrin, peak 1 or Warrior-1 |
| Cyhalothrin, lambda-2 | lambda-Cyhalothrin, peak 2 or Warrior-2 |
| Cyhalothrin, Total | Total Cyhalothrin |
| Cyhalothrin, Total lambda- | Total lambda-Cyhalothrin, sum peaks 1 & 2 |
| Cyhalothrin-d6, Total lambda-(Surrogate) | Surrogate: Total lambda-Cyhalothrin-d6 |
| Cylindrospermopsin | Cylindrospermopsin |
| Cymene, p- | p-Cymene |
| Cymoxanil | Cymoxanil |
| Cypermethrin, Total | Total Cypermethrin, sum peaks 1,2,3 & 4 |
| Cypermethrin-1 | Cypermethrin peak 1 |
| Cypermethrin-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Cypermethrin-13C6 |
| Cypermethrin-13C6(Surrogate) | Surrogate: Cypermethrin-13C6 |
| Cypermethrin-2 | Cypermethrin peak 2 |
| Cypermethrin-2/Cypermethrin-4 | Cypermethrin-2/Cypermethrin-4 |
| Cypermethrin-3 | Cypermethrin peak 3 |
| Cypermethrin-4 | Cypermethrin peak 4 |
| Cyprazine | Cyprazine |
| Cyproconazole | Cyproconazole |
| Cyprodinil | Cyprodinil |
| d13C_VPDB | Delta 13C, relative to Vienna Pee Dee Belemnite |
| d15N_Air-N2 | Delta 15N, relative to Atmospheric Nitrogen |
| d34S_VCDT | Delta 34S, relative to Vienna Canyon Diablo Troilite |
| Dacthal | Dacthal |
| Dacthal acid metabolites | Dacthal acid metabolites |
| Dacthal Monoacid | Dacthal Monoacid |
| Dairies Extent | Dairies Extent |
| Dairies Intensity | Dairies Intensity |
| Dairies Proximity | Dairies Proximity |
| Dam Extent | Dam Extent |
| Dam Intensity | Dam Intensity |
| Dam Proximity | Dam Proximity |
| Dams | Dams |
| Dazomet | Dazomet |
| DBCE(Surrogate) | Surrogate: Dibutylchlorendate |
| DCBP(p,p') | p,p'-Dichlorobenzophenone (DCBP) |
| DDD(o,p') | o,p'-DDD |
| DDD(o,p')(Surrogate) | Surrogate: o,p'-DDD |
| DDD(o,p')/PCB 118 | o,p'-DDD/PCB 118 |
| DDD(p,p') | p,p'-DDD |
| DDD(p,p')(Surrogate) | Surrogate: p,p'-DDD |
| DDD-13C12(o,p')(IsoDilAnalogue) | Isotope Dilution Analogue: o,p'-DDD-13C12 |
| DDD-13C12(p,p')(IsoDilAnalogue) | Isotope Dilution Analogue: p,p'-DDD-13C12 |
| DDD-d8(p,p')(Surrogate) | Surrogate: p,p'-DDD-d8 |
| DDE(o,p') | o,p'-DDE |
| DDE(o,p')(Surrogate) | Surrogate: o,p'-DDE |
| DDE(p,p') | p,p'-DDE |
| DDE(p,p')(Surrogate) | Surrogate: p,p'-DDE |
| DDE(p,p')/PCB 087 | p,p'-DDE/PCB 087 |
| DDE-13C12(o,p')(IsoDilAnalogue) | Isotope Dilution Analogue: o,p'-DDE-13C12 |
| DDE-13C12(p,p')(IsoDilAnalogue) | Isotope Dilution Analogue: p,p'-DDE-13C12 |
| DDE-13C12(p,p')(Surrogate) | Surrogate: DDE-13C12(p,p') |
| DDMS(p,p') | p,p'-DDMS |
| DDMU(p,p') | p,p'-DDMU |
| DDT(o,p') | o,p'-DDT |
| DDT(o,p')(Surrogate) | Surrogate: o,p'-DDT |
| DDT(p,p') | p,p'-DDT |
| DDT(p,p')(Surrogate) | Surrogate: p,p'-DDT |
| DDT(p,p')/PCB 187 | p,p'-DDT/PCB 187 |
| DDT-13C12(o,p')(IsoDilAnalogue) | Isotope Dilution Analogue: o,p'-DDT-13C12 |
| DDT-13C12(p,p')(IsoDilAnalogue) | Isotope Dilution Analogue: p,p'-DDT-13C12 |
| Dead Domestic Animals | Dead Domestic Animals |
| Deaminated metribuzin (DA) | Deaminated metribuzin (DA) |
| Debris Lines/Silt-Laden Vegetation Extent | Debris Lines/Silt-Laden Vegetation Extent |
| Debris Lines/Silt-Laden Vegetation Intensity | Debris Lines/Silt-Laden Vegetation Intensity |
| Debris Lines/Silt-Laden Vegetation Proximity | Debris Lines/Silt-Laden Vegetation Proximity |
| DebrisLandUse_Commercial | DebrisLandUse_Commercial |
| DebrisLandUse_Industrial | DebrisLandUse_Industrial |
| DebrisLandUse_LimitedTimeParking | DebrisLandUse_LimitedTimeParking |
| DebrisLandUse_OpenSpace | DebrisLandUse_OpenSpace |
| DebrisLandUse_Park | DebrisLandUse_Park |
| DebrisLandUse_ParkingLot | DebrisLandUse_ParkingLot |
| DebrisLandUse_Residential | DebrisLandUse_Residential |
| Decabromodiphenyl Ethane | Decabromodiphenyl Ethane |
| Decabromodiphenylethane | Decabromodiphenylethane (DBDPE) |
| Decabromodiphenylethane-13C14(IsoDilAnalogue) | Isotope Dilution Analogue: Decabromodiphenylethane-13C14 (DBDPE-13C14) |
| Decafluorobiphenyl(Surrogate) | Surrogate: Decafluorobiphenyl |
| Decalin | Decalin |
| Decalin, C1- | C1-Decalin |
| Decalin, C2- | C2-Decalin |
| Decalin, C3- | C3-Decalin |
| Decalin, C4- | C4-Decalin |
| Decamethylcyclopentasiloxane | Decamethylcyclopentasiloxane |
| Decane, 2-phenyl- | 2-Phenyl-decane |
| Decane, 3-phenyl- | 3-Phenyl-decane |
| Decane, 4-phenyl- | 4-Phenyl-decane |
| Decane, 5-phenyl- | 5-Phenyl-decane |
| Decane, n- | n-Decane |
| Dechlorane 601 | Dechlorane 601 |
| Dechlorane 602 | Dechlorane 602 |
| Dechlorane 603 | Dechlorane 603 |
| Dechlorane 604 | Dechlorane 604 |
| Dechlorane 604 Component B | Dechlorane 604 Component B |
| Dechlorane Plus Mono Adduct | Dechlorane Plus Mono Adduct (DPMA) |
| Dechlorane Plus, anti- | anti-Dechlorane Plus (anti-DP) |
| Dechlorane Plus, syn- | syn-Dechlorane Plus (syn-DP) |
| Dechlorane Plus, Total | Total Dechlorane Plus (DP) |
| Dehydronifedipine | Dehydronifedipine |
| Delta 13C | Delta 13C |
| Delta 15N | Delta 15N |
| Delta 15N - baseline corrected | Delta 15N - baseline corrected |
| Deltamethrin | Deltamethrin |
| Deltamethrin/Tralomethrin | Deltamethrin/Tralomethrin |
| Deltamethrin-d6, Total(Surrogate) | Surrogate: Total Deltamethrin-d6 |
| Demeton, Total | Total Demeton |
| Demeton-O | Demeton-O |
| Demeton-s | Demeton-s |
| Density | Density of Sample |
| Deposits | Deposits |
| Desethyl-Atrazine | Desethyl-Atrazine |
| Desethyl-desisopropyl-atrazine | Desethyl-desisopropyl-atrazine |
| Desisopropyl-Atrazine | Desisopropyl-Atrazine |
| Desmedipham | Desmedipham |
| Desmethyldiltiazem | Desmethyldiltiazem |
| Desmethyl-LR | Desmethyl-LR |
| Desmethyl-RR | Desmethyl-RR |
| Desmetryn | Desmetryn |
| Desnitro-imidacloprid | Desnitro-imidacloprid |
| Desthio-prothioconazole | Desthio-prothioconazole |
| Detergent | Detergent |
| Deuterium/Hydrogen Ratio | Deuterium/Hydrogen Ratio |
| Di(2-ethylhexyl) phosphate | Di(2-ethylhexyl) phosphate (DEHP) |
| Diallate | Diallate (Avadex) |
| Diaminochlorotriazine (DACT) | Diaminochlorotriazine (DACT) |
| Diazepam | Diazepam |
| Diazepam-d5(Surrogate) | Surrogate: Diazepam-d5 |
| Diazinon | Diazinon |
| Diazinon(Surrogate) | Surrogate: Diazinon |
| Diazinon-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Diazinon-d10 |
| Diazinon-d10(Surrogate) | Surrogate: Diazinon-d10 |
| Diazoxon | Diazoxon |
| Dibenz(a,h)anthracene | Dibenz(a,h)anthracene |
| Dibenz(a,h)anthracene, C1- | C1-Dibenz(a,h)anthracene |
| Dibenz(a,h)anthracene, C2- | C2-Dibenz(a,h)anthracene |
| Dibenz(a,h)anthracene, C3- | C3-Dibenz(a,h)anthracene |
| Dibenz(a,h)anthracene-d14(IsoDilAnalogue) | Isotope Dilution Analogue: Dibenz(a,h)anthracene-d14 |
| Dibenz(a,h)anthracene-d14(Surrogate) | Surrogate: Dibenz(a,h)anthracene-d14 |
| Dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene | Dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene |
| Dibenzofuran | Dibenzofuran |
| Dibenzothiophene | Dibenzothiophene |
| Dibenzothiophene-d8(IsoDilAnalogue) | Isotope Dilution Analogue: Dibenzothiophene-d8 |
| Dibenzothiophene-d8(Surrogate) | Surrogate: Dibenzothiophene-d8 |
| Dibenzothiophenes, C1- | C1-Dibenzothiophenes |
| Dibenzothiophenes, C2- | C2-Dibenzothiophenes |
| Dibenzothiophenes, C3- | C3-Dibenzothiophenes |
| Dibenzothiophenes, C4- | C4-Dibenzothiophenes |
| Dibromo-2,3-dichlorophenyl-hexachloro-norbornene, 4,6- | 4,6-Dibromo-2,3-dichlorophenyl-hexachloro-norbornene (Br2Cl2-DEC604) |
| Dibromo-3-Chloropropane, 1,2- | 1,2-Dibromo-3-Chloropropane (DBCP) |
| Dibromo-4-(1,2-dibromoethyl)cyclohexane, alpha-1,2- | alpha-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (alpha-DBE-DBCH) |
| Dibromo-4-(1,2-dibromoethyl)cyclohexane, beta-1,2- | beta-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (beta-DBE-DBCH) |
| Dibromo-4-(1,2-dibromoethyl)cyclohexane, gamma-1,2- | gamma-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (gamma-DBE-DBCH) |
| Dibromo-4-Cyanophenyl Octanoate, 2,6- | 2,6-Dibromo-4-Cyanophenyl Octanoate |
| Dibromo-4-hydroxybenzonitrile, 3,5- | 3,5-Dibromo-4-hydroxybenzonitrile (Bromoxynil) |
| Dibromoacetic Acid | Dibromoacetic Acid (DBAA) |
| Dibromoaldrin | Dibromoaldrin (DBALD) |
| Dibromochloromethane | Dibromochloromethane |
| Dibromodichloromethane | Dibromodichloromethane |
| Dibromoethane, 1,2- | 1,2-Dibromoethane |
| Dibromofluoromethane | Dibromofluoromethane |
| Dibromofluoromethane(Surrogate) | Surrogate: Dibromofluoromethane |
| Dibromomethane | Dibromomethane |
| Dibromooctafluorobiphenyl, 4,4'-(Surrogate) | Surrogate: 4,4'-Dibromooctafluorobiphenyl (DBOFB) |
| Dibromooctafluorobiphenyl, 4,4'-(Surrogate)DB-608 | Surrogate: 4,4’-Dibromooctafluorobiphenyl run on column DB-608 |
| Dibromooctafluorobiphenyl, 4,4'-(Surrogate)HP-5 | Surrogate: 4,4’-Dibromooctafluorobiphenyl run on column HP-5 |
| Dibromooctafluorobiphenyl, 4-4'-(Surrogate) | Surrogate: 4-4' Dibromooctafluorobiphenyl (DBOFB) |
| Dibromooctafluorobiphenyl, 4-4'-(Surrogate)DB-608 | Surrogate: 4,4’-dibromooctafluorobiphenyl run on column DB-608 |
| Dibromooctafluorobiphenyl, 4-4'-(Surrogate)HP-5 | Surrogate: 4,4’-dibromooctafluorobiphenyl run on column HP-5 |
| Dibromophenyl-hexachloro-norbornene | Dibromophenyl-hexachloro-norbornene (Br2-DEC604) |
| Dibromopropane, 1,2-(Surrogate) | Surrogate: 1,2-Dibromopropane |
| Dibutyl phosphate | Dibutyl phosphate (DBP) |
| Dibutylchlorendate | Dibutylchlorendate |
| Dibutylchlorendate(Surrogate) | Surrogate: Dibutylchlorendate (DBCE) |
| Dibutyltin as Sn | Dibutyltin as Sn (DBT) |
| Dicamba | Dicamba (2,5-Dichloro-6-methoxybenzoic Acid) |
| Dicamba, diethanolamine salt | Dicamba, diethanolamine salt |
| Dicamba, dimethylamine salt | Dicamba, dimethylamine salt |
| Dichlofenthion | Dichlofenthion |
| Dichlofenthion(Surrogate) | Surrogate: Dichlofenthion |
| Dichlone | Dichlone |
| Dichloran | Dichloran (Botran) (Benzenamine, 2,6-dichloro-4-nitro-) |
| Dichloro-2 butene, cis 1,4- | Cis-1,4-dichloro-2 butene |
| Dichloro-2 butene, trans 1,4- | Trans-1,4-dichloro-2 butene |
| Dichloroacetate(Surrogate) | Surrogate: Dichloroacetate |
| Dichloroacetic Acid | Dichloroacetic Acid (DCAA) |
| Dichloroaniline, 3,4- | 3,4-Dichloroaniline |
| Dichloroaniline, 3,5- | 3,5-Dichloroaniline |
| Dichlorobenzenamine, 3,4- | 3,4-Dichlorobenzenamine (3,4-DCA) |
| Dichlorobenzene, 1,2- | 1,2-Dichlorobenzene |
| Dichlorobenzene, 1,2-(Surrogate) | Surrogate: 1,2-Dichlorobenzene |
| Dichlorobenzene, 1,3- | 1,3-Dichlorobenzene |
| Dichlorobenzene, 1,3-(Surrogate) | Surrogate: 1,3-Dichlorobenzene |
| Dichlorobenzene, 1,4- | 1,4-Dichlorobenzene |
| Dichlorobenzene, 1,4-(Surrogate) | Surrogate: 1,4-Dichlorobenzene |
| Dichlorobenzene-13C6,1,4-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,4-Dichlorobenzene-13C6 |
| Dichlorobenzene-d4, 1,2- | 1,2-Dichlorobenzene-d4 |
| Dichlorobenzene-d4, 1,2-(Surrogate) | Surrogate: 1,2-Dichlorobenzene-d4 |
| Dichlorobenzene-d4, 1,4-(Surrogate) | Surrogate: 1,4-Dichlorobenzene-d4 |
| Dichlorobenzidine, 3,3'- | 3,3'-Dichlorobenzidine |
| Dichlorobenzidine, 3,3'-(Surrogate) | Surrogate: 3,3'-Dichlorobenzidine |
| Dichlorobenzoic Acid, 3,5- | 3,5-Dichlorobenzoic Acid |
| Dichlorobenzoic Acid, 3,5-(Surrogate) | Surrogate: 3,5-Dichlorobenzoic Acid |
| Dichlorobenzonitrile, 2,6- | 2,6-Dichlorobenzonitrile (Dichlobenil) |
| Dichlorobenzophenone(p,p') | p,p'-Dichlorobenzophenone |
| Dichlorodifluoromethane | Dichlorodifluoromethane |
| Dichloroethane, 1,1- | 1,1-Dichloroethane |
| Dichloroethane, 1,2- | 1,2-Dichloroethane |
| Dichloroethane-d4, 1,2-(Surrogate) | Surrogate: 1,2-Dichloroethane-d4 |
| Dichloroethylene, 1,1- | 1,1-Dichloroethylene (1,1-Dichloroethene) |
| Dichloroethylene, cis 1,2- | cis-1,2-Dichloroethylene (cis-1,2-Dichloroethene) |
| Dichloroethylene, Total 1,2- | Total 1,2-Dichloroethylene |
| Dichloroethylene, trans 1,2- | trans-1,2-Dichloroethylene (trans-1,2-Dichloroethene) |
| Dichlorophenol, 2,4- | 2,4-Dichlorophenol |
| Dichlorophenol, 2,4-(Surrogate) | Surrogate: 2,4-Dichlorophenol |
| Dichlorophenol, 2,6- | 2,6-Dichlorophenol |
| Dichlorophenoxy)propionic acid isooctyl ester, 2-(2,4- | 2-(2,4-dichlorophenoxy)propionic acid isooctyl ester |
| Dichlorophenoxyacetic Acid 2-ethylhexyl ester, 2,4- | 2,4-Dichlorophenoxyacetic acid 2-ethylhexyl ester (2,4-D 2-ethylexyl ester) |
| Dichlorophenoxyacetic Acid alkanolamine salts, 2,4- | 2,4-Dichlorophenoxyaceticc Acid alkanolamine salts (2,4-D alkanolamine salts) |
| Dichlorophenoxyacetic Acid butoxyethanol ester, 2,4- | 2,4-Dichlorophenoxyaceticc Acid butoxyethanol ester (2,4-D Butoxyethyl ester) |
| Dichlorophenoxyacetic Acid butyl ester, 2,4- | 2,4-Dichlorophenoxyaceticc Acid butyl ester (2,4-D butyl ester) |
| Dichlorophenoxyacetic Acid diethanolamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid diethanolamine salt (2,4-D diethanolamine salt) |
| Dichlorophenoxyacetic Acid diethylamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid diethylamine salt (2,4-D diethylamine salt) |
| Dichlorophenoxyacetic Acid dimethylamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid dimethylamine salt (2,4-D dimethylamine salt) |
| Dichlorophenoxyacetic Acid dodecylamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid dodecylamine salt (2,4-D dodecylamine salt) |
| Dichlorophenoxyacetic Acid isooctyl ester, 2,4- | 2,4-Dichlorophenoxyaceticc Acid isooctyl ester (2,4-D isooctyl ester) |
| Dichlorophenoxyacetic Acid Methyl Ester, 2,4- | 2,4-Dichlorophenoxyacetic acid Methyl ester (2,4-D 2-Methyl ester) |
| Dichlorophenoxyacetic Acid n,n-dimethyloleyl-linoleyamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid n,n-dimethyloleyl-linoleyamine salt (2,4-D n,n-dimethyloleyl-linoleyamine salt) |
| Dichlorophenoxyacetic Acid n-oleyl-1, 2,4-3-propylenediamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid n-oleyl-1,3-propylenediamine salt (2,4-D n-oleyl-1,3-propylenediamine salt) |
| Dichlorophenoxyacetic Acid octyl ester, 2,4- | 2,4-Dichlorophenoxyaceticc Acid octyl ester (2,4-D octyl ester) |
| Dichlorophenoxyacetic Acid propyl ester, 2,4- | 2,4-Dichlorophenoxyaceticc Acid propyl ester (2,4-D propyl ester) |
| Dichlorophenoxyacetic Acid propyleneglycolbutylether ester, 2,4- | 2,4-Dichlorophenoxyacetic Acid propylene glycol butyl ether ester (2,4-D propylene glycol butyl ether ester) |
| Dichlorophenoxyacetic Acid tetradecylamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid tetradecylamine salt (2,4-D tetradecylamine salt) |
| Dichlorophenoxyacetic Acid triethylamine salt, 2,4- | 2,4-Dichlorophenoxyaceticc Acid triethylamine salt (2,4-D triethylamine salt) |
| Dichlorophenoxyacetic Acid, 2,3-(Surrogate) | Surrogate: 2,3-Dichlorophenoxyacetic Acid (2,3-D) |
| Dichlorophenoxyacetic Acid, 2,4- | 2,4-Dichlorophenoxyacetic Acid (2,4-D) |
| Dichlorophenoxyacetic Acid, 2,4-(Surrogate) | Surrogate: 2,4-Dichlorophenoxyacetic Acid (2,4-D) |
| Dichlorophenoxybutyric Acid dimethylamine salt, 4-(2,4- | 4-2,4-Dichlorophenoxybutyric Acid dimethylamine salt |
| Dichlorophenoxybutyric Acid isooctyl ester, 4-(2,4- | 4-2,4-Dichlorophenoxybutyric Acid isooctyl ester |
| Dichlorophenoxybutyric Acid Methyl Ester, 2,4- | 2,4-Dichlorophenoxybutyric Acid Methyl Ester (2,4-DB Methyl Ester) |
| Dichlorophenoxybutyric Acid, 2,4- | 2,4-Dichlorophenoxybutyric Acid (2,4-DB) |
| Dichlorophenoxybutyric Acid, 2,4-(Surrogate) | Surrogate: 2,4-Dichlorophenoxybutyric Acid (2,4-DB) |
| Dichlorophenyl isocyanate, 3,4- | 3,4-Dichlorophenyl isocyanate |
| Dichlorophenyl Urea, 3,4- | 3,4-Dichlorophenyl Urea (DCPU) |
| Dichlorophenyl-3-methyl Urea, 3,4- | 3,4-Dichlorophenyl-3-methyl Urea (DCPMU) |
| Dichlorophenylacetic Acid, 2,4- | 2,4-Dichlorophenylacetic Acid |
| Dichlorophenylacetic Acid, 2,4- (Surrogate) | Surrogate: 2,4-Dichlorophenylacetic Acid |
| Dichloroprop | Dichlorprop (2-(2,4-Dichlorophenoxy)propanoic Acid) |
| Dichloroprop, dimethylamine salt | Dichloroprop, dimethylamine salt |
| Dichloropropane, 1,2- | 1,2-Dichloropropane |
| Dichloropropane, 1,3- | 1,3-Dichloropropane |
| Dichloropropane, 2,2- | 2,2-Dichloropropane |
| Dichloropropene, 1,1- | 1,1-Dichloropropene |
| Dichloropropene, 1,3- | 1,3-Dichloropropene |
| Dichloropropene, cis 1,3- | cis-1,3-Dichloropropene |
| Dichloropropene, Total 1,3- | Total 1,3-Dichloropropene |
| Dichloropropene, trans 1,3- | trans-1,3-Dichloropropene |
| Dichloropropionic Acid, 2,2- | 2,2-Dichloropropionic Acid (Dalapon) |
| Dichloro-pyridine-2-carboxylic Acid, 3,6- | 3,6-Dichloro-pyridine-2-carboxylic Acid (Clopyralid) |
| Dichlorotrifluoroethane | Dichlorotrifluoroethane (Freon 123) |
| Dichlorotrifluoromethane | Dichlorotrifluoromethane |
| Dichlorprop, butoxyethyl ester | Dichlorprop, butoxyethyl ester |
| Dichlorvos | Dichlorvos |
| Dichrotophos | Dichrotophos |
| Diclofenac | Diclofenac (2-(2-(2,6-Dichlorophenylamino)phenyl)acetic Acid) |
| Diclofop-Methyl | Diclofop-Methyl |
| Dicofol | Dicofol |
| Dicrotophos | Dicrotophos |
| Dicyclohexylurea, 1,3- | 1,3-Dicyclohexylurea (N,N'-Dicyclohexylurea) |
| Di-dechlorinated Dechlorane Plus | Di-dechlorinated Dechlorane Plus (C10-DP) |
| Dieldrin | Dieldrin |
| Dieldrin(Surrogate) | Surrogate: Dieldrin |
| Dieldrin-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Dieldrin-13C12 |
| Dienochlor | Dienochlor |
| Diesel Fuel | Diesel Fuel |
| Diethatyl-Ethyl | Diethatyl-Ethyl |
| Diethyl Phosphate | Diethyl Phosphate (DEP) |
| Diethyl phthalate | Diethyl phthalate |
| Diethyl-3-methyl-benzamide, N,N- | N,N-Diethyl-3-methyl-benzamide |
| Diethyl-3-methyl-benzamide-d7, N,N-(Surrogate) | Surrogate: N,N-Diethyl-3-methyl-benzamide-d7 |
| Diethylaniline, 2,6- | 2,6-Diethylaniline |
| Diethylstilbestrol | Diethylstilbestrol |
| Difenoconazole | Difenoconazole |
| Difenzoquat Methylsulfate | Difenzoquat Methylsulfate |
| Diflubenzuron | Diflubenzuron (Difluron) |
| Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether, 5,6-(Surrogate) | Surrogate: 5,6-Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether |
| Difluoro-2,2’,3,3’,4,5,5’,6’-Octabromodiphenyl Ether 4’,6-(Surrogate) | Surrogate: 4’,6-Difluoro-2,2’,3,3’,4,5,5’,6’-Octabromodiphenyl Ether |
| Difluorobenzene, 1,4- | 1,4-Difluorobenzene |
| Difluorobenzene, 1,4-(Surrogate) | Surrogate: 1,4-Difluorobenzene |
| Digoxigenin | Digoxigenin |
| Digoxin | Digoxin |
| Diisopropyl Ether | Diisopropyl Ether |
| Diisopropylphenyl Diphenyl Phosphate, 2,4- | 2,4-Diisopropylphenyl Diphenyl Phosphate (2,4-Di(Propan-2-yl)Phenyl Diphenyl Phosphate) (24DIPPDPP) |
| Dike/Levee Extent | Dike/Levee Extent |
| Dike/Levee Intensity | Dike/Levee Intensity |
| Dike/Levee Proximity | Dike/Levee Proximity |
| Diltiazem | Diltiazem |
| Dimethipin | Dimethipin |
| Dimethoate | Dimethoate |
| Dimethomorph | Dimethomorph |
| Dimethyl phosphate | Dimethyl Phosphate (DMP) |
| Dimethyl phthalate | Dimethyl phthalate |
| Dimethyl-2-nitrobenzene, 1,3- | 1,3-Dimethyl-2-nitrobenzene |
| Dimethyl-2-nitrobenzene, 1,3-(Surrogate) | Surrogate: 1,3-Dimethyl-2-nitrobenzene (2,6-Dimethylnitrobenzene) |
| Dimethylarsinic Acid | Dimethylarsinic Acid |
| Dimethylchrysene, 5,9- | 5,9-Dimethylchrysene |
| Dimethyldibenzothiophene, 2,4- | 2,4-Dimethyldibenzothiophene |
| Dimethyldibenzothiophene, 4,6- | 4,6-Dimethyldibenzothiophene |
| Dimethylfluorene, 1,7- | 1,7-Dimethylfluorene |
| Dimethylnaphthalene, 1,2- | 1,2-Dimethylnaphthalene |
| Dimethylnaphthalene, 1,2,6- | 1,2,6-Dimethylnaphthalene |
| Dimethylnaphthalene, 2,6- | 2,6-Dimethylnaphthalene |
| Dimethylnaphthalene, 2,6-(Surrogate) | Surrogate: 2,6-Dimethylnaphthalene |
| Dimethylnaphthalene-d12, 2,6-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,6-Dimethylnaphthalene-d12 |
| Dimethylnaphthalene-d12, 2,6-(Surrogate) | Surrogate: 2,6-Dimethylnaphthalene-d12 |
| Dimethylphenanthrene, 1,5/1,7- | 1,5-Dimethylphenanthrene/1,7-Dimethylphenanthrene |
| Dimethylphenanthrene, 1,7- | 1,7-Dimethylphenanthrene |
| Dimethylphenanthrene, 1,8- | 1,8-Dimethylphenanthrene |
| Dimethylphenanthrene, 2,6- | 2,6-Dimethylphenanthrene |
| Dimethylphenanthrene, 3,6- | 3,6-Dimethylphenanthrene |
| Dimethylphenol, 2,4- | 2,4-Dimethylphenol |
| Dimethylphenol, 2,4-(Surrogate) | Surrogate: 2,4-Dimethylphenol |
| Dimethylxanthine, 1,7- | 1,7-Dimethylxanthine |
| Di-n-butyl Phthalate | Di-n-butyl Phthalate |
| Di-n-butyl Phthalate-d4(Surrogate) | Surrogate: Di-n-butyl Phthalate-d4 |
| Dinitro-2-methylphenol, 4,6- | 4,6-Dinitro-2-methylphenol |
| Dinitro-2-methylphenol, 4,6-(Surrogate) | Surrogate: 4,6-Dinitro-2-methylphenol |
| Dinitrophenol, 2,4- | 2,4-Dinitrophenol |
| Dinitrophenol, 2,4-(Surrogate) | Surrogate: 2,4-Dinitrophenol |
| Dinitrotoluene, 2,4- | 2,4-Dinitrotoluene |
| Dinitrotoluene, 2,4-(Surrogate) | Surrogate: 2,4-Dinitrotoluene |
| Dinitrotoluene, 2,6- | 2,6-Dinitrotoluene |
| Dinitrotoluene, 2,6-(Surrogate) | Surrogate: 2,6-Dinitrotoluene |
| Di-n-octyl Phthalate | Di-n-octyl Phthalate |
| Dinonyl-Diphenylamine | Dinonyl-Diphenylamine (ar-Nonyl-N-(Nonylphenyl)-Benzenamine) (SDPA-C9C9) |
| Dinoseb | Dinoseb (2,4-Dinitro-6-sec-butylphenol) |
| Dinotefuran | Dinotefuran |
| Dinotefuran-13C5(Surrogate) | Surrogate: Dinotefuran-13C5 |
| Dinotefuran-d3(Surrogate) | Surrogate: Dinotefuran-d3 |
| Di-n-propylnitrosamine | Di-n-propylnitrosamine |
| Dioctyl-Diphenylamine, 4,4'- | 4,4'-Dioctyl-Diphenylamine (SDPA-C8C8) |
| Dioxa-3H-Perfluorononanoic Acid, 4,8- | 4,8-Dioxa-3H-Perfluorononanoic Acid (ADONA) |
| Dioxacarb | Dioxacarb (2-(1,3-Dioxolan-2-yl)phenyl Methylcarbamate) |
| Dioxane, 1,4- | 1,4-Dioxane |
| Dioxathion | Dioxathion |
| Diphenamid | Diphenamid |
| Diphenamid(Surrogate) | Surrogate: Diphenamid |
| Diphenhydramine | Diphenhydramine |
| Diphenyl 4-Isopropylphenyl Phosphate | Diphenyl 4-Isopropylphenyl Phosphate (4-Isopropylphenyl Diphenyl Phosphate) (4IPPDPP) |
| Diphenyl Ether | Diphenyl Ether |
| Diphenyl phosphate | Diphenyl phosphate (DPP) |
| Diphenylamine | Diphenylamine |
| Diphenylanthracene, 9,10- | 9,10-Diphenylanthracene |
| Diphenylguanidine,1,3- | 1,3-diphenylguanidine |
| Diphenylhydrazine, 1,2- | 1,2-Diphenylhydrazine |
| Diphenylhydrazine, 1,2-(Surrogate) | Surrogate: 1,2-Diphenylhydrazine |
| Diphenylphthalate(Surrogate) | Surrogate: Diphenylphthalate |
| Dipropetryn | Dipropetryn |
| Diquat | Diquat |
| Direct Septic/Sewage Discharge Extent | Direct Septic/Sewage Discharge Extent |
| Direct Septic/Sewage Discharge Intensity | Direct Septic/Sewage Discharge Intensity |
| Direct Septic/Sewage Discharge Proximity | Direct Septic/Sewage Discharge Proximity |
| Discharge | Discharge from a calculation |
| Discharge Direct Measurement | Discharge Direct Measurement |
| DischargeMeasurementMethod | Method used to collect discharge (velocity) measurement |
| DischargeMeasurementRating | Code qualifying the stream discharge measurement quality in relation to the actual flow |
| Disodium methylarsonate | Disodium methylarsonate |
| Dissolved Inorganic Carbon | Dissolved Inorganic Carbon (DIC) |
| Dissolved Organic Carbon | Dissolved Organic Carbon (DOC) |
| Distance from Bank | Distance from Bank |
| Distance to Bankfull | Distance from the wetted edge to the Bankfull mark |
| Distance, Float | Float distance of observed object |
| Distance, Sampled | Distance sampled within a given waterbody |
| Disulfoton | Disulfoton |
| Disulfoton Sulfone | Disulfoton Sulfone |
| Ditches/Canals Extent | Ditches/Canals Extent |
| Ditches/Canals Intensity | Ditches/Canals Intensity |
| Ditches/Canals Proximity | Ditches/Canals Proximity |
| Dithiopyr | Dithiopyr |
| Diuron | Diuron |
| Diuron-d6(Surrogate) | Surrogate: Diuron-d6 |
| DNOC, sodium salt | DNOC, Sodium salt (4,6-Dinitro-2-methylphenol sodium salt) |
| Docohexaenoic Acid | Docohexaenoic Acid |
| Docosahexaenoic Acid | Docosahexaenoic Acid |
| Docosane, n- | n-Docosane |
| Docosapentaenoic Acid | Docosapentaenoic Acid |
| Dodecamethylcyclohexasiloxane | Dodecamethylcyclohexasiloxane |
| Dodecane, 2-phenyl- | 2-Phenyl-dodecane |
| Dodecane, 3-phenyl- | 3-Phenyl-dodecane |
| Dodecane, 4-phenyl- | 4-Phenyl-dodecane |
| Dodecane, 5-phenyl- | 5-Phenyl-dodecane |
| Dodecane, 6-phenyl- | 6-Phenyl-dodecane |
| Dodecane, n- | n-Dodecane |
| Dodecylammonium Methanearsonate | Dodecylammonium Methanearsonate |
| Dodemorph | Dodemorph |
| Dodine | Dodine |
| Dominant Benthic Substrate | Dominant Benthic Substrate - Specific to EMAP BA |
| Dominant Land Use | Dominant Land Use |
| DominantSubstrate | DominantSubstrate |
| Domoic Acid | Domoic Acid |
| Dotriacontane, n- | n-Dotriacontane |
| Doxycycline | Doxycycline |
| Dredging | Dredging |
| Dry | Dry |
| Dry Weight | Dry Weight |
| Dry Weight Standard Error | Dry Weight Standard Error |
| Dumping | Dumping using Trash Protocol |
| DW_Algae | Total Dry Weight primarily of Algae but other items may be weighed |
| E. coli | Escherichia coli |
| E. Coli O157:H7 | Escherichia Coli O157:H7 strain |
| Eicosane, n- | n-Eicosane |
| Eicosapentaenoate | Eicosapentaenoate |
| ElectricalConductivity | Electrical Conductivity |
| Elevation Difference | Elevation Difference |
| Embeddedness | Embeddedness |
| Emergent | Emergent (%) |
| Emergent juvenile | Emergent juvenile (#) |
| Enalapril | Enalapril |
| Enalapril-d5(Surrogate) | Surrogate: Enalapril-d5 |
| End Time | Time (hh:mm) when a given event ended |
| Endosulfan I | Endosulfan I (alpha-Endosulfan) |
| Endosulfan I(Surrogate) | Surrogate: Endosulfan I (alpha-Endosulfan) |
| Endosulfan I-13C9(IsoDilAnalogue) | Isotope Dilution Analogue: Endosulfan I-13C9 |
| Endosulfan I-d4(Surrogate) | Surrogate: Endosulfan I-d4 (alpha-Endosuflan-d4) |
| Endosulfan II | Endosulfan II (beta-Endosulfan) |
| Endosulfan II(Surrogate) | Surrogate: Endosulfan II (beta-Endosulfan) |
| Endosulfan II-13C9(IsoDilAnalogue) | Isotope Dilution Analogue: Endosulfan I-13C9 |
| Endosulfan II-d4(Surrogate) | Surrogate: Endosulfan II-d4 |
| Endosulfan Sulfate | Endosulfan Sulfate |
| Endosulfan Sulfate-13C9(IsoDilAnalogue) | Isotope Dilution Analogue: Endosulfan Sulfate-13C9 |
| Endosulfan Sulfate-13C9(Surrogate) | Surrogate: Endosulfan Sulfate-13C9 |
| Endothall | Endothall |
| Endothall, dipotassium salt | Endothall, dipotassium salt |
| Endothall, mono (N,N-diethyl alkylamine) salt | Endothall, mono (N,N-diethyl alkylamine) salt |
| Endothall, mono (N,N-dimethyl alkylamine) salt | Endothall, mono (N,N-dimethyl alkylamine) salt |
| Endrin | Endrin |
| Endrin Aldehyde | Endrin Aldehyde |
| Endrin Aldehyde(Surrogate) | Surrogate: Endrin Aldehyde |
| Endrin Aldehyde-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Endrin Aldehyde-13C12 |
| Endrin Ketone | Endrin Ketone |
| Endrin Ketone-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Endrin Ketone-13C12 |
| Endrin Ketone-13C12(Surrogate) | Surrogate: Endrin Ketone-13C12 |
| Endrin(Surrogate) | Surrogate: Endrin |
| Endrin-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Endrin-13C12 |
| Endrin-13C12(Surrogate) | Surrogate: Endrin-13C12 |
| Enrofloxacin | Enrofloxacin |
| Enterococcus | Enterococcus |
| Enterovirus | |
| Epitestosterone | Epitestosterone |
| EPN | EPN |
| EPN(Surrogate) | Surrogate: EPN |
| EPTC | EPTC |
| EPTC(Surrogate) | Surrogate: EPTC |
| Erythromycin | Erythromycin |
| Erythromycin-H2O | Erythromycin-H2O |
| Erythromycin-H2O-13C2(Surrogate) | Surrogate: Erythromycin-H2O-13C2 |
| Esfenvalerate | Esfenvalerate |
| Esfenvalerate/Fenvalerate, Total | Total Esfenvalerate/Fenvalerate, sum peaks 1 & 2 |
| Esfenvalerate/Fenvalerate-1 | Esfenvalerate/Fenvalerate peak 1 |
| Esfenvalerate/Fenvalerate-2 | Esfenvalerate/Fenvalerate peak 2 |
| Esfenvalerate-d6, Total(Surrogate) | Surrogate: Total Esfenvalerate-d6, sum peaks 1 & 2 |
| Esfenvalerate-d6-1(Surrogate) | Surrogate: Esfenvalerate-d6 peak 1 |
| Esfenvalerate-d6-2(Surrogate) | Surrogate: Esfenvalerate-d6 peak 2 |
| Estradiol, 17alpha- | 17alpha-Estradiol |
| Estradiol, 17beta- | 17beta-Estradiol |
| Estradiol-d3, 17beta-(IsoDilAnalogue) | Isotope Dilution Analogue: 17beta-Estradiol-d3 |
| Estriol | Estriol |
| Estriol-d2(Surrogate) | Surrogate: Estriol-d2 |
| Estrone | Estrone |
| Ethaboxam | Ethaboxam |
| Ethafluralin | Ethalfluralin |
| Ethalfluralin | Ethalfluralin |
| Ethanol | Ethanol (Ethyl Alcohol) |
| Ethion | Ethion |
| Ethion monoxon | Ethion monoxon |
| Ethion(Surrogate) | Surrogate: Ethion |
| Ethiprole(Surrogate) | Ethiprole(Surrogate) |
| Ethofenprox | Ethofenprox |
| Ethofumesate | Ethofumesate |
| Ethoprop | Ethoprop (Prophos) |
| Ethyl Ether | Ethyl Ether |
| Ethyl Perfluorooctane Sulfonamido Acetic Acid, N- | N-Ethyl Perfluorooctane Sulfonamido Acetic Acid (Et-PFOSA-AcOH) |
| Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(Surrogate) | Surrogate: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5 |
| Ethyl Perfluorooctanesulfonamide, N- | N-Ethyl Perfluorooctanesulfonamide (NEtFOSA) |
| Ethyl Perfluorooctanesulfonamide-d5, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Ethyl Perfluorooctanesulfonamide-d5 (NEtFOSA-d5) |
| Ethyl Perfluorooctanesulfonamidoacetic Acid, N- | N-Ethyl Perfluorooctanesulfonamidoacetic Acid (NEtFOSAA) |
| Ethyl Perfluorooctanesulfonamidoacetic Acid-d5, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Ethyl Perfluorooctanesulfonamidoacetic Acid-d5 (NEtFOSAA-d5) |
| Ethyl Perfluorooctanesulfonamidoethanol, N- | N-Ethyl Perfluorooctanesulfonamidoethanol (NEtFOSE) |
| Ethyl Perfluorooctanesulfonamidoethanol-d9, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Ethyl Perfluorooctanesulfonamidoethanol-d9 (NEtFOSE-d9) |
| Ethyl Tert-butyl Ether | Ethyl Tert-butyl Ether (ETBE) |
| Ethyl-6-methylaniline, 2- | 2-Ethyl-6-methylaniline |
| Ethylan | Ethylan |
| Ethylbenzene | Ethylbenzene |
| Ethylene bis(tetrabromophthalimide) | Ethylene bis(tetrabromophthalimide) (EBTEBPI) |
| Ethylene Glycol | Ethylene Glycol |
| Ethylene Thiourea | Ethylene Thiourea |
| Ethylene/vinyl Acetate Co-polymer Fiber | Ethylene/vinyl acetate copolymer Fiber |
| Ethylene/vinyl Acetate Co-polymer Film | Ethylene/vinyl acetate copolymer Film |
| Ethylene/vinyl Acetate Co-polymer Foam | Ethylene/vinyl acetate copolymer Foam |
| Ethylene/vinyl Acetate Co-polymer Fragment | Ethylene/vinyl acetate copolymer Fragment |
| Ethylene/vinyl Acetate Co-polymer Sphere | Ethylene/vinyl acetate copolymer Sphere |
| Ethylene-propylene copolymer fragment | Ethylene-propylene copolymer fragment that can be grouped under the plastic category |
| Ethylhexyl 2,3,4,5-tetrabromobenzoate, 2- | 2-Ethylhexyl 2,3,4,5-tetrabromobenzoate |
| Ethylparaben | Ethylparaben |
| Ethyl-perfluorooctanesulfonamide, N- | N-Ethyl-perfluorooctanesulfonamide |
| Ethyl-perfluorooctanesulfonamide-d5, N-(Surrogate) | Surrogate: Ethyl-perfluorooctanesulfonamide-d5, N- (N-EtFOSA) |
| Ethyl-perfluorooctanesulfonamidoethanol, N- | N-Ethyl-perfluorooctanesulfonamidoethanol |
| Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(Surrogate) | Surrogate: Ethyl-perfluorooctanesulfonamidoethanol-d9, N- (N-EtFOSE) |
| Ethynylestradiol, 17alpha- | 17alpha-Ethynylestradiol |
| Ethynylestradiol-d4, 17alpha-(IsoDilAnalogue) | Isotope Dilution Analogue: 17alpha-Ethynylestradiol-d4 |
| Ethynylestradiol-d4, 17alpha-(Surrogate) | Surrogate: 17alpha-Ethynylestradiol-d4 |
| Etoxazole | Etoxazole |
| Europium | Europium |
| Ev_FlowHab | Evenness of flow habitat types physical-habitat metric |
| Evidence of Fire | Evidence of Fire |
| Evidence of Fire Intensity | Evidence of Fire Intensity - Specific to EMAP BA |
| Evidence of Illegal Connection | Evidence of Illegal Connection |
| Evidence of Illegal Dumping | Evidence of Illegal Dumping |
| Evidence of Recent Rainfall | Evidence of Recent Rainfall |
| Evidence of Scour | Site is affected by recent scouring event |
| E-waste | E-waste |
| Excavation Extent | Excavation Extent |
| Excavation Intensity | Excavation Intensity |
| Excavation Proximity | Excavation Proximity |
| Excess Animal Waste Extent | Excess Animal Waste Extent |
| Excess Animal Waste Intensity | Excess Animal Waste Intensity |
| Excess Animal Waste Proximity | Excess Animal Waste Proximity |
| Excess Sediment Input Other Extent | Excess Sediment Input Other Extent |
| Excess Sediment Input Other Intensity | Excess Sediment Input Other Intensity |
| Excess Sediment Input Other Proximity | Excess Sediment Input Other Proximity |
| Excessive Human Visitation Extent | Excessive Human Visitation Extent |
| Excessive Human Visitation Intensity | Excessive Human Visitation Intensity |
| Excessive Human Visitation Proximity | Excessive Human Visitation Proximity |
| Fabric | Fabric |
| FabricCloth | Fabric Cloth using Trash Protocol |
| Fallow Fields Extent | Fallow Fields Extent |
| Fallow Fields Intensity | Fallow Fields Intensity |
| Fallow Fields Proximity | Fallow Fields Proximity |
| Famoxadone | Famoxadone |
| Famphur | Famphur |
| FBDE 069 | Fluorobrominated Diphenyl Ether (FBDE) 069 (4′-Fluoro-2,3′,4,6-tetrabromodiphenyl ether) |
| FBDE 160 | Fluorobrominated Diphenyl Ether (FBDE) 160 (4′-Fluoro-2,3,3′,4,5,6-hexabromodiphenyl ether) |
| Fenamidone | Fenamidone |
| Fenamiphos | Fenamiphos (Phosphoramidic acid, Isopropyl-, 4-(methylthio)-m-tolyl Ethyl Ester) |
| Fenamiphos sulfone | Fenamiphos sulfone |
| Fenamiphos sulfoxide | Fenamiphos sulfoxide |
| Fenarimol | Fenarimol |
| Fenbuconazole | Fenbuconazole |
| Fenbutatin-Oxide | Fenbutatin-Oxide |
| Fenchlorphos | Fenchlorphos (Ronnel) |
| Fenhexamid | Fenhexamid |
| Fenitrothion | Fenitrothion |
| Fenoxycarb | Fenoxycarb |
| Fenpropathrin | Fenpropathrin (Danitol) |
| Fenpropathrin-d6(Surrogate) | Surrogate: Fenpropathrin-d6 |
| Fenpyroximate | Fenpyroximate |
| Fensulfothion | Fensulfothion |
| Fenthion | Fenthion (Mercaptophos) |
| Fenuron | Fenuron |
| Fenuron trichloroacetate | Fenuron trichloroacetate |
| Fenvalerate | Fenvalerate |
| Fenvalerate-d5(Surrogate) | Surrogate: Fenvalerate-d5 |
| Feral Pig Disturbance Extent | Feral Pig Disturbance Extent |
| Feral Pig Disturbance Intensity | Feral Pig Disturbance Intensity |
| Feral Pig Disturbance Proximity | Feral Pig Disturbance Proximity |
| Ferbam | Ferbam |
| Fertilization | Fertilization (%) |
| Fertilized eggs per nest | Fertilized eggs per nest (#) |
| Filling Time | Time to fill a collection device with water |
| FinalSampleExtVolume | Final post-processing volume |
| Fine | Fine |
| Fipronil | Fipronil |
| Fipronil Amide | Fipronil Amide |
| Fipronil Desulfinyl | Fipronil Desulfinyl |
| Fipronil Desulfinyl Amide | Fipronil Desulfinyl Amide |
| Fipronil Desulfinyl-13C4 15N2(Surrogate) | Surrogate: Fipronil Desulfinyl-13C4 15N2 |
| Fipronil desulfinyl-13C4,15N2(IsoDilAnalogue) | Isotope Dilution Analogue: Fipronil desulfinyl-13C4,15N2 |
| Fipronil DetrifluoroMethylsulfinyl | Fipronil DetrifluoroMethylsulfinyl |
| Fipronil Detrifluoromethylsulfinyl-13C4 15N2(Surrogate) | Surrogate: Fipronil Detrifluoromethylsulfinyl-13C4 15N2 |
| Fipronil detrifluoromethylsulfinyl-13C4,15N2(IsoDilAnalogue) | Isotope Dilution Analogue: Fipronil detrifluoromethylsulfinyl-13C4,15N2 |
| Fipronil Sulfide | Fipronil Sulfide |
| Fipronil Sulfide-13C4 15N2(Surrogate) | Surrogate: Fipronil Sulfide-13C4 15N2 |
| Fipronil sulfide-13C4,15N2(IsoDilAnalogue) | Isotope Dilution Analogue: Fipronil sulfide-13C2,15N2 |
| Fipronil Sulfone | Fipronil Sulfone |
| Fipronil Sulfone-13C4 15N2(Surrogate) | Surrogate: Fipronil Sulfone-13C4 15N2 |
| Fipronil sulfone-13C4,15N2(IsoDilAnalogue) | Isotope Dilution Analogue: Fipronil sulfone-13C4,15N2 |
| Fipronil-13C4 15N2(Surrogate) | Surrogate: Fipronil-13C4 15N2 |
| Fipronil-13C4(Surrogate) | Surrogate: Fipronil-13C4 |
| Fipronil-13C4,15N2(IsoDilAnalogue) | Isotope Dilution Analogue: Fipronil-13C2,15N2 |
| Fipronil-C13(Surrogate) | Surrogate: Fipronil-C13 |
| Fire Breaks Extent | Fire Breaks Extent |
| Fire Breaks Intensity | Fire Breaks Intensity |
| Fire Breaks Proximity | Fire Breaks Proximity |
| Fireworks | Fireworks |
| Fish Cover Artificial Structures | Fish Cover/Instream Habitat Complexity – Other Artificial Structures |
| Fish Cover Boulders | Fish Cover/Instream Habitat Complexity – Other Boulders |
| Fish Cover Filamentous Algae | Fish Cover/Instream Habitat Complexity - Other Filamentous Algae |
| Fish Cover Live Trees/Roots | Fish Cover/Instream Habitat Complexity – Other Live Trees or Roots |
| Fish Cover Macrophytes | Fish Cover/Instream Habitat Complexity - Macrophytes |
| Fish Cover Overhang.Veg | Fish Cover/Instream Habitat Complexity – Other Overhanging Vegetation =<1 m of surface |
| Fish Cover Undercut Banks | Fish Cover/Instream Habitat Complexity – Other Undercut Banks |
| Fish Cover Woody Debris <0.3 m | Fish Cover/Instream Habitat Complexity – Other Woody Debris <0.3 m |
| Fish Cover Woody Debris >0.3 m | Fish Cover/Instream Habitat Complexity – Other Woody Debris >0.3 m |
| Fish Stocking | Fish Stocking |
| Fishing Line/Net | Fishing Line/Net |
| Float Time | Float time of observed object |
| Floatables | Floatables |
| Flonicamid | Flonicamid |
| Florpyrauxifen-Benzyl | Florpyrauxifen-Benzyl |
| Flow Diversions Extent | Flow Diversions Extent |
| Flow Diversions Intensity | Flow Diversions Intensity |
| Flow Diversions Proximity | Flow Diversions Proximity |
| Fluazifop-P-butyl | Fluazifop-P-butyl |
| Fluazinam | Fluazinam |
| Flubendiamide | Flubendiamide |
| Fluchloralin | Fluchloralin |
| Flucythrinate | Flucythrinate |
| Fludioxonil | Fludioxonil |
| Flufenacet | Flufenacet |
| Fluindapyr | Fluindapyr |
| Flumequine | Flumequine |
| Flumetralin | Flumetralin |
| Flumetsulam | Flumetsulam |
| Flumioxazin | Flumioxazin |
| Fluocinonide | Fluocinonide |
| Fluometuron | Fluometuron |
| Fluopicolide | Fluopicolide |
| Fluopyram | Fluopyram |
| Fluoranthene | Fluoranthene |
| Fluoranthene/Pyrenes, C1- | C1-Fluoranthene/Pyrenes |
| Fluoranthene-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Fluoranthene-d10 |
| Fluoranthene-d10(Surrogate) | Surrogate: Fluoranthene-d10 |
| Fluoranthenes/Pyrenes, C2- | C2-Fluoranthenes/Pyrenes |
| Fluoranthenes/Pyrenes, C3- | C3-Fluoranthenes/Pyrenes |
| Fluoranthenes/Pyrenes, C4- | C4-Fluoranthenes/Pyrenes |
| Fluorene | Fluorene |
| Fluorene-d10(Surrogate) | Surrogate: Fluorene-d10 |
| Fluorenes, C1- | C1-Fluorenes |
| Fluorenes, C2- | C2-Fluorenes |
| Fluorenes, C3- | C3-Fluorenes |
| Fluorescence | Fluorescence |
| Fluorescence, Daily Mean | Daily Mean Fluorescence (Calculated) |
| Fluoridamid | Fluoridamid (Acetamide) |
| Fluoride | Fluoride |
| Fluoro(Perfluoro-2-(Perfluoro-2-Sulfoethoxy)Propoxy)Acetic Acid | Fluoro(Perfluoro-2-(Perfluoro-2-Sulfoethoxy)Propoxy)Acetic Acid (Hydrolyzed PSDA) (Nafion Byproduct 5) |
| Fluoro-2,3,3',4,5,6-Hexabromodiphenyl Ether, 4'-(Surrogate) | Surrogate: 4'-Fluoro-2,3,3',4,5,6-Hexabromodiphenyl Ether (FBDE 160) |
| Fluoro-2,3',4,6-Tetrabromodiphenyl Ether, 4'-(Surrogate) | Surrogate: 4'-Fluoro-2,3',4,6-Tetrabromodiphenyl Ether (FBDE 069) |
| Fluoro-2,3',6-Tribromodiphenyl Ether, 4'-(Surrogate) | Surrogate: 4'-Fluoro-2,3',6-tribromodiphenyl Ether |
| Fluorobenzene | Fluorobenzene |
| Fluorobenzene(Surrogate) | Surrogate: Fluorobenzene |
| Fluorobiphenyl, 2- | 2-Fluorobiphenyl |
| Fluorobiphenyl, 2-(Surrogate) | Surrogate: 2-Fluorobiphenyl |
| Fluoroelastomer Fiber | Fluoroelastomer Fiber |
| Fluoroelastomer Fiber Bundle | Fluoroelastomer Fiber Bundle |
| Fluorophenol, 2- | 2-Fluorophenol |
| Fluorophenol, 2-(Surrogate) | Surrogate: 2-Fluorophenol |
| Fluorotelomer Carboxylic Acid, 3:3- | 3:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorohexanoic acid) (3:3 FTCA) |
| Fluorotelomer Carboxylic Acid, 5:3- | 5:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorooctanoic acid) (5:3 FTCA) |
| Fluorotelomer Carboxylic Acid, 7:3- | 7:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorodecanoic acid) (7:3 FTCA) |
| Fluorotelomer Carboxylic Acid-13C2, 10:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 10:2-Fluorotelomer Carboxylic Acid-13C2 (2-Perfluorodecyl Ethanoic Acid-13C2) (10:2 FTCA-13C2) |
| Fluorotelomer Carboxylic Acid-13C2, 6:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 6:2-Fluorotelomer Carboxylic Acid-13C2 (2-Perfluorohexyl Ethanoic Acid-13C2) (6:2 FTCA-13C2) |
| Fluorotelomer Carboxylic Acid-13C2, 8:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 8:2-Fluorotelomer Carboxylic Acid-13C2 (2-Perfluorooctyl Ethanoic Acid-13C2) (8:2 FTCA-13C2) |
| Fluorotelomer Phosphate Diester, 10:2- | 10:2-Fluorotelomer Phosphate Diester (10:2 diPAP) |
| Fluorotelomer Phosphate Diester, 6:2/8:2- | 6:2/8:2 Fluorotelomer Phosphate Diester (6:2/8:2-diPAP) |
| Fluorotelomer Unsaturated Carboxylic Acid, 10:2- | 10:2-Fluorotelomer Unsaturated Carboxylic Acid (FTuCA) |
| Fluorotelomer Unsaturated Carboxylic Acid, 6:2- | 6:2-Fluorotelomer Unsaturated Carboxylic Acid (FTuCA) |
| Fluorotelomer Unsaturated Carboxylic Acid, 8:2- | 8:2-Fluorotelomer Unsaturated Carboxylic Acid (FTuCA) |
| Fluorotelomer Unsaturated Carboxylic Acid-13C2, 10:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 10:2-Fluorotelomer Unsaturated Carboxylic Acid-13C2 (2H-Perfluoro-2-Dodecenoic Acid-13C2) (10:2 FTuCA-13C2) |
| Fluorotelomer Unsaturated Carboxylic Acid-13C2, 10:2-(Surrogate) | Surrogate: 10:2-Fluorotelomer Unsaturated Carboxylic Acid-13C2 |
| Fluorotelomer Unsaturated Carboxylic Acid-13C2, 6:2-(Surrogate) | Surrogate: 6:2-Fluorotelomer Unsaturated Carboxylic Acid-13C2 |
| Fluorotelomer Unsaturated Carboxylic Acid-13C2, 8:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 8:2-Fluorotelomer Unsaturated Carboxylic Acid-13C2 (2H-Perfluoro-2-Decenoic Acid-13C2) (8:2 FTuCA-13C2) |
| Fluoxastrobin | Fluoxastrobin |
| Fluoxetine | Fluoxetine |
| Fluoxetine-d5(Surrogate) | Surrogate: Fluoxetine-d5 |
| Flupyradifurone | Flupyradifurone |
| Fluridone | Fluridone |
| Fluridone(Surrogate) | Surrogate: Fluridone |
| Flusilazole | Flusilazole |
| Fluticasone Propionate | Fluticasone Propionate |
| Flutolanil | Flutolanil |
| Flutriafol | Flutriafol |
| Fluvalinate | Fluvalinate |
| Fluxapyroxad | Fluxapyroxad |
| Foam Ball | Foam Ball |
| Foliose Algae | Foliose Algae |
| Folpet | Folpet |
| Fonofos | Fonofos (Dyfonate) |
| Fonofos(Surrogate) | Surrogate: Fonofos |
| Fonofos-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Fonofos-13C6 |
| Food Service | Food Service |
| Food Service, Other | Food Service, Other |
| Forest Dominant Age Class | Forest Dominant Age Class |
| Formaldehyde | Formaldehyde (Methanal) |
| Formate | Formate |
| Formate(Surrogate) | Surrogate: Formate |
| Formetanate hydrochloride | Formetanate hydrochloride |
| Fosetyl-al, Technical | Fosetyl-aluminum, Technical |
| FPOM | Fine particulate organic matter |
| Furniture | Furniture |
| Furosemide | Furosemide |
| Gadolinium | Gadolinium |
| Gage Height | Water surface level measured against a staff gage within a given waterbody |
| Galaxolide | Galaxolide |
| Galaxolide-d6(Surrogate) | Galaxolide-d6(Surrogate) |
| Gallium | Gallium |
| Garbage Bag of Trash | Garbage Bag of Trash |
| Gasoline | Gasoline |
| Gasterosteus aculeatus (Gaac) | Gasterosteus aculeatus, Assay name: Gaac, 5’ ACGCCACCTTAACACGTTTC 3’, 5’ AGAGCCTGTCTGGTGAAGG 3’, 5FAM-CTGGTGCCACACTTGTTCAC-3IABkFQ |
| Gemfibrozil | Gemfibrozil |
| Gemfibrozil-d6(IsoDilAnalogue) | Isotope Dilution Analogue: Gemfibrozil-d6 |
| Gemfibrozil-d6(Surrogate) | Surrogate: Gemfibrozil-d6 |
| Geosmin | Geosmin |
| Germination | Germination (%) |
| Giardia | Giardia |
| Giardia Cysts Fluorescence Antibody | Giardia Cysts Fluorescence Antibody |
| Giardia Cysts Negative | Giardia Cysts Negative |
| Giardia Cysts/Amorphous Structure | Giardia Cysts/Amorphous Structure |
| Giardia Cysts/DAPI & DIC Positive | Giardia Cysts/DAPI & DIC Positive |
| Giardia Cysts/Empty | Giardia Cysts/Empty |
| Giardia Cysts/Flourescence Antibody | Giardia Cysts/Flourescence Antibody |
| Giardia Cysts/Internal Structure | Giardia Cysts/Internal Structure |
| Giardia Cysts/Internal Structure (>One) | Giardia Cysts/Internal Structure (>One) |
| Giardia Cysts/Internal Structure (One) | Giardia Cysts/Internal Structure (One) |
| Giardia Cysts/Internal Structures (>One) | Giardia Cysts/Internal Structures (>One) |
| Giardia Cysts/Negative | Giardia Cysts/Negative |
| Giardia Cysts/Positive | Giardia Cysts/Positive |
| Giardia Cysts/Positive (Internal Staining) | Giardia Cysts/Positive (Internal Staining) |
| Giardia Cysts/Positive (Stained Nuclei) | Giardia Cysts/Positive (Stained Nuclei) |
| Giardia Cysts/Total IFA Count | Giardia Cysts/Total IFA Count |
| Glass | Glass using Trash Protocol |
| Glass Foam | Glass Foam |
| Glass fragment | Glass fragment |
| Glass Servicewear | Glass Servicewear |
| Glass Shard | Glass Shard |
| Glass sphere | Glass sphere |
| Glide | Glide |
| Glide/Pool Bank Stability | Glide/Pool Bank Stability (used for EMAP RBP 20-score habitat characterization) |
| Glide/Pool Channel Alteration | Glide/Pool Channel Alteration |
| Glide/Pool Channel Flow Status | Glide/Pool Channel Flow Status |
| Glide/Pool Channel Sinuosity | Glide/Pool Channel Sinuosity |
| Glide/Pool Epifaunal Substrate | Glide/Pool Epifaunal Substrate |
| Glide/Pool Pool Substrate | Glide/Pool Pool Substrate |
| Glide/Pool Pool Variability | Glide/Pool Pool Variability |
| Glide/Pool Riparian Zone Width | Glide/Pool Riparian Zone Width |
| Glide/Pool Sediment Deposition | Glide/Pool Sediment Deposition |
| Glide/Pool Vegetative Protection | Glide/Pool Vegetative Protection |
| Glipizide | Glipizide |
| Glipizide-d11(Surrogate) | Surrogate: Glipizide-d11 |
| Glufosinate | Glufosinate |
| Glyburide | Glyburide |
| Glyburide-d3(Surrogate) | Surrogate: Glyburide-d3 |
| Glyoxal | Glyoxal (Oxaldehyde)(Ethanedial) |
| Glyphosate | Glyphosate |
| Glyphosate, isopropylamine salt | Glyphosate, isopropylamine salt |
| Gold | Gold |
| Golf Course/Parks/Sports Fields Extent | Golf Course/Parks/Sports Fields Extent |
| Golf Course/Parks/Sports Fields Intensity | Golf Course/Parks/Sports Fields Intensity |
| Golf Course/Parks/Sports Fields Proximity | Golf Course/Parks/Sports Fields Proximity |
| Gonad Index CI Mean | Gonad Index CI Mean |
| Gonad Index Standard Error | Gonad Index Standard Error |
| Grading/Compaction Extent | Grading/Compaction Extent |
| Grading/Compaction Intensity | Grading/Compaction Intensity |
| Grading/Compaction Proximity | Grading/Compaction Proximity |
| Granule | Granule |
| Granule + Pebble | Granule + Pebble |
| Gravel | Gravel |
| Grazing_Recent | Evidence of grazing activiy by cattle within the past year |
| Gross Alpha | Gross Alpha |
| Gross Beta | Gross Beta |
| Groundwater Extraction Extent | Groundwater Extraction Extent |
| Groundwater Extraction Intensity | Groundwater Extraction Intensity |
| Groundwater Extraction Proximity | Groundwater Extraction Proximity |
| Growth (ash-free dry wt/surv indiv) | Growth (ash-free dry weight/surviving individual) |
| Growth (Chlorophyll a fluorescence) | Growth (Chlorophyll a fluorescence) |
| Growth (Chlorophyll a) | Growth (Chlorophyll a) |
| Growth (gonad) | Growth (gonad) |
| Growth (length head capsule) | Growth (length head capsule) |
| Growth (length) | Growth (length) |
| Growth (weight) | Growth (weight) |
| Growth (wt/surv indiv) | Growth (weight/surviving individual) |
| Growth Ratio | Growth Ratio (final measurement / initial measurement) |
| Growth Standard Error | Growth Standard Error |
| H_AqHab | Shannon diversity of natural instream cover types physical-habitat metric |
| H_SubNat | Shannon diversity of natural substrate types physical-habitat metric |
| HabitatType | HabitatType |
| Halauxifen-methyl | Halauxifen-methyl |
| Halofenozide | Halofenozide |
| Halosulfuron Methyl | Halosulfuron Methyl |
| Hard Plastic Piece, non-specific | Hard Plastic Piece, non-specific |
| Hardened Features Other Extent | Hardened Features Other Extent |
| Hardened Features Other Intensity | Hardened Features Other Intensity |
| Hardened Features Other Proximity | Hardened Features Other Proximity |
| Hardness as CaCO3 | Hardness as CaCO3 |
| Hatchability | Hatchability (%) |
| Hay Extent | Hay Extent |
| Hay Intensity | Hay Intensity |
| Hay Proximity | Hay Proximity |
| HCH, alpha- | alpha-Hexachlorocyclohexane (HCH) (alpha-BHC) |
| HCH, alpha-(Surrogate) | Surrogate: alpha-Hexachlorocyclohexane (HCH) (alpha-BHC) |
| HCH, beta- | beta-Hexachlorocyclohexane (HCH) (beta-BHC) |
| HCH, beta-(Surrogate) | Surrogate: beta-Hexachlorocyclohexane (HCH) (beta-BHC) |
| HCH, delta- | delta-Hexachlorocyclohexane (HCH) (delta-BHC) |
| HCH, delta-(Surrogate) | Surrogate: delta-Hexachlorocyclohexane (HCH) (delta-BHC) |
| HCH, gamma- | gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane) |
| HCH, gamma-(Surrogate) | Surrogate: gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane) |
| HCH, gamma-/PCB 015/17/18 | gamma-HCH/PCB 15/17/18 |
| HCH, gamma-/PCB 015/18 | gamma-HCH/PCB 15/18 |
| HCH, gamma-/PCB 015/19 | gamma-HCH/PCB 15/19 |
| HCH, gamma-/PCB 015/20 | gamma-HCH/PCB 15/20 |
| HCH, gamma-/PCB 015/21 | gamma-HCH/PCB 15/21 |
| HCH, gamma-/PCB 015/22 | gamma-HCH/PCB 15/22 |
| HCH, gamma-/PCB 015/23 | gamma-HCH/PCB 15/23 |
| HCH, gamma-/PCB 015/24 | gamma-HCH/PCB 15/24 |
| HCH, gamma-/PCB 015/25 | gamma-HCH/PCB 15/25 |
| HCH, gamma-/PCB 015/26 | gamma-HCH/PCB 15/26 |
| HCH-13C6, alpha-(IsoDilAnalogue) | Isotope Dilution Analogue: alpha-Hexachlorocyclohexane-13C6 (HCH) (alpha-BHC) |
| HCH-13C6, alpha-(IsoDilAnalogues) | Isotope Dilution Analogue: alpha-Hexachlorocyclohexane-13C6 (HCH) (alpha-BHC) |
| HCH-13C6, beta-(IsoDilAnalogues) | Isotope Dilution Analogue: beta-Hexachlorocyclohexane-13C6 (HCH) (beta-BHC) |
| HCH-13C6, delta-(IsoDilAnalogue) | Isotope Dilution Analogue: delta-Hexachlorocyclohexane-13C6 (HCH) (delta-BHC) |
| HCH-13C6, gamma-(IsoDilAnalogue) | Isotope Dilution Analogue: gamma-Hexachlorocyclohexane-13C6 (HCH) (gamma-BHC) (Lindane) |
| HCH-d6, gamma-(IsoDilAnalogue) | Isotope Dilution Analogue: HCH-d6, gamma- |
| HCH-d6, gamma-(Surrogate) | Surrogate: gamma-Hexachlorocyclohexane-d6 (HCH-d6) (gamma-BHC-d6) (Lindane-d6) |
| Heavy Urban Other Extent | Heavy Urban Other Extent |
| Heavy Urban Other Intensity | Heavy Urban Other Intensity |
| Heavy Urban Other Proximity | Heavy Urban Other Proximity |
| Helicobacter, Avian (GFD) | Avian Helicobacter, Assay name: GFD, 5'-TCGGCTGAGCACTCTAGGG-3', 5'-GCGTCTCTTTGTACATCCCA-3' |
| Heneicosane, n- | n-Heneicosane |
| Hentriacontane, n- | n-Hentriacontane |
| Hepatitis A Virus | Hepatitis A Virus |
| Heptachlor | Heptachlor |
| Heptachlor Epoxide | Heptachlor Epoxide |
| Heptachlor Epoxide(Surrogate) | Surrogate: Heptachlor Epoxide |
| Heptachlor Epoxide, cis- | cis-Heptachlor Epoxide |
| Heptachlor Epoxide, trans- | trans-Heptachlor Epoxide |
| Heptachlor Epoxide/Oxychlordane | Heptachlor Epoxide/Oxychlordane |
| Heptachlor Epoxide-13C10(IsoDilAnalogue) | Isotope Dilution Analogue: Heptachlor Epoxide-13C10 |
| Heptachlor Epoxide-13C10(Surrogate) | Surrogate: Heptachlor Epoxide-13C10 |
| Heptachlor Epoxide-13C10, cis-(Surrogate) | Surrogate: cis-Heptachlor Epoxide-13C10 |
| Heptachlor(Surrogate) | Surrogate: Heptachlor |
| Heptachlor-13C10(IsoDilAnalogue) | Isotope Dilution Analogue: Heptachlor-13C10 |
| Heptachlor-13C10(Surrogate) | Surrogate: Heptachlor-13C10 |
| Heptachlorobenzene | Heptachlorobenzene |
| Heptacosane, n- | n-Heptacosane |
| Heptadecane, n- | n-Heptadecane |
| Hexa(Methoxymethyl)Melamine | Hexa(Methoxymethyl)Melamine (HMMM) |
| Hexabromobenzene | Hexabromobenzene (HBBZ) |
| Hexabromobenzene-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Hexabromobenzene-13C6 (HBB-13C6) |
| Hexabromocyclododecane, alpha- | alpha-Hexabromocyclododecane (alpha-HBCDD) |
| Hexabromocyclododecane, alpha-(Surrogate) | Surrogate: alpha-Hexabromocyclododecane (HBCDD) |
| Hexabromocyclododecane, beta- | beta-Hexabromocyclododecane (beta-HBCDD) |
| Hexabromocyclododecane, gamma- | gamma-Hexabromocyclododecane (gamma-HBCDD) |
| Hexabromocyclododecane, Total | Total Hexabromocyclododecane (HBCDD) |
| Hexabromocyclododecane-13C12(Surrogate) | Surrogate: Hexabromocyclododecane-13C12 (HBCDD) |
| Hexachloro(phenyl)norbornene | Hexachloro(phenyl)norbornene (HCPN) |
| Hexachlorobenzene | Hexachlorobenzene |
| Hexachlorobenzene(Surrogate) | Surrogate: Hexachlorobenzene |
| Hexachlorobenzene-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Hexachlorobenzene-13C6 |
| Hexachlorobenzene-13C6(Surrogate) | Surrogate: Hexachlorobenzene-13C6 |
| Hexachlorobutadiene | Hexachlorobutadiene |
| Hexachlorocyclopentadiene | Hexachlorocyclopentadiene (HCCPD) |
| Hexachlorocyclopentadienyldibromocyclooctane | Hexachlorocyclopentadienyldibromocyclooctane (HCDBCO) |
| Hexachloroethane | Hexachloroethane |
| Hexacosane, n- | n-Hexacosane |
| Hexadecane, n- | n-Hexadecane |
| Hexafluoropropylene Oxide Dimer Acid | Hexafluoropropylene Oxide Dimer Acid (HFPO-DA) |
| Hexafluoropropylene Oxide Dimer Acid-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Hexafluoropropylene Oxide Dimer Acid-13C3 (HFPO-DA-13C3) |
| Hexahydro-1,3,5-trinitro-1,3,5-triazine | Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) |
| Hexanone, 2- | 2-Hexanone |
| Hexazinone | Hexazinone |
| High Concentration of Salts Extent | High Concentration of Salts Extent |
| High Concentration of Salts Intensity | High Concentration of Salts Intensity |
| High Concentration of Salts Proximity | High Concentration of Salts Proximity |
| High density polyethylene fragment | HDPE fragment, that can be grouped under plastic category |
| Highway >2 lanes Extent | Highway >2 lanes Extent |
| Highway >2 lanes Intensity | Highway >2 lanes Intensity |
| Highway >2 lanes Proximity | Highway >2 lanes Proximity |
| Hiking Trails | Hiking Trails |
| Holmium | Holmium |
| Homeless Encampment, Distance from Transect | Homeless Encampment, Distance from Transect |
| Homeless Encampment, Distance from Transect Downstream | Homeless Encampment, Distance from Transect Downstream |
| Homeless Encampment, Distance from Transect Upstream | Homeless Encampment, Distance from Transect Upstream |
| Homeless Encampment, Within Transect | Homeless Encampment, Within Transect |
| Homoanatoxin-a | Homoanatoxin-a |
| Hopane, C29- | C29-Hopane |
| Hopane, C30- | C30-Hopane |
| Horses Extent | Horses Extent |
| Horses Intensity | Horses Intensity |
| Horses Proximity | Horses Proximity |
| Hose Piece | Hose Piece |
| Household | Household |
| Household, Other | Household, Other |
| HpCDD, 1,2,3,4,6,7,8- | 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD) |
| HpCDD, 1,2,3,4,6,7,8-(Surrogate) | Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD) |
| HpCDD-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin-13C12 (HpCDD-13C12) |
| HpCDF, 1,2,3,4,6,7,8- | 1,2,3,4,6,7,8-Heptachlorodibenzofuran (HpCDF) |
| HpCDF, 1,2,3,4,6,7,8-(Surrogate) | Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran |
| HpCDF, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Heptachlorodibenzofuran |
| HpCDF, 1,2,3,4,7,8,9- | 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF) |
| HpCDF, 1,2,3,4,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF) |
| HpCDF-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,6,7,8-Heptachlorodibenzofuran-13C12 (HpCDF-13C12) |
| HpCDF-13C12, 1,2,3,4,7,8,9-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,7,8,9-Heptachlorodibenzofuran-13C12 (HpCDF-13C12) |
| Human Adenovirus | |
| Human Norovirus GI | |
| Human Norovirus GII | |
| Human Waste/Diaper | Human Waste/Diaper |
| HumanHealth | HumanHealth using Trash Protocol |
| HxCDD, 1,2,3,4,7,8- | 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) |
| HxCDD, 1,2,3,4,7,8-(Surrogate) | Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) |
| HxCDD, 1,2,3,6,7,8- | 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) |
| HxCDD, 1,2,3,6,7,8-(Surrogate) | Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) |
| HxCDD, 1,2,3,7,8,9- | 1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin (HxCDD) |
| HxCDD-13C12, 1,2,3,4,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD-13C12) |
| HxCDD-13C12, 1,2,3,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD-13C12) |
| HxCDD-13C12, 1,2,3,7,8,9-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD) |
| HxCDF, 1,2,3,4,7,8- | 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF) |
| HxCDF, 1,2,3,4,7,8-(Surrogate) | Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF) |
| HxCDF, 1,2,3,6,7,8- | 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF) |
| HxCDF, 1,2,3,6,7,8-(Surrogate) | Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF) |
| HxCDF, 1,2,3,7,8,9- | 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF) |
| HxCDF, 1,2,3,7,8,9-(Surrogate) | Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF) |
| HxCDF, 2,3,4,6,7,8- | 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF) |
| HXCDF, 2,3,4,6,7,8-(Surrogate) | Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF) |
| HxCDF-13C12, 1,2,3,4,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,7,8-Hexachlorodibenzofuran-13C12 (HxCDF-13C12) |
| HxCDF-13C12, 1,2,3,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,6,7,8-Hexachlorodibenzofuran-13C12 (HxCDF-13C12) |
| HxCDF-13C12, 1,2,3,7,8,9-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,7,8,9-Hexachlorodibenzofuran-13C12 (HxCDF-13C12) |
| HxCDF-13C12, 2,3,4,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,4,6,7,8-Hexachlorodibenzofuran-13C12 (HxCDF-13C12) |
| Hydramethylnon | Hydramethylnon |
| Hydraulic Height | Height from bottom of stream to top of bankfull height or the summation of station water depth and bankfull height |
| Hydrochlorothiazide | Hydrochlorothiazide |
| Hydrocodone | Hydrocodone |
| Hydrocodone-d3(Surrogate) | Surrogate: Hydrocodone-d3 |
| Hydrocortisone | Hydrocortisone |
| Hydrocortisone-d4(Surrogate) | Surrogate: Hydrocortisone-d4 |
| Hydrogen Sulfide | Hydrogen Sulfide |
| Hydrolyzable Phosphorus + Orthophosphate as P | Hydrolyzable Phosphorus + Orthophosphate as P |
| Hydroperiod | Hydroperiod of the waterbody |
| Hydroxide | Hydroxide |
| Hydroxide Alkalinity as CaCO3 | Hydroxide Alkalinity as CaCO3 |
| Hydroxy-amitriptyline, 10- | 10-Hydroxy-amitriptyline |
| Hydroxyatrazine, 2- | 2-Hydroxyatrazine |
| Hydroxycarbofuran, 3- | 3-Hydroxycarbofuran |
| Hydroxydicamba, 5- | 5-Hydroxydicamba |
| Hydroxy-ibuprofen, 2- | 2-Hydroxy-ibuprofen |
| Hydroxy-Imidacloprid, 5- | 5-Hydroxy-Imidacloprid |
| Hydroxypropanal, 3- | 3-Hydroxypropanal |
| IBI | Score for the Index of Biotic Integrity (IBI) |
| Ibuprofen | Ibuprofen |
| Ibuprofen-13C3(Surrogate) | Surrogate: Ibuprofen-13C3 |
| Ibuprofen-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Ibuprofen-d3 |
| Imazalil | Imazalil |
| Imazamox | Imazamox |
| Imazapyr | Imazapyr |
| Imazaquin | Imazaquin |
| Imazethapyr | Imazethapyr |
| Imidacloprid | Imidacloprid |
| Imidacloprid guanidine | Imidacloprid guanidine |
| Imidacloprid guanidine olefin | Imidacloprid guanidine olefin |
| Imidacloprid olefin | Imidacloprid olefin |
| Imidacloprid urea | Imidacloprid urea |
| Imidacloprid-d4(Surrogate) | Surrogate: Imidacloprid-d4 |
| Imidaclothiz | Imidaclothiz |
| Incised Height | Incised Height |
| Increment | Increment |
| Indaziflam | Indaziflam |
| Indeno(1,2,3-c,d)pyrene | Indeno(1,2,3-c,d)pyrene |
| Indeno(1,2,3-c,d)pyrene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Indeno(1,2,3-c,d)pyrene-d12 |
| Indeno(1,2,3-c,d)pyrene-d12(Surrogate) | Surrogate: Indeno(1,2,3-c,d)pyrene-d12 |
| Indole | Indole |
| Indoxacarb | Indoxacarb |
| Industrial Extent | Industrial Extent |
| Industrial Intensity | Industrial Intensity |
| Industrial Plants | Industrial Plants |
| Industrial Proximity | Industrial Proximity |
| Industrial Water Quality Other Extent | Industrial Water Quality Other Extent |
| Industrial Water Quality Other Intensity | Industrial Water Quality Other Intensity |
| Industrial Water Quality Other Proximity | Industrial Water Quality Other Proximity |
| Inorganic natural material | Inorganic natural material, including rock and minerals |
| Inorganic Natural Material Fiber | Inorganic natural material Fiber |
| Inorganic Natural Material Film | Inorganic natural material Film |
| Inorganic Natural Material Foam | Inorganic natural material Foam |
| Inorganic Natural Material Fragment | Inorganic natural material Fragment |
| Inorganic Natural Material Sphere | Inorganic natural material Sphere |
| Instream Plant Cover | Instream Plant Cover |
| IntertidalSubstrateCharacteristics_Mud | IntertidalSubstrateCharacteristics_Mud |
| IntertidalSubstrateCharacteristics_Rocky | IntertidalSubstrateCharacteristics_Rocky |
| IntertidalSubstrateCharacteristics_Sand | IntertidalSubstrateCharacteristics_Sand |
| IntertidalSubstrateCharacteristics_Vegetated | IntertidalSubstrateCharacteristics_Vegetated |
| Invasive Plants Extent | Invasive Plants Extent |
| Invasive Plants Intensity | Invasive Plants Intensity |
| Invasive Plants Proximity | Invasive Plants Proximity |
| Iodomethane | Iodomethane |
| Iohexol | Iohexol |
| Iopromide | Iopromide |
| Iopromide-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Iopromide-d3 |
| Ioxynil | Ioxynil |
| Ipconazole | Ipconazole |
| IPI | Score for the Index of Physical-habitat Integrity (IPI) |
| IPI_Ev_FlowHab_qa | Quality assurance metric for the evenness of flow habitat types physical-habitat metric, calculated as the percent of expected measurements present in the input data |
| IPI_Ev_FlowHab_score | Scored evenness of flow habitat types physical-habitat metric |
| IPI_H_AqHab_pred | Predicted Shannon diversity of natural instream cover types physical-habitat metric |
| IPI_H_AqHab_qa | Quality assurance metric for the Shannon diversity of natural instream cover types physical-habitat metric, calculated as the percent of expected measurements present in the input data |
| IPI_H_AqHab_score | Scored Shannon diversity of natural instream cover types physical-habitat metric |
| IPI_H_SubNat_qa | Quality assurance metric for the Shannon diversity of natural substrate types physical-habitat metric, calculated as the percent of expected measurements present in the input data |
| IPI_H_SubNat_score | Scored Shannon diversity of natural substrate types physical-habitat metric |
| IPI_IPI_qa | Quality assurance metric for the Index of Physical-habitat Integrity score, calculated as the minimum of other quality assurance metric values |
| IPI_PCT_SAFN_pred | Predicted percent sands and fines streambed substrate physical-habitat metric |
| IPI_PCT_SAFN_qa | Quality assurance metric for the percent sands and fines physical-habitat metric, calculated as the percent of expected measurements present in the input data |
| IPI_PCT_SAFN_score | Scored percent sands and fines streambed substrate physical-habitat metric |
| IPI_XCMG_pred | Predicted riparian cover as sum of three layers physical-habitat metric |
| IPI_XCMG_qa | Quality assurance metric for the riparian cover metric, calculated as the percent of expected measurements present in the input data |
| IPI_XCMG_score | Scored riparian cover as sum of three layers physical-habitat metric |
| Iprodione | Iprodione |
| IQ Test - Fluorescence (EC50) | IQ Test - Fluorescence (EC50) |
| Iron | Iron |
| Irrigation Equipment | Irrigation Equipment |
| Isoborneol | Isoborneol |
| Isobutylparaben | Isobutylparaben |
| Isodecyl Diphenyl Phosphate | Isodecyl Diphenyl Phosphate |
| Isodrin | Isodrin |
| Isodrin-13C12(Surrogate) | Surrogate: Isodrin-13C12 |
| Isofenphos | Isofenphos |
| Isofetamid | Isofetamid |
| Isophorone | Isophorone |
| Isopropalin | Isopropalin |
| Isopropyl Alcohol | Isopropyl Alcohol (2-propanol) |
| Isopropylbenzene | Isopropylbenzene (Cumene) |
| Isopropylphenyl Diphenyl Phosphate | Isopropylphenyl Diphenyl Phosphate |
| Isopropylphenyl Diphenyl Phosphate, 2- | 2-Isopropylphenyl Diphenyl Phosphate (2IPPDPP) |
| Isopropylphenyl Diphenyl Phosphate-d10, 2-(IsoDilAnalogue) | Isotope Dilution Analogue: 2-Isopropylphenyl Diphenyl Phosphate-d10 (2IPPDPP-d10) |
| Isopropyltoluene, p- | p-Isopropyltoluene |
| Isoproturon | Isoproturon |
| Isoquinoline | Isoquinoline |
| Isotopes | Isotopes |
| Isoxaben | Isoxaben (Flexidor) (Gallery) |
| Isoxaben(Surrogate) | Surrogate: Isoxaben (Flexidor) (Gallery) |
| ITEQ | International Toxic Equivalent (ITEQ) |
| Jasmolin-1 | Jasmolin-1 (Jasmolin I) |
| Jasmolin-2 | Jasmolin-2 (Jasmolin II) |
| Kelp holdfast | Kelp holdfast |
| Kelp Stipe/Blade | Kelp Stipe/Blade |
| Kepone | Kepone (Chlordecone) |
| Ketocarbofuran phenol, 3- | 3-ketocarbofuran phenol |
| Ketocarbofuran, 3- | 3-Ketocarbofuran |
| Ketoprofen | Ketoprofen |
| Ketorolac | Ketorolac |
| Keyboard | Keyboard |
| Kresoxim-methyl | Kresoxim-methyl |
| Lachnospiraceae, Canine (DG37) | Canine Lachnospiraceae, Assay name: DG37, 5'-TTTTCTCCCACGGTCATCTG-3', 5'-CTTGGTTATGGGCGACATTG-3' |
| Landfill Extent | Landfill Extent |
| Landfill Intensity | Landfill Intensity |
| Landfill Proximity | Landfill Proximity |
| Lanthanum | Lanthanum |
| Large | Large using Trash Protocol |
| Large/Unmovable, Other | Large/Unmovable, Other |
| Larval abnormality | Larval abnormality |
| Lead | Lead |
| Length | Length |
| Length Downstream | Length Downstream from X location |
| Length Pool | Length Pool |
| Length Reach | Length Reach |
| Length Riffle | Length Riffle |
| Length Root | Length Root |
| Length Shoot | Length Shoot |
| Length Upstream | Length Upstream from X location |
| Length, Segment | Segment Length |
| Leptophos | Leptophos |
| Level Of Trash | Level Of Trash using Trash Protocol |
| Lid | Lid |
| Lidocaine | Lidocaine |
| Light Urban Other Extent | Light Urban Other Extent |
| Light Urban Other Intensity | Light Urban Other Intensity |
| Light Urban Other Proximity | Light Urban Other Proximity |
| Lighter | Lighter |
| Liming | Liming |
| Limonene, d- | d-Limonene |
| Lincomycin | Lincomycin |
| Linuron | Linuron |
| Linuron-d6(Surrogate) | Surrogate: Linuron-d6 |
| Lipid | Lipid |
| Lithium | Lithium |
| Littering | Littering using Trash Protocol |
| Live young | Live young (#) |
| Livestock Use | Livestock Use |
| Logging | Logging |
| Lomefloxacin | Lomefloxacin |
| Loss On Ignition | Loss On Ignition (LOI) |
| Low density polyethylene fragment | LDPE fragment, that can be grouped under plastic category |
| LWD >0.8 DLE, Length >15m | LWD >0.8 DLE, Length >15m |
| LWD >0.8m DLE, Length 1.5-5m | LWD >0.8m DLE, Length 1.5-5m |
| LWD >0.8m DLE, Length 5-15m | LWD >0.8m DLE, Length 5-15m |
| LWD 0.1-<0.3m DLE, Length >15m | LWD 0.1-<0.3m DLE, Length >15m |
| LWD 0.1-<0.3m DLE, Length 1.5-5m | LWD 0.1-<0.3m DLE, Length 1.5-5m |
| LWD 0.1-<0.3m DLE, Length 5-15m | LWD 0.1-<0.3m DLE, Length 5-15m |
| LWD 0.3-<0.6m DLE, Length >15 | LWD 0.3-<0.6m DLE, Length >15 |
| LWD 0.3-<0.6m DLE, Length 1.5-5m | LWD 0.3-<0.6m DLE, Length 1.5-5m |
| LWD 0.3-<0.6m DLE, Length 5-15m | LWD 0.3-<0.6m DLE, Length 5-15m |
| LWD 0.6-<0.8m DLE, Length >15m | LWD 0.6-<0.8m DLE, Length >15m |
| LWD 0.6-<0.8m DLE, Length 1.5-5m | LWD 0.6-<0.8m DLE, Length 1.5-5m |
| LWD 0.6-<0.8m DLE, Length 5-15 | LWD 0.6-<0.8m DLE, Length 5-15 |
| LWD A | Large Woody Debris in the A class of corresponding Diameter and Length categories |
| LWD L | Large Woody Debris in the L class of corresponding Diameter and Length categories |
| LWD M | Large Woody Debris in the M class of corresponding Diameter and Length categories |
| LWD S | Large Woody Debris in the S class of corresponding Diameter and Length categories |
| LWD T | Large Woody Debris in the T class of corresponding Diameter and Length categories |
| Lyngbyatoxin-a | Lyngbyatoxin-a |
| Macroalgae Cover, Attached | Presence/Absence of attached macroalgae at a point along a transect |
| Macroalgae Cover, Unattached | Presence/Absence of unattached macroalgae at a point along a transect |
| Macroinvertebrate Habitat Patch Richness Metric | Metric assesses macroinvertebrate habitat patch richness along the channel edge and bank within the assessment area. |
| Macrophyte Cover | Presence/Absence of macrophytes at a point along a transect |
| Magnesium | Magnesium |
| Maintained Lawns | Maintained Lawns |
| Malachite Green | Malachite Green |
| Malaoxon | Malaoxon |
| Malathion | Malathion |
| Maleic hydrazide | Maleic hydrazide |
| Male-specific F+ Coliphage (E. coli Famp) | Male-specific F+ coliphages, Host Bacterium Strain: E. coli Famp |
| Malonate(Surrogate) | Surrogate: Malonate |
| M-AMBI | Score for Multivariate AZTI Marine Biotic Index (M-AMBI) |
| Mancozeb | Mancozeb |
| Mandestrobin | Mandestrobin |
| Mandipropamid | Mandipropamid |
| Maneb | Maneb |
| Manganese | Manganese |
| Marbon CNB 23010-1 | Marbon CNB 23010 (VCH-DP isomer 1) |
| Marbon CNB 23010-2 | Marbon CNB 23010 (VCH-DP isomer 2) |
| Marine, Other | Marine, Other |
| Mature | Mature (%) |
| Mature females | Mature females (%) |
| MBAS | MBAS (Methylene Blue Active Substances) |
| MCPA | MCPA (2-Methyl-4-chlorophenoxy)Acetic Acid) (2,4-MCPA) |
| MCPA, alkanolamine salt | MCPA, alkanolamine salt |
| MCPA, butoxyethanol ester | MCPA, butoxyethanol ester |
| MCPA, dimethylamine salt | MCPA, dimethylamine salt |
| MCPA, isooctyl ester | MCPA, isooctyl ester |
| MCPA, sodium salt | MCPA, sodium salt |
| MCPP | MCPP (2-(2-Methyl-4-chlorophenoxy) Propionic Acid) |
| MCPP, diethanolamine salt | MCPP, diethanolamine salt |
| MCPP, dimethylamine salt | MCPP, dimethylamine salt |
| MCPP, potassium salt | MCPP, potassium salt |
| Mean Grain Size | Mean Grain Size |
| Mean Growth (Ash Free Dry Weight) | Mean Growth (Ash Free Dry Weight) |
| Mean Percent Normal Alive | The observed number of normal larvae divided by the mean number of live embryos inoculated at the beginning of the test |
| Mechanical Pencil | Mechanical Pencil |
| Meclofenamic Acid | Meclofenamic Acid |
| Median Effective Concentration | Median Effective Concentration |
| Median Grain Size | Median Grain Size |
| Median Inhibatory Concentration | Median Inhibatory Concentration |
| Medical Device | Medical Device |
| Menthol | Menthol |
| Meprobamate | Meprobamate |
| Mercuric Chloride | Mercuric Chloride |
| Mercury | Mercury |
| Mercury (II)R | Reactive Mercury |
| Mercury, Acid Labile | Acid Labile Mercury |
| Mercury, Extract Fraction 1 | Mercury selective sequential extraction, Fraction 1 |
| Mercury, Extract Fraction 2 | Mercury selective sequential extraction, Fraction 2 |
| Mercury, Extract Fraction 3 | Mercury selective sequential extraction, Fraction 3 |
| Mercury, Extract Fraction 4 | Mercury selective sequential extraction, Fraction 4 |
| Mercury, Extract Fraction 5 | Mercury selective sequential extraction, Fraction 5 |
| Mercury, Methyl | Methyl Mercury |
| Merphos | Merphos (Tributylphosphorotrithioite) |
| Mesh Size | Mesh Size |
| Metabolite B | Metabolite B (metabolite of Benzobicyclon) |
| Metal | Metal using Trash Protocol |
| Metal Object | Metal Object |
| Metal Pipe/Bar | Metal Pipe/Bar |
| Metal, Other | Metal, Other |
| Metalaxyl | Metalaxyl |
| Metalaxyl-hydroxymethyl | Metalaxyl-hydroxymethyl |
| Metaldehyde | Metaldehyde |
| Metam-Sodium | Metam-Sodium |
| Metazachlor | Metazachlor |
| Metconazole | Metconazole |
| MeterAveragingInterval | Time period (seconds) upon which the meter reading is averaged internally to attain a result |
| Metformin | Metformin |
| Metformin-d6(Surrogate) | Surrogate: Metformin-d6 |
| Methadone | Methadone |
| Methamidophos | Methamidophos (O,S-Dimethyl thiophosphate) |
| Methidathion | Methidathion |
| Methidathion oxon | Methidathion oxon |
| Methiocarb | Methiocarb |
| Methiocarb sulfone | Methiocarb sulfone |
| Methiocarb sulfoxide | Methiocarb sulfoxide |
| Methomyl | Methomyl |
| Methoprene | Methoprene |
| Methoxychlor | Methoxychlor |
| Methoxychlor(Surrogate) | Surrogate: Methoxychlor |
| Methoxychlor-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Methoxychlor-13C12 |
| Methoxychlor-d6(Surrogate) | Surrogate: Methoxychlor-d6 |
| Methoxyfenozide | Methoxyfenozide |
| Methoxy-methylsulfanylphosphoryl acetamide, N- | N-Methoxy-methylsulfanylphosphoryl acetamide (Acephate) |
| Methoxytetrafluoropropionic Acid, 3- | 3-Methoxytetrafluoropropionic Acid (2,2,3,3-Tetrafluoro-3-Methoxypropanoic Acid) (MTP) |
| Methyl (3,4-dichlorophenyl)carbamate | Methyl (3,4-dichlorophenyl)carbamate (Swep) |
| Methyl 2,4-dichlorophenylacetate | Methyl 2,4-dichlorophenylacetate (2,4-DCAA) |
| Methyl 3-Amino-2,5-dichlorobenzoate | Methyl 3-Amino-2,5-dichlorobenzoate (Chloramben Methyl) |
| Methyl isothiocyanate | Methyl isothiocyanate |
| Methyl Methacrylate | Methyl Methacrylate (MMA) |
| Methyl paraoxon | Methyl paraoxon |
| Methyl Perfluorooctane Sulfonamido Acetic Acid, N- | N-Methyl Perfluorooctane Sulfonamido Acetic Acid (Me-PFOSA-AcOH) |
| Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(Surrogate) | Surrogate: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3 |
| Methyl Perfluorooctanesulfonamide, N- | N-Methyl Perfluorooctanesulfonamide (NMeFOSA) |
| Methyl Perfluorooctanesulfonamide-d3, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Methyl Perfluorooctanesulfonamide-d3 (NMeFOSA-d3) |
| Methyl Perfluorooctanesulfonamidoacetic Acid, N- | N-Methyl Perfluorooctanesulfonamidoacetic Acid (NMeFOSAA) |
| Methyl Perfluorooctanesulfonamidoacetic Acid-d3, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Methyl Perfluorooctanesulfonamidoacetic Acid-d3 (NMeFOSAA-d3) |
| Methyl Perfluorooctanesulfonamidoethanol, N- | N-Methyl Perfluorooctanesulfonamidoethanol (NMeFOSE) |
| Methyl Perfluorooctanesulfonamidoethanol-d7, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Methyl Perfluorooctanesulfonamidoethanol-d7 (NMeFOSE-d7) |
| Methyl salicylate | Methyl salicylate |
| Methyl Tert-butyl Ether | Methyl Tert-butyl Ether (MTBE) |
| Methyl triclosan | Methyl triclosan |
| Methyl Triclosan-13C12(Surrogate) | Surrogate: Methyl Triclosan-13C12 |
| Methyl vinyl ether Co-polymers Fiber | Methyl vinyl ether copolymers Fiber |
| Methyl vinyl ether Co-polymers Film | Methyl vinyl ether copolymers Film |
| Methyl vinyl ether Co-polymers Foam | Methyl vinyl ether copolymers Foam |
| Methyl vinyl ether Co-polymers Fragment | Methyl vinyl ether copolymers Fragment |
| Methyl-1(H)-indole, 3- | 3-Methyl-1(H)-indole (Skatole) |
| Methyl-1H-benzotriazole, 5- | 5-Methyl-1H-benzotriazole |
| Methyl-2-pentanone, 4- | 4-Methyl-2-pentanone (Methyl Isobutyl Ketone) |
| Methylanthracene | Methylanthracene |
| Methylanthracene, 2- | 2-Methylanthracene |
| Methylbenzo(a)pyrene, 7- | 7-Methylbenzo(a)pyrene |
| Methylchlolanthrene, 3- | Methylchlolanthrene, 3- |
| Methylchrysene, 1- | 1-Methylchrysene |
| Methylchrysene, 5/6- | 5-Methylchrysene/6-Methylchrysene |
| Methyldibenzothiophene, 2- | 2-Methyldibenzothiophene |
| Methyldibenzothiophene, 4- | 4-Methyldibenzothiophene |
| Methyldibenzothiophenes, 2/3- | 2-Methyldibenzothiophene/3-Methyldibenzothiophene |
| Methylene Chloride | Methylene Chloride (Dichloromethane) |
| Methylenebis(2-chloroaniline), 4,4'- | 4,4'-Methylenebis(2-chloroaniline) |
| Methylfluoranthene, 2- | 2-Methylfluoranthene |
| Methylfluoranthene, 3- | 3-Methylfluoranthene |
| Methylfluoranthene, 3-/Benzo(a)fluorene | 3-Methylfluoranthene/Benzo(a)fluorene |
| Methylfluorene, 1- | 1-Methylfluorene |
| Methylfluorene, 2- | 2-Methylfluorene |
| Methylisoborneol, 2- | 2-Methylisoborneol |
| Methylnaphthalene, 1- | 1-Methylnaphthalene |
| Methylnaphthalene, 2- | 2-Methylnaphthalene |
| Methylnaphthalene-d10, 2-(IsoDilAnalogue) | Isotope Dilution Analogue: 2-Methylnaphthalene-d10 |
| Methylnaphthalene-d10, 2-(Surrogate) | Surrogate: 2-Methylnaphthalene-d10 |
| Methylparaben | Methylparaben |
| Methyl-perfluorooctanesulfonamide-d3, N-(Surrogate) | Surrogate: Methyl-perfluorooctanesulfonamide-d3, N- (N-MeFOSA) |
| Methyl-perfluorooctanesulfonamidoethanol, N- | N-Methyl-perfluorooctanesulfonamidoethanol |
| Methyl-perfluorooctanesulfonamidoethanol-d7, N-(Surrogate) | Surrogate: N-Methyl-perfluorooctanesulfonamidoethanol-d7 |
| Methylphenanthrene | Methylphenanthrene |
| Methylphenanthrene, 1- | 1-Methylphenanthrene |
| Methylphenanthrene, 2- | 2-Methylphenanthrene |
| Methylphenanthrene, 3- | 3-Methylphenanthrene |
| Methylphenanthrene, 3/4- | 3/4-Methylphenanthrene |
| Methylphenanthrene, 9/4- | 9/4-Methylphenanthrene |
| Methylphenanthrene-d10, 2-(Surrogate) | Surrogate: 2-Methylphenanthrene-d10 |
| Methylphenol, 2- | 2-Methylphenol |
| Methylphenol, 2-(Surrogate) | Surrogate: 2-Methylphenol |
| Methylphenol, 3- | 3-Methylphenol |
| Methylphenol, 3/4- | 3-Methylphenol/4-Methylphenol |
| Methylphenol, 3/4-(Surrogate) | Surrogate: 3-Methylphenol/4-Methylphenol |
| Methylphenol, 4- | 4-Methylphenol |
| Methylprednisolone | Methylprednisolone |
| Methylprednisolone-d2(Surrogate) | Surrogate: Methylprednisolone-d2 |
| Methylprednisolone-d3(Surrogate) | Surrogate: Methylprednisolone-d3 |
| Methylpyridine, 2- | 2-Methylpyridine |
| Metiram | Metiram |
| Metolachlor | Metolachlor |
| Metolachlor ethanesulfonic acid | Metolachlor ethanesulfonic acid |
| Metolachlor oxanilic acid | Metolachlor oxanilic acid |
| Metolachlor, S- | S-Metolachlor |
| Metolachlor-13C6(Surrogate) | Surrogate: Metolachlor-13C6 |
| Metoprolol | Metoprolol |
| Metoprolol-d7(Surrogate) | Surrogate: Metoprolol-d7 |
| Metribuzin | Metribuzin |
| Metsulfuron Methyl | Metsulfuron Methyl |
| Mevinphos | Mevinphos (Phosdrin) |
| Mexacarbate | Mexacarbate |
| MGK 264 | MGK 264 (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide) |
| MGK 264-A | MGK 264 Peak A (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide) |
| MGK 264-B | MGK 264 Peak B (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide) |
| Miconazole | Miconazole |
| Microalgae Thickness | Thickness of microalgae (if present) at a point along a transect |
| Microcystin-[Dha7]LR | Microcystin-[dehydroalanine7]LR |
| Microcystin-[DLeu1]LR | Microcystin-[deleucine1]LR |
| Microcystin-HilR | Microcystin- homoisoleucineR |
| Microcystin-HtyR | Microcystin-homotyrosineR |
| Microcystin-LA | Microcystin-LA (MCY-LA) |
| Microcystin-LF | Microcystin-LF (MCY-LF) |
| Microcystin-LR | Microcystin-LR (MCY-LR) |
| Microcystin-LW | Microcystin-LW (MCY-LW) |
| Microcystin-LY | Microcystin-LY (MCY-LY) |
| Microcystin-RR | Microcystin-RR (MCY-RR) |
| Microcystins, Total | Total Microcystins |
| Microcystin-WR | Microcystin-WR (MCY-WR) |
| Microcystin-YR | Microcystin-YR (MCY-YR) |
| Military Land Extent | Military Land Extent |
| Military Land Intensity | Military Land Intensity |
| Military Land Proximity | Military Land Proximity |
| Milk Carton | Milk Carton |
| Mines, Quaries | Mines, Quaries |
| Mining Extent | Mining Extent |
| Mining Intensity | Mining Intensity |
| Mining Proximity | Mining Proximity |
| Mirex | Mirex |
| Mirex(Surrogate) | Surrogate: Mirex |
| Mirex-13C10(IsoDilAnalogue) | Isotope Dilution Analogue: Mirex-13C10 |
| Mirex-13C10(Surrogate) | Surrogate: Mirex-13C10 |
| Miscellaneous | Miscellaneous using Trash Protocol |
| Miscellaneous, Other | Miscellaneous, Other |
| Moisture | Moisture |
| Molinate | Molinate (Ordram) |
| Molinate sulfoxide | Molinate sulfoxide |
| Molybdenum | Molybdenum |
| Molybdenum, Acid Labile | Acid Labile Molybdenum |
| Monobromophenyl-hexachloro-norbornene-1 | Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 1) |
| Monobromophenyl-hexachloro-norbornene-2 | Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 2) |
| Monobromophenyl-hexachloro-norbornene-3 | Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 3) |
| Monobutyl Monooctyl-Diphenylamine | Monobutyl Monooctyl-Diphenylamine (SDPA-C4C8) |
| Monobutyltin as Sn | Monobutyltin as Sn (MBT) |
| Monocrotophos | Monocrotophos |
| Mono-dechlorinated Dechlorane Plus | Mono-dechlorinated Dechlorane Plus (C11-DP) |
| Monomethyl tetrachloroterephthalate | Monomethyl tetrachloroterephthalate (MTP) |
| Monomethylarsonic Acid | Monomethylarsonic Acid |
| Monuron | Monuron |
| Monuron(Surrogate) | Surrogate: Monuron |
| Monuron-TCA | Monuron-TCA |
| Morphine | Morphine |
| Mortality/Abnormality | Mortality/Abnormality (%) |
| Mortality/Normality | Mortality/Normality (%) |
| Motor Oil | Motor Oil |
| Mountain Bikes Extent | Mountain Bikes Extent |
| Mountain Bikes Intensity | Mountain Bikes Intensity |
| Mountain Bikes Proximity | Mountain Bikes Proximity |
| Mowing/Cutting Extent | Mowing/Cutting Extent |
| Mowing/Cutting Intensity | Mowing/Cutting Intensity |
| Mowing/Cutting Proximity | Mowing/Cutting Proximity |
| Musk Ambrette | Musk Ambrette |
| Musk Ketone | Musk Ketone |
| Musk Moskene | Musk Moskene |
| Musk Xylene | Musk Xylene |
| Mutagenicity | Mutagenicity |
| Myclobutanil | Myclobutanil |
| N,N-Diethyl-3-methyl-benzamide-d7(Surrogate) | Surrogate: N,N-Diethyl-3-methyl-benzamide-d7 |
| N,N-Diethyl-3-methyl-benzamide-d7, N,N-(Surrogate) | Surrogate: N,N-Diethyl-3-methyl-benzamide-d7 |
| Nabam | Nabam |
| Nail/Screw/Bolt | Nail/Screw/Bolt |
| Naled | Naled (Dibrom) |
| Naphthalene | Naphthalene |
| Naphthalene-d8(IsoDilAnalogue) | Isotope Dilution Analogue: Naphthalene-d8 |
| Naphthalene-d8(Surrogate) | Surrogate: Naphthalene-d8 |
| Naphthalenes, C1- | C1-Naphthalenes |
| Naphthalenes, C2- | C2-Naphthalenes |
| Naphthalenes, C3- | C3-Naphthalenes |
| Naphthalenes, C4- | C4-Naphthalenes |
| Naphthobenzothiophene | Naphthobenzothiophene |
| Naphthobenzothiophene, C1- | C1-Naphthobenzothiophene |
| Naphthobenzothiophene, C2- | C2-Naphthobenzothiophene |
| Naphthobenzothiophene, C3- | C3-Naphthobenzothiophene |
| Naphthylamine, 2- | 2-Naphthylamine |
| Napropamide | Napropamide |
| Naproxen | Naproxen |
| Naproxen-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Naproxen-d3 |
| Naptalam, sodium salt | Naptalam, sodium salt |
| Napthalene | Napthalene |
| Natural, cotton/wool | Natural, cotton/wool |
| Neburon | Neburon |
| Neodymium | Neodymium |
| Nest | Nest (%) |
| Nickel | Nickel |
| Nicosulfuron | Nicosulfuron |
| NID as CTAS | 4-Nitro-Inden-1-One (NID) as Cobalt Thiocyanate Active Substances (CTAS) |
| Nifedipine | Nifedipine |
| Niobium | Niobium |
| Nitenpyram | Nitenpyram |
| Nitralin | Nitralin |
| Nitrapyrin | Nitrapyrin |
| Nitrate + Nitrite as N | Nitrate + Nitrite as N |
| Nitrate as N | Nitrate as N |
| Nitrate as NO3 | Nitrate as Nitrate |
| Nitrate as NO3, Daily Mean | Daily Mean Nitrate as Nitrate (Calculated) |
| Nitrite as N | Nitrite as N |
| Nitroaniline, 2- | 2-Nitroaniline |
| Nitroaniline, 3- | 3-Nitroaniline |
| Nitroaniline, 4- | 4-Nitroaniline |
| Nitrobenzene | Nitrobenzene |
| Nitrobenzene-d5(Surrogate) | Surrogate: Nitrobenzene-d5 |
| Nitrofen | Nitrofen |
| Nitrogen Oxide | Nitrogen Oxide |
| Nitrogen, Inorganic | Inorganic Nitrogen as N |
| Nitrogen, Organic | Organic Nitrogen as N |
| Nitrogen, Total | Total Nitrogen |
| Nitrogen, Total Kjeldahl | Total Kjeldahl Nitrogen (TKN) |
| Nitrogen-15 | Nitrogen-15 |
| Nitrogen-15/Nitrogen-14 Ratio | Nitrogen-15/Nitrogen-14 Ratio (Delta 15N nitrate isotope) |
| Nitrophenol, 2- | 2-Nitrophenol |
| Nitrophenol, 2-(Surrogate) | Surrogate: 2-Nitrophenol |
| Nitrophenol, 4- | 4-Nitrophenol |
| Nitrophenol, 4-(Surrogate) | Surrogate: 4-Nitrophenol |
| Nitrosodiethylamine, N- | N-Nitrosodiethylamine |
| Nitrosodimethylamine, N- | N-Nitrosodimethylamine |
| Nitrosodimethylamine-d6, N-(Surrogate) | Surrogate: N-Nitrosodimethylamine-d6 |
| Nitrosodi-n-propylamine, N- | N-Nitrosodi-n-propylamine |
| Nitrosodiphenylamine, N- | N-Nitrosodiphenylamine |
| Nitrosomethylethylamine, N- | N-Nitrosomethylethylamine |
| No Debris Collected | No Debris Collected |
| No Debris Present | No Debris Present |
| Nodularin | Nodularin |
| NoItems | Number of Items using Trash Protocol |
| Nonachlor, cis- | cis-Nonachlor |
| Nonachlor, cis-(Surrogate) | Surrogate: cis-Nonachlor |
| Nonachlor, trans- | trans-Nonachlor |
| Nonachlor, trans-(Surrogate) | Surrogate: trans-Nonachlor |
| Nonachlor-13C10, cis-(IsoDilAnalogue) | Isotope Dilution Analogue: cis-Nonachlor-13C10 |
| Nonachlor-13C10, trans-(IsoDilAnalogue) | Isotope Dilution Analogue: trans-Nonachlor-13C10 |
| Nonacosane, n- | n-Nonacosane |
| Nonadecane, n- | n-Nonadecane |
| Nonafluoro-3,6-Dioxaheptanoic Acid | Nonafluoro-3,6-Dioxaheptanoic Acid (NFDHA) |
| Nonane | Nonane (C9) |
| Nonane(Surrogate) | Surrogate: Nonane |
| None | Used for non-treated samples |
| NonPoint Source Discharges Stormwater Extent | NonPoint Source Discharges Stormwater Extent |
| NonPoint Source Discharges Stormwater Intensity | NonPoint Source Discharges Stormwater Intensity |
| NonPoint Source Discharges Stormwater Proximity | NonPoint Source Discharges Stormwater Proximity |
| Nonylphenol | Nonylphenol |
| Nonylphenol diethoxylate | Nonylphenol diethoxylate |
| Nonylphenol Diethoxylate, 4- | 4-Nonylphenol Diethoxylate |
| Nonylphenol Diethoxylate, 4-(Surrogate) | Surrogate: 4-Nonylphenol Diethoxylate |
| Nonylphenol diethoxylate, tech- | tech-Nonylphenol diethoxylate |
| Nonylphenol Diethoxylate-13C6, 4-(Surrogate) | Surrogate: 4-Nonylphenol Diethoxylates-13C6 |
| Nonylphenol monoethoxylate | Nonylphenol monoethoxylate |
| Nonylphenol Monoethoxylate, 4- | 4-Nonylphenol Monoethoxylate |
| Nonylphenol monoethoxylate, 4-n- | 4-n-Nonylphenol monoethoxylate |
| Nonylphenol Monoethoxylate-13C6, 4-(Surrogate) | Surrogate: 4-Nonylphenol Monoethoxylate-13C6 |
| Nonylphenol, 4-n- | 4-n-Nonylphenol |
| Nonylphenol, p- | p-Nonylphenol |
| Nonylphenol, tech- | tech-Nonylphenol (Branched p-nonylphenol) |
| Nonylphenol-13C6, 4-n-(Surrogate) | Surrogate: 4-n-Nonylphenol-13C6 |
| Nonylphenol-13C6, n-4-(Surrogate) | Surrogate: 4-n-Nonylphenol-13C6 |
| Nonylphenol-d4, 4-(Surrogate) | Surrogate: 4-Nonylphenol-d4 |
| Nonylphenolethoxylate | Nonylphenolethoxylate |
| Norethisterone | Norethisterone |
| Norfloxacin | Norfloxacin |
| Norfluoxetine | Norfluoxetine |
| Norfluoxetine-d5(Surrogate) | Surrogate: Norfluoxetine-d5 |
| Norflurazon | Norflurazon (3(2H)-Pyridazinone, 4-chloro-5-(methylamino)-2-[3-(trifluoromethyl)phenyl]-) (Telok) |
| Norgestimate | Norgestimate |
| Normal Development | Normal Development (%) |
| Norverapamil | Norverapamil |
| Not Characterized Fiber | Fiber particle not attempted to be characterized by spectroscopy |
| Not Characterized Fiber Bundle | Fiber bundle particle not attempted to be characterized by spectroscopy |
| Not Characterized Film | Film particle not attempted to be characterized by spectroscopy |
| Not Characterized Foam | Foam particle not attempted to be characterized by spectroscopy |
| Not Characterized Fragment | Fragment particle not attempted to be characterized by spectroscopy |
| Not Characterized Sphere | Sphere particle not attempted to be characterized by spectroscopy |
| Novaluron | Novaluron |
| Noxious Chemical Odors Extent | Noxious Chemical Odors Extent |
| Noxious Chemical Odors Intensity | Noxious Chemical Odors Intensity |
| Noxious Chemical Odors Proximity | Noxious Chemical Odors Proximity |
| Nutrient Related Water Other Extent | Nutrient Related Water Other Extent |
| Nutrient Related Water Other Intensity | Nutrient Related Water Other Intensity |
| Nutrient Related Water Other Proximity | Nutrient Related Water Other Proximity |
| NutrientSpike | Combination of multiple nutrients; see tox test comments for specific analytes and concentrations |
| Nylon Fiber | Nylon Fiber |
| Nylon Film | Nylon Film |
| Nylon Foam | Nylon Foam |
| Nylon Fragment | Nylon Fragment |
| Nylon Sphere | Nylon Sphere |
| O,O,O-Triethyl phosphorothioate | O,O,O-Triethyl phosphorothioate |
| ObservedChannelFlowLevel | ObservedChannelFlowLevel |
| ObservedFlow | ObservedFlow |
| Obstructions (culverts, paved stream crossings) Extent | Obstructions (culverts, paved stream crossings) Extent |
| Obstructions (culverts, paved stream crossings) Intensity | Obstructions (culverts, paved stream crossings) Intensity |
| Obstructions (culverts, paved stream crossings) Proximity | Obstructions (culverts, paved stream crossings) Proximity |
| OCDD, 1,2,3,4,6,7,8,9- | 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD) |
| OCDD, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD) |
| OCDD-13C12, 1,2,3,4,6,7,8,9-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin-13C12 (OCDD-13C12) |
| OCDF, 1,2,3,4,6,7,8,9- | 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF) |
| OCDF, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF) |
| Octabromo-1,3,3-trimethyl-1-phenylindane | Octabromo-1,3,3-trimethyl-1-phenylindane (OBIND) |
| Octachlorostyrene | Octachlorostyrene |
| Octachlorostyrene-13C8(Surrogate) | Surrogate: Octachlorostyrene-13C8 |
| Octacosane, n- | n-Octacosane |
| Octacosane, n-(Surrogate) | Surrogate: n-Octacosane |
| Octadecane, n- | n-Octadecane |
| Octamethylcyclotetrasiloxane | Octamethylcyclotetrasiloxane |
| Octyl bicycloheptene dicarboximide, N- | N-Octyl bicycloheptene dicarboximide |
| Octylammonium Methanearsonate | Octylammonium Methanearsonate |
| Octylphenol | Octylphenol |
| Octylphenol diethoxylate, 4-n- | 4-n-Octylphenol diethoxylate |
| Octylphenol diethoxylate, tert-4- | 4-tert-Octylphenol diethoxylate (OP2EO) |
| Octylphenol monoethoxylate, 4- | 4-Octylphenol monoethoxylate |
| Octylphenol monoethoxylate, 4-n- | 4-n-Octylphenol monoethoxylate |
| Octylphenol monoethoxylate, tert-4- | 4-tert-Octylphenol monoethoxylate (OP1EO) |
| Octylphenol, 4- | 4-Octylphenol |
| Octylphenol, 4-n- | 4-n-Octylphenol |
| Octylphenol, tert-4- | 4-tert-Octylphenol |
| Odor | Odor |
| Odor Intensity | Odor Intensity - Specific to EMAP BA (characterizes intensity of odor) |
| Offspring | Offspring (#) |
| Ofloxacin | Ofloxacin |
| Oil, Gas Wells | Oil, Gas Wells |
| OilandGrease; FOG-HEM | Oil and Grease; Fats, Oils and Grease N-Hexane Extractable Material (Polar Material) |
| OilandGrease; HEM | Oil and Grease, N-Hexane Extractable Material |
| OilandGrease; SGT-HEM | Oil and Grease, Silica Gel Treated N-Hexane Extractable Material (Non-Polar Material Not Adsorbed by Silica Gel) |
| Okadaic Acid | Okadaic Acid |
| Omethoate | Omethoate |
| Oncorhynchus mykiss (KF55) | Oncorhynchus mykiss, Assay name: KF55, 5’ AACATAAAACCTCCAGCCATCTCT 3’, 5’ AGCACGGCTCAAACGAAAA 3’, 5FAM-AGTACCAAACCCCC-3IABkFQ |
| Open Shell Volume | Open Shell Volume (weight (in grams) of water displaced by each empty bivalve) |
| Orchards | Orchards |
| Orchards Extent | Orchards Extent |
| Orchards Intensity | Orchards Intensity |
| Orchards Proximity | Orchards Proximity |
| Organic natural material | Hair or other unprocessed natural fiber, fragment, film |
| Organic Natural Material Fiber | Organic natural material Fiber |
| Organic Natural Material Film | Organic natural material Film |
| Organic Natural Material Foam | Organic natural material Foam |
| Organic Natural Material Fragment | Organic natural material Fragment |
| Organic Natural Material Sphere | Organic natural material Sphere |
| Ormetoprim | Ormetoprim |
| OrthoPhosphate as P | Reactive Phosphorous (PO4) |
| Oryzalin | Oryzalin (Rycelan) (Ryzelan) (Surflan) |
| Osmoregulation | Osmoregulation |
| o-Terphenyl(Surrogate) | Surrogate: o-Terphenyl |
| OtherPresence | OtherPresence |
| Outfall Accessibility | Outfall Accessibility |
| Outfall Structural Cond | Structural condition of the outfall |
| Outfall, Distance from Transect | Outfall, Distance from Transect |
| Outfall, Within Transect | Outfall, Within Transect |
| OverlandRunoffLast24hrs | Influence of overland runoff during last 24 hours |
| Oxacillin | Oxacillin |
| Oxadiazon | Oxadiazon |
| Oxamyl | Oxamyl |
| Oxathiapiprolin | Oxathiapiprolin |
| Oxidation-Reduction Potential | Oxidation-Reduction Potential (OPR) |
| Oxolinic Acid | Oxolinic Acid |
| Oxybenzone | Oxybenzone |
| Oxycarboxin | Oxycarboxin |
| Oxychlordane | Oxychlordane |
| Oxychlordane(Surrogate) | Surrogate: Oxychlordane |
| Oxychlordane-13C10(IsoDilAnalogue) | Isotope Dilution Analogue: Oxychlordane-13C10 |
| Oxychlordane-13C10(Surrogate) | Surrogate: Oxychlordane-13C10 |
| Oxycodone | Oxycodone |
| Oxycodone-d6(Surrogate) | Surrogate: Oxycodone-d6 |
| Oxydemeton-methyl | Oxydemeton-methyl |
| Oxyfluorfen | Oxyfluorfen (Goal) |
| Oxygen, Dissolved | Dissolved Oxygen (DO) |
| Oxygen, Dissolved, Daily Mean | Daily Mean Dissolved Oxygen (DO) (Calculated) |
| Oxygen, Saturation | Oxygen, Saturation |
| Oxygen, Saturation, Daily Mean | Daily Mean Oxygen Saturation (Calculated) |
| Oxygen-18/Oxygen-16 Ratio | Oxygen-18/Oxygen-16 Ratio (Delta 18O nitrate isotope) |
| Oxytetracycline | Oxytetracycline |
| Oxythioquinox | Oxythioquinox (Chinomethionate) |
| Paclobutrazol | Paclobutrazol |
| Paint Fiber | Paint Fiber |
| Paint Film | Paint Film |
| Paint Foam | Paint Foam |
| Paint fragment | Paint anthropogenic fragment |
| Paper/Cardboard | Paper/Cardboard |
| PAR | Photosynthetically Active Radiation (PAR) |
| Paraoxon | Paraoxon |
| Paraquat | Paraquat |
| Paraquat Bis(methylsulfate) | Paraquat Bis(methylsulfate) |
| Paraquat Dichloride | Paraquat Dichloride |
| Parathion, Ethyl | Ethyl Parathion (Parathion) |
| Parathion, Methyl | Methyl Parathion |
| Parathion, Total | Total Parathion |
| Parking Lot/Pavement Extent | Parking Lot/Pavement Extent |
| Parking Lot/Pavement Intensity | Parking Lot/Pavement Intensity |
| Parking Lot/Pavement Proximity | Parking Lot/Pavement Proximity |
| Parks, Campgrounds | Parks, Campgrounds |
| Paroxetine | Paroxetine |
| Paroxetine-d6(Surrogate) | Surrogate: Paroxetine-d6 |
| Particulate Organic Carbon | Particulate Organic Carbon (POC) |
| Particulate Organic Hydrogen | Particulate Organic Hydrogen |
| Passive Input (Construction/Erosion) Extent | Passive Input (Construction/Erosion) Extent |
| Passive Input (Construction/Erosion) Intensity | Passive Input (Construction/Erosion) Intensity |
| Passive Input (Construction/Erosion) Proximity | Passive Input (Construction/Erosion) Proximity |
| Pasture | Pasture |
| Pasture Extent | Pasture Extent |
| Pasture Intensity | Pasture Intensity |
| Pasture Proximity | Pasture Proximity |
| Paved Roads Extent | Paved Roads Extent |
| Paved Roads Intensity | Paved Roads Intensity |
| Paved Roads Proximity | Paved Roads Proximity |
| PBB 001 | Polybrominated Biphenyl (PBB) 1 |
| PBB 002 | Polybrominated Biphenyl (PBB) 2 |
| PBB 003 | Polybrominated Biphenyl (PBB) 3 |
| PBB 004 | Polybrominated Biphenyl (PBB) 4 |
| PBB 007 | Polybrominated Biphenyl (PBB) 7 |
| PBB 009 | Polybrominated Biphenyl (PBB) 9 |
| PBB 010 | Polybrominated Biphenyl (PBB) 10 |
| PBB 015 | Polybrominated Biphenyl (PBB) 15 |
| PBB 015(Surrogate) | Surrogate: PBB 015 |
| PBB 018 | Polybrominated Biphenyl (PBB) 18 |
| PBB 026 | Polybrominated Biphenyl (PBB) 26 |
| PBB 030 | Polybrominated Biphenyl (PBB) 30 |
| PBB 031 | Polybrominated Biphenyl (PBB) 31 |
| PBB 049 | Polybrominated Biphenyl (PBB) 49 |
| PBB 052 | Polybrominated Biphenyl (PBB) 52 |
| PBB 053 | Polybrominated Biphenyl (PBB) 53 |
| PBB 077 | Polybrominated Biphenyl (PBB) 77 |
| PBB 080 | Polybrominated Biphenyl (PBB) 80 |
| PBB 103 | Polybrominated Biphenyl (PBB) 103 |
| PBB 155 | Polybrominated Biphenyl (PBB) 155 |
| PBDE 001 | Polybrominated Diphenyl Ether (PBDE) 1 |
| PBDE 001(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 1 |
| PBDE 002 | Polybrominated Diphenyl Ether (PBDE) 2 |
| PBDE 003 | Polybrominated Diphenyl Ether (PBDE) 3 |
| PBDE 003(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 3 |
| PBDE 004(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 4 |
| PBDE 007 | Polybrominated Diphenyl Ether (PBDE) 7 |
| PBDE 008 | Polybrominated Diphenyl Ether (PBDE) 8 |
| PBDE 008/11 | Polybrominated Diphenyl Ether (PBDE) 8/11 |
| PBDE 010 | Polybrominated Diphenyl Ether (PBDE) 10 |
| PBDE 011 | Polybrominated Diphenyl Ether (PBDE) 11 |
| PBDE 012 | Polybrominated Diphenyl Ether (PBDE) 12 |
| PBDE 012/13 | Polybrominated Diphenyl Ether (PBDE) 12/13 |
| PBDE 013 | Polybrominated Diphenyl Ether (PBDE) 13 |
| PBDE 015 | Polybrominated Diphenyl Ether (PBDE) 15 |
| PBDE 015(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 15 |
| PBDE 015-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 15-13C12 |
| PBDE 017 | Polybrominated Diphenyl Ether (PBDE) 17 |
| PBDE 017/25 | Polybrominated Diphenyl Ether (PBDE) 17/25 |
| PBDE 019(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 19 |
| PBDE 025 | Polybrominated Diphenyl Ether (PBDE) 25 |
| PBDE 028 | Polybrominated Diphenyl Ether (PBDE) 28 |
| PBDE 028(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 28 |
| PBDE 028/33 | Polybrominated Diphenyl Ether (PBDE) 28/33 |
| PBDE 028-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 028-13C12 |
| PBDE 028-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 28-13C12 |
| PBDE 030 | Polybrominated Diphenyl Ether (PBDE) 30 |
| PBDE 032 | Polybrominated Diphenyl Ether (PBDE) 32 |
| PBDE 033 | Polybrominated Diphenyl Ether (PBDE) 33 |
| PBDE 033(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 33 |
| PBDE 035 | Polybrominated Diphenyl Ether (PBDE) 35 |
| PBDE 037 | Polybrominated Diphenyl Ether (PBDE) 37 |
| PBDE 037(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 37 |
| PBDE 047 | Polybrominated Diphenyl Ether (PBDE) 47 |
| PBDE 047(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 47 |
| PBDE 047-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 047-13C12 |
| PBDE 047-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 47-13C12 |
| PBDE 049 | Polybrominated Diphenyl Ether (PBDE) 49 |
| PBDE 049/71 | Polybrominated Diphenyl Ether (PBDE) 49/71 |
| PBDE 051 | Polybrominated Diphenyl Ether (PBDE) 51 |
| PBDE 052(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 52 |
| PBDE 054(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 54 |
| PBDE 066 | Polybrominated Diphenyl Ether (PBDE) 66 |
| PBDE 069-F(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 69-F |
| PBDE 071 | Polybrominated Diphenyl Ether (PBDE) 71 |
| PBDE 075 | Polybrominated Diphenyl Ether (PBDE) 75 |
| PBDE 077 | Polybrominated Diphenyl Ether (PBDE) 77 |
| PBDE 077(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 77 |
| PBDE 077-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 77-13C12 |
| PBDE 079 | Polybrominated Diphenyl Ether (PBDE) 79 |
| PBDE 081(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 81 |
| PBDE 085 | Polybrominated Diphenyl Ether (PBDE) 85 |
| PBDE 099 | Polybrominated Diphenyl Ether (PBDE) 99 |
| PBDE 099(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 99 |
| PBDE 099-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 099-13C12 |
| PBDE 099-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 99-13C12 |
| PBDE 100 | Polybrominated Diphenyl Ether (PBDE) 100 |
| PBDE 100(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 100 |
| PBDE 100-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 100-13C12 |
| PBDE 100-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-13C12 |
| PBDE 100-L(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-Labeled |
| PBDE 104(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 104 |
| PBDE 105 | Polybrominated Diphenyl Ether (PBDE) 105 |
| PBDE 105(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 105 |
| PBDE 111(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 111 |
| PBDE 114(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 114 |
| PBDE 116 | Polybrominated Diphenyl Ether (PBDE) 116 |
| PBDE 118 | Polybrominated Diphenyl Ether (PBDE) 118 |
| PBDE 118(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 118 |
| PBDE 119 | Polybrominated Diphenyl Ether (PBDE) 119 |
| PBDE 119/120 | Polybrominated Diphenyl Ether (PBDE) 119/120 |
| PBDE 120 | Polybrominated Diphenyl Ether (PBDE) 120 |
| PBDE 123(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 123 |
| PBDE 126 | Polybrominated Diphenyl Ether (PBDE) 126 |
| PBDE 126(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 126 |
| PBDE 126-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 126-13C12 |
| PBDE 128 | Polybrominated Diphenyl Ether (PBDE) 128 |
| PBDE 138 | Polybrominated Diphenyl Ether (PBDE) 138 |
| PBDE 138(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 138 |
| PBDE 138/166 | Polybrominated Diphenyl Ether (PBDE) 138/166 |
| PBDE 139 | Polybrominated Diphenyl Ether (PBDE) 139 |
| PBDE 139(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 139 |
| PBDE 139-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 139-13C12 |
| PBDE 139-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 139-13C12 |
| PBDE 140 | Polybrominated Diphenyl Ether (PBDE) 140 |
| PBDE 140(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 140 |
| PBDE 153 | Polybrominated Diphenyl Ether (PBDE) 153 |
| PBDE 153(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 153 |
| PBDE 153-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 153-13C12 |
| PBDE 153-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 153-13C12 |
| PBDE 154 | Polybrominated Diphenyl Ether (PBDE) 154 |
| PBDE 154(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 154 |
| PBDE 154-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 154-13C12 |
| PBDE 154-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 154-13C12 |
| PBDE 155 | Polybrominated Diphenyl Ether (PBDE) 155 |
| PBDE 155(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 155 |
| PBDE 156(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 156 |
| PBDE 157(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 157 |
| PBDE 160 | Polybrominated Diphenyl Ether (PBDE) 160 |
| PBDE 166 | Polybrominated Diphenyl Ether (PBDE) 166 |
| PBDE 167(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 167 |
| PBDE 169(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 169 |
| PBDE 170(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 170 |
| PBDE 172(Surrogate) | Surrogate: PBDE 172
Surrogate: PBDE 172 |
| PBDE 178(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 178 |
| PBDE 179 | Polybrominated Diphenyl Ether (PBDE) 179 |
| PBDE 180(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 180 |
| PBDE 181 | Polybrominated Diphenyl Ether (PBDE) 181 |
| PBDE 183 | Polybrominated Diphenyl Ether (PBDE) 183 |
| PBDE 183(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 183 |
| PBDE 183-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 183-13C12 |
| PBDE 183-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 183-13C12 |
| PBDE 184 | Polybrominated Diphenyl Ether (PBDE) 184 |
| PBDE 188 | Polybrominated Diphenyl Ether (PBDE) 188 |
| PBDE 188(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 188 |
| PBDE 189(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 189 |
| PBDE 190 | Polybrominated Diphenyl Ether (PBDE) 190 |
| PBDE 194 | Polybrominated Diphenyl Ether (PBDE) 194 |
| PBDE 195 | Polybrominated Diphenyl Ether (PBDE) 195 |
| PBDE 196 | Polybrominated Diphenyl Ether (PBDE) 196 |
| PBDE 197 | Polybrominated Diphenyl Ether (PBDE) 197 |
| PBDE 197(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 197 |
| PBDE 197-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 197-13C12 |
| PBDE 198 | Polybrominated Diphenyl Ether (PBDE) 198 |
| PBDE 200 | Polybrominated Diphenyl Ether (PBDE) 200 |
| PBDE 200/203 | Polybrominated Diphenyl Ether (PBDE) 200/203 |
| PBDE 201 | Polybrominated Diphenyl Ether (PBDE) 201 |
| PBDE 202 | Polybrominated Diphenyl Ether (PBDE) 202 |
| PBDE 202(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 202 |
| PBDE 203 | Polybrominated Diphenyl Ether (PBDE) 203 |
| PBDE 204 | Polybrominated Diphenyl Ether (PBDE) 204 |
| PBDE 205 | Polybrominated Diphenyl Ether (PBDE) 205 |
| PBDE 205(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 205 |
| PBDE 206 | Polybrominated Diphenyl Ether (PBDE) 206 |
| PBDE 206(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 206 |
| PBDE 207 | Polybrominated Diphenyl Ether (PBDE) 207 |
| PBDE 207(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 207 |
| PBDE 208 | Polybrominated Diphenyl Ether (PBDE) 208 |
| PBDE 208(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 208 |
| PBDE 209 | Polybrominated Diphenyl Ether (PBDE) 209 |
| PBDE 209(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 209 |
| PBDE 209-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 209-13C12 |
| PBDE 209-13C12(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 209-13C12 |
| PCB 001 | PCB 1 Congener |
| PCB 001(Surrogate) | Surrogate: PCB 1 Congener |
| PCB 001-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 001-13C12 |
| PCB 002 | PCB 2 Congener |
| PCB 003 | PCB 3 Congener |
| PCB 003(Surrogate) | Surrogate: PCB 3 Congener |
| PCB 003-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 003-13C12 |
| PCB 004 | PCB 4 Congener |
| PCB 004(Surrogate) | Surrogate: PCB 4 Congener |
| PCB 004/10 | PCB 4/10 Congener |
| PCB 004-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 004-13C12 |
| PCB 005 | PCB 5 Congener |
| PCB 005/8 | PCB 5/8 Congener |
| PCB 006 | PCB 6 Congener |
| PCB 007 | PCB 7 Congener |
| PCB 007/9 | PCB 7/9 Congener |
| PCB 008 | PCB 8 Congener |
| PCB 008(Surrogate) | Surrogate: PCB 8 Congener |
| PCB 009 | PCB 9 Congener |
| PCB 009(Surrogate) | Surrogate: PCB 9 Congener |
| PCB 009-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 9-13C12 |
| PCB 010 | PCB 10 Congener |
| PCB 011 | PCB 11 Congener |
| PCB 011-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 11-13C12 |
| PCB 012 | PCB 12 Congener |
| PCB 012/13 | PCB 12/13 Congener |
| PCB 013 | PCB 13 Congener |
| PCB 014 | PCB 14 Congener |
| PCB 015 | PCB 15 Congener |
| PCB 015(Surrogate) | Surrogate: PCB 15 Congener |
| PCB 015-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 015-13C12 |
| PCB 016 | PCB 16 Congener |
| PCB 016/32 | PCB 16/32 Congener |
| PCB 017 | PCB 17 Congener |
| PCB 017/18 | PCB 17/18 Congener |
| PCB 018 | PCB 18 Congener |
| PCB 018/30 | PCB 18/30 Congener |
| PCB 019 | PCB 19 Congener |
| PCB 019(Surrogate) | Surrogate: PCB 19 Congener |
| PCB 019-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 019-13C12 |
| PCB 020 | PCB 20 Congener |
| PCB 020/21/33 | PCB 020/21/33 Congener |
| PCB 020/28 | PCB 20/28 Congener |
| PCB 020/33 | PCB 20/33 Congener |
| PCB 020/33/53 | PCB 20/33/53 Congener |
| PCB 021 | PCB 21 Congener |
| PCB 021/33 | PCB 21/33 Congener |
| PCB 022 | PCB 22 Congener |
| PCB 022/51 | PCB 22/51 Congener |
| PCB 023 | PCB 23 Congener |
| PCB 023(Surrogate) | Surrogate: PCB 023 |
| PCB 024 | PCB 24 Congener |
| PCB 024/27 | PCB 24/27 Congener |
| PCB 025 | PCB 25 Congener |
| PCB 026 | PCB 26 Congener |
| PCB 026/29 | PCB 26/29 Congener |
| PCB 027 | PCB 27 Congener |
| PCB 028 | PCB 28 Congener |
| PCB 028(Surrogate) | Surrogate: PCB 28 Congener |
| PCB 028/31 | PCB 28/31 Congener |
| PCB 028-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 028-13C12 |
| PCB 029 | PCB 29 Congener |
| PCB 030 | PCB 30 Congener |
| PCB 030(Surrogate) | Surrogate: PCB 30 Congener |
| PCB 031 | PCB 31 Congener |
| PCB 031(Surrogate) | Surrogate: PCB 31 Congener |
| PCB 031-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 031-13C12 |
| PCB 032 | PCB 32 Congener |
| PCB 032-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 32-13C12 |
| PCB 033 | PCB 33 Congener |
| PCB 034 | PCB 34 Congener |
| PCB 034(Surrogate) | Surrogate: PCB 034 |
| PCB 035 | PCB 35 Congener |
| PCB 036 | PCB 36 Congener |
| PCB 037 | PCB 37 Congener |
| PCB 037(Surrogate) | Surrogate: PCB 37 Congener |
| PCB 037/42 | PCB 37/42 Congener |
| PCB 037/42/59 | PCB 37/42/59 Congener |
| PCB 037-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 037-13C12 |
| PCB 038 | PCB 38 Congener |
| PCB 039 | PCB 39 Congener |
| PCB 040 | PCB 40 Congener |
| PCB 040/41 | PCB 40/41 Congener |
| PCB 040/41/71 | PCB 40/41/71 Congener |
| PCB 040/71 | PCB 40/71 Congener |
| PCB 041 | PCB 41 Congener |
| PCB 041/64 | PCB 41/64 Congener |
| PCB 041/64/71/72 | PCB 041/64/71/72 Congener |
| PCB 041/71/40 | PCB 41/71/40 Congener
PCB 041/71/40 |
| PCB 042 | PCB 42 Congener |
| PCB 042/59 | PCB 042/59 Congener |
| PCB 043 | PCB 43 Congener |
| PCB 043/49 | PCB 43/49 Congener |
| PCB 043/73 | PCB 43/73 Congener |
| PCB 044 | PCB 44 Congener |
| PCB 044/47 | PCB 44/47 Congener |
| PCB 044/47/65 | PCB 44/47/65 Congener |
| PCB 044/65 | PCB 44/65 Congener |
| PCB 045 | PCB 45 Congener |
| PCB 045/51 | PCB 45/51 Congener |
| PCB 046 | PCB 46 Congener |
| PCB 047 | PCB 47 Congener |
| PCB 047/48 | PCB 47/48 Congener |
| PCB 047/48/75 | PCB 47/48/75 Congener |
| PCB 047-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 47-13C12 |
| PCB 048 | PCB 48 Congener |
| PCB 048/75 | PCB 048/75 Congener |
| PCB 049 | PCB 49 Congener |
| PCB 049/69 | PCB 49/69 Congener |
| PCB 050 | PCB 50 Congener |
| PCB 050/53 | PCB 50/53 Congener |
| PCB 051 | PCB 51 Congener |
| PCB 052 | PCB 52 Congener |
| PCB 052(Surrogate) | Surrogate: PCB 52 Congener |
| PCB 052/69 | PCB 52/69 Congener |
| PCB 052-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 52-13C12 |
| PCB 053 | PCB 53 Congener |
| PCB 054 | PCB 54 Congener |
| PCB 054(Surrogate) | Surrogate: PCB 54 Congener |
| PCB 054-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 054-13C12 |
| PCB 055 | PCB 55 Congener |
| PCB 056 | PCB 56 Congener |
| PCB 056/60 | PCB 56/60 Congener |
| PCB 057 | PCB 57 Congener |
| PCB 058 | PCB 58 Congener |
| PCB 059 | PCB 59 Congener |
| PCB 059/62 | PCB 59/62 Congener |
| PCB 059/62/75 | PCB 59/62/75 Congener |
| PCB 059/75 | PCB 59/75 Congener |
| PCB 060 | PCB 60 Congener |
| PCB 061 | PCB 61 Congener |
| PCB 061/70 | PCB 61/70 Congener |
| PCB 061/70/74/76 | PCB 61/70/74/76 Congener |
| PCB 061/74 | PCB 61/74 Congener |
| PCB 061/76 | PCB 61/76 Congener |
| PCB 062 | PCB 62 Congener |
| PCB 063 | PCB 63 Congener |
| PCB 064 | PCB 64 Congener |
| PCB 065 | PCB 65 Congener |
| PCB 065(Surrogate) | Surrogate: PCB 65 Congener |
| PCB 066 | PCB 66 Congener |
| PCB 066/76 | PCB 66/76 Congener |
| PCB 067 | PCB 67 Congener |
| PCB 068 | PCB 68 Congener |
| PCB 069 | PCB 69 Congener |
| PCB 070 | PCB 70 Congener |
| PCB 070/61/74/76 | PCB 70/61/74/76 Congener |
| PCB 070/74 | PCB 070/74 |
| PCB 070/74/76 | PCB 70/74/76 Congener |
| PCB 070/76 | PCB 070/76 |
| PCB 070-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 70-13C12 |
| PCB 071 | PCB 71 Congener |
| PCB 072 | PCB 72 Congener |
| PCB 073 | PCB 73 Congener |
| PCB 074 | PCB 74 Congener |
| PCB 075 | PCB 75 Congener |
| PCB 076 | PCB 76 Congener |
| PCB 076/66 | PCB 076/66 Congener |
| PCB 077 | PCB 77 Congener |
| PCB 077 (TEQ ND=0) | PCB 077 (TEQ ND=0) |
| PCB 077 (TEQ ND=1/2 DL) | PCB 077 (TEQ ND=1/2 DL) |
| PCB 077 (TEQ ND=1/2 DL)) | PCB 077 (TEQ ND=1/2 DL) |
| PCB 077 (TEQ ND=DL) | PCB 077 (TEQ ND=DL) |
| PCB 077(Surrogate) | Surrogate: PCB 77 Congener |
| PCB 077/110 | PCB 77/110 Congener |
| PCB 077/85 | PCB 77/85 Congener |
| PCB 077-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 077-13C12 |
| PCB 078 | PCB 78 Congener |
| PCB 079 | PCB 79 Congener |
| PCB 079-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 79-13C12 |
| PCB 080 | PCB 80 Congener |
| PCB 080-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 80-13C12 |
| PCB 081 | PCB 81 Congener |
| PCB 081 (TEQ ND=0) | PCB 081 (TEQ ND=0) |
| PCB 081 (TEQ ND=1/2 DL) | PCB 081 (TEQ ND=1/2 DL) |
| PCB 081 (TEQ ND=DL) | PCB 081 (TEQ ND=DL) |
| PCB 081(Surrogate) | Surrogate: PCB 81 Congener |
| PCB 081-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 081-13C12 |
| PCB 082 | PCB 82 Congener |
| PCB 083 | PCB 83 Congener |
| PCB 083/99 | PCB 83/99 Congener |
| PCB 084 | PCB 84 Congener |
| PCB 084/92 | PCB 084/92 Congener |
| PCB 085 | PCB 85 Congener |
| PCB 085/110/115/116/117 | PCB 85/110/115/116/117 Congener |
| PCB 085/116 | PCB 85/116 Congener |
| PCB 085/116/117 | PCB 85/116/117 Congener |
| PCB 085/117 | PCB 85/117 Congener |
| PCB 086 | PCB 86 Congener |
| PCB 086/108 | PCB 86/108 Congener |
| PCB 086/119 | PCB 86/119 Congener |
| PCB 086/125 | PCB 86/125 Congener |
| PCB 086/87 | PCB 86/87 Congener |
| PCB 086/87/97/108/109/119/125 | PCB 86/87/97/108/109/119/125 Congener |
| PCB 086/87/97/108/119/125 | PCB 86/87/97/108/119/125 Congener |
| PCB 086/87/97/109/119/125 | PCB 86/87/97/109/119/125 Congener |
| PCB 086/97 | PCB 86/97 Congener |
| PCB 087 | PCB 87 Congener |
| PCB 087/108 | PCB 087/108 |
| PCB 087/115 | PCB 87/115 Congener |
| PCB 087/117/125 | PCB 87/117/125 Congener |
| PCB 087/119 | PCB 087/119 |
| PCB 087/125 | PCB 087/125 |
| PCB 087/97 | PCB 087/97 |
| PCB 088 | PCB 88 Congener |
| PCB 088/91 | PCB 88/91 Congener |
| PCB 089 | PCB 89 Congener |
| PCB 090 | PCB 90 Congener |
| PCB 090/101 | PCB 90/101 Congener |
| PCB 090/101/113 | PCB 90/101/113 Congener |
| PCB 090/101/113(Surrogate) | Surrogate: PCB 090/101/113 |
| PCB 090/113 | PCB 90/113 Congener |
| PCB 091 | PCB 91 Congener |
| PCB 092 | PCB 92 Congener |
| PCB 093 | PCB 93 Congener |
| PCB 093/100 | PCB 93/100 Congener |
| PCB 093/102 | PCB 93/102 Congener |
| PCB 093/95 | PCB 93/95 Congener |
| PCB 093/95/100 | PCB 93/95/100 Congener |
| PCB 093/95/98/100/102 | PCB 93/95/98/100/102 Congener |
| PCB 093/95/98/102 | PCB 93/95/98/102 Congener |
| PCB 093/98 | PCB 93/98 Congener |
| PCB 093/98/100/102 | PCB 93/98/100/102 Congener |
| PCB 094 | PCB 94 Congener |
| PCB 095 | PCB 95 Congener |
| PCB 095(Surrogate) | Surrogate: PCB 95 Congener |
| PCB 095/100 | PCB 95/100 Congener |
| PCB 095/102 | PCB 095/102 |
| PCB 095/98 | PCB 095/98 |
| PCB 095/98/102 | PCB 95/98/102 Congener |
| PCB 095-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 095-13C12 |
| PCB 096 | PCB 96 Congener |
| PCB 097 | PCB 97 Congener |
| PCB 097/154 | PCB 97/154 Congener |
| PCB 097-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 97-13C12 |
| PCB 098 | PCB 98 Congener |
| PCB 098/102 | PCB 98/102 Congener |
| PCB 099 | PCB 99 Congener |
| PCB 100 | PCB 100 Congener |
| PCB 101 | PCB 101 Congener |
| PCB 101(Surrogate) | Surrogate: PCB 101 Congener |
| PCB 101/113 | PCB 101/113 |
| PCB 101-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 101-13C12 |
| PCB 102 | PCB 102 Congener |
| PCB 103 | PCB 103 Congener |
| PCB 103(Surrogate) | Surrogate: PCB 103 Congener |
| PCB 104 | PCB 104 Congener |
| PCB 104(Surrogate) | Surrogate: PCB 104 Congener |
| PCB 104-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 104-13C12 |
| PCB 105 | PCB 105 Congener |
| PCB 105 (TEQ ND=0) | PCB 105 (TEQ ND=0) |
| PCB 105 (TEQ ND=1/2 DL) | PCB 105 (TEQ ND=1/2 DL) |
| PCB 105 (TEQ ND=DL) | PCB 105 (TEQ ND=DL) |
| PCB 105(Surrogate) | Surrogate: PCB 105 Congener |
| PCB 105-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 105-13C12 |
| PCB 106 | PCB 106 Congener |
| PCB 106/118 | PCB 106/118 Congener |
| PCB 107 | PCB 107 Congener |
| PCB 107/108/144 | PCB 107/108/144 Congener |
| PCB 107/109 | PCB 107/109 Congener |
| PCB 107/124 | PCB 107/124 Congener |
| PCB 108 | PCB 108 Congener |
| PCB 108/112 | PCB 108/112 Congener |
| PCB 108/124 | PCB 108/124 Congener |
| PCB 109 | PCB 109 Congener |
| PCB 110 | PCB 110 Congener |
| PCB 110/115 | PCB 110/115 Congener |
| PCB 110/151 | PCB 110/151 Congener |
| PCB 111 | PCB 111 Congener |
| PCB 111(Surrogate) | Surrogate: PCB 111 Congener |
| PCB 111/115 | PCB 111/115 Congener |
| PCB 111-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 111-13C12 |
| PCB 112 | PCB 112 Congener |
| PCB 112(Surrogate) | Surrogate: PCB 112 Congener |
| PCB 112/119 | PCB 112/119 Congener |
| PCB 113 | PCB 113 Congener |
| PCB 114 | PCB 114 Congener |
| PCB 114 (TEQ ND=0) | PCB 114 (TEQ ND=0) |
| PCB 114 (TEQ ND=1/2 DL) | PCB 114 (TEQ ND=1/2 DL) |
| PCB 114 (TEQ ND=DL) | PCB 114 (TEQ ND=DL) |
| PCB 114(Surrogate) | Surrogate: PCB 114 Congener |
| PCB 114/122/131 | PCB 114/122/131 Congener |
| PCB 114/153 | PCB 114/153 Congener |
| PCB 114-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 114-13C12 |
| PCB 115 | PCB 115 Congener |
| PCB 116 | PCB 116 Congener |
| PCB 117 | PCB 117 Congener |
| PCB 118 | PCB 118 Congener |
| PCB 118 (TEQ ND=0) | PCB 118 (TEQ ND=0) |
| PCB 118 (TEQ ND=1/2 DL) | PCB 118 (TEQ ND=1/2 DL) |
| PCB 118 (TEQ ND=DL) | PCB 118 (TEQ ND=DL) |
| PCB 118(Surrogate) | Surrogate: PCB 118 Congener |
| PCB 118-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 118-13C12 |
| PCB 119 | PCB 119 Congener |
| PCB 120 | PCB 120 Congener |
| PCB 121 | PCB 121 Congener |
| PCB 122 | PCB 122 Congener |
| PCB 123 | PCB 123 Congener |
| PCB 123 (TEQ ND=0) | PCB 123 (TEQ ND=0) |
| PCB 123 (TEQ ND=1/2 DL) | PCB 123 (TEQ ND=1/2 DL) |
| PCB 123 (TEQ ND=DL) | PCB 123 (TEQ ND=DL) |
| PCB 123(Surrogate) | Surrogate: PCB 123 Congener |
| PCB 123/149 | PCB 123/149 Congener |
| PCB 123-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 123-13C12 |
| PCB 124 | PCB 124 Congener |
| PCB 125 | PCB 125 Congener |
| PCB 126 | PCB 126 Congener |
| PCB 126 (TEQ ND=0) | PCB 126 (TEQ ND=0) |
| PCB 126 (TEQ ND=1/2 DL) | PCB 126 (TEQ ND=1/2 DL) |
| PCB 126 (TEQ ND=DL) | PCB 126 (TEQ ND=DL) |
| PCB 126(Surrogate) | Surrogate: PCB 126 Congener |
| PCB 126-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 126-13C12 |
| PCB 127 | PCB 127 Congener |
| PCB 127-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 127-13C12 |
| PCB 128 | PCB 128 Congener |
| PCB 128/162 | PCB 128/162 Congener |
| PCB 128/166 | PCB 128/166 Congener |
| PCB 128/166(Surrogate) | Surrogate: PCB 128/166 |
| PCB 128/167 | PCB 128/167 Congener |
| PCB 129 | PCB 129 Congener |
| PCB 129/138 | PCB 129/138 Congener |
| PCB 129/138/160/163 | PCB 129/138/160/163 Congener |
| PCB 129/138/163 | PCB 129/138/163 Congener |
| PCB 129/160 | PCB 129/160 Congener |
| PCB 129/163 | PCB 129/163 Congener |
| PCB 129/166 | PCB 129/166 Congener |
| PCB 130 | PCB 130 Congener |
| PCB 131 | PCB 131 Congener |
| PCB 131/133 | PCB 131/133 Congener |
| PCB 132 | PCB 132 Congener |
| PCB 132/137 | PCB 132/137 Congener |
| PCB 132/146 | PCB 132/146 Congener |
| PCB 132/153 | PCB 132/153 Congener |
| PCB 132/153/168 | PCB 132/153/168 Congener |
| PCB 132/161 | PCB 132/161 Congener |
| PCB 132/168 | PCB 132/168 Congener |
| PCB 133 | PCB 133 Congener |
| PCB 133/142 | PCB 133/142 Congener |
| PCB 134 | PCB 134 Congener |
| PCB 134/143 | PCB 134/143 Congener |
| PCB 135 | PCB 135 Congener |
| PCB 135/151 | PCB 135/151 Congener |
| PCB 135/151/154 | PCB 135/151/154 Congener |
| PCB 135/154 | PCB 135/154 Congener |
| PCB 136 | PCB 136 Congener |
| PCB 137 | PCB 137 Congener |
| PCB 137/164 | PCB 137/164 Congener |
| PCB 137/176 | PCB 137/176 Congener |
| PCB 138 | PCB 138 Congener |
| PCB 138(Surrogate) | Surrogate: PCB 138 Congener |
| PCB 138/158 | PCB 138/158 Congener |
| PCB 138/160 | PCB 138/160 Congener |
| PCB 138/163 | PCB 138/163 |
| PCB 138/163/164 | PCB 138/163/164 Congener |
| PCB 138-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 138-13C12 |
| PCB 139 | PCB 139 Congener |
| PCB 139/140 | PCB 139/140 Congener |
| PCB 139/149 | PCB 139/149 Congener |
| PCB 140 | PCB 140 Congener |
| PCB 141 | PCB 141 Congener |
| PCB 141/179 | PCB 141/179 Congener |
| PCB 141-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 141-13C12 |
| PCB 142 | PCB 142 Congener |
| PCB 143 | PCB 143 Congener |
| PCB 144 | PCB 144 Congener |
| PCB 145 | PCB 145 Congener |
| PCB 146 | PCB 146 Congener |
| PCB 146/165 | PCB 146/165 Congener |
| PCB 147 | PCB 147 Congener |
| PCB 147/149 | PCB 147/149 Congener |
| PCB 148 | PCB 148 Congener |
| PCB 149 | PCB 149 Congener |
| PCB 150 | PCB 150 Congener |
| PCB 151 | PCB 151 Congener |
| PCB 151/154 | PCB 151/154 |
| PCB 152 | PCB 152 Congener |
| PCB 153 | PCB 153 Congener |
| PCB 153(Surrogate) | Surrogate: PCB 153 Congener |
| PCB 153/168 | PCB 153/168 Congener |
| PCB 153-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 153-13C12 |
| PCB 154 | PCB 154 Congener |
| PCB 155 | PCB 155 Congener |
| PCB 155(Surrogate) | Surrogate: PCB 155 Congener |
| PCB 155-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 155-13C12 |
| PCB 156 | PCB 156 Congener |
| PCB 156 (TEQ ND=0) | PCB 156 (TEQ ND=0) |
| PCB 156 (TEQ ND=1/2 DL) | PCB 156 (TEQ ND=1/2 DL) |
| PCB 156 (TEQ ND=DL) | PCB 156 (TEQ ND=DL) |
| PCB 156(Surrogate) | Surrogate: PCB 156 Congener |
| PCB 156/157 | PCB 156/157 Congener |
| PCB 156/157 (TEQ ND=0) | PCB 156/157 (TEQ ND=0) |
| PCB 156/157 (TEQ ND=1/2 DL) | PCB 156/157 (TEQ ND=1/2 DL) |
| PCB 156/157 (TEQ ND=DL) | PCB 156/157 (TEQ ND=DL) |
| PCB 156/157(Surrogate) | Surrogate: PCB 156/157 Congener |
| PCB 156/171 | PCB 156/171 Congener |
| PCB 156/171/202 | PCB 156/171/202 Congener |
| PCB 156/177/200 | PCB 156/177/200 Congener |
| PCB 156-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 156-13C12 |
| PCB 156-13C12/157-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 156-13C12/157-13C12 |
| PCB 157 | PCB 157 Congener |
| PCB 157 (TEQ ND=0) | PCB 157 (TEQ ND=0) |
| PCB 157 (TEQ ND=1/2 DL) | PCB 157 (TEQ ND=1/2 DL) |
| PCB 157 (TEQ ND=DL) | PCB 157 (TEQ ND=DL) |
| PCB 157(Surrogate) | Surrogate: PCB 157 Congener |
| PCB 157/173 | PCB 157/173 Congener |
| PCB 157/173/201 | PCB 157/173/201 Congener |
| PCB 157/180 | PCB 157/180 Congener |
| PCB 157-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 157-13C12 |
| PCB 158 | PCB 158 Congener |
| PCB 158/160 | PCB 158/160 Congener |
| PCB 159 | PCB 159 Congener |
| PCB 159(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 159 |
| PCB 159(Surrogate) | Surrogate: PCB 159 Congener |
| PCB 159/182/187 | PCB 159/182/187 Congener |
| PCB 159-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 159-13C12 |
| PCB 160 | PCB 160 Congener |
| PCB 161 | PCB 161 Congener |
| PCB 162 | PCB 162 Congener |
| PCB 163 | PCB 163 Congener |
| PCB 164 | PCB 164 Congener |
| PCB 165 | PCB 165 Congener |
| PCB 166 | PCB 166 Congener |
| PCB 166/167 | PCB 166/167 Congener |
| PCB 167 | PCB 167 Congener |
| PCB 167 (TEQ ND=0) | PCB 167 (TEQ ND=0) |
| PCB 167 (TEQ ND=1/2 DL) | PCB 167 (TEQ ND=1/2 DL) |
| PCB 167 (TEQ ND=DL) | PCB 167 (TEQ ND=DL) |
| PCB 167(Surrogate) | Surrogate: PCB 167 Congener |
| PCB 167-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 167-13C12 |
| PCB 168 | PCB 168 Congener |
| PCB 168/132 | PCB 168/132 Congener |
| PCB 169 | PCB 169 Congener |
| PCB 169 (TEQ ND=0) | PCB 169 (TEQ ND=0) |
| PCB 169 (TEQ ND=1/2 DL) | PCB 169 (TEQ ND=1/2 DL) |
| PCB 169 (TEQ ND=DL) | PCB 169 (TEQ ND=DL) |
| PCB 169(Surrogate) | Surrogate: PCB 169 Congener |
| PCB 169-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 169-13C12 |
| PCB 170 | PCB 170 Congener |
| PCB 170(Surrogate) | Surrogate: PCB 170 Congener |
| PCB 170/190 | PCB 170/190 Congener |
| PCB 170-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 170-13C12 |
| PCB 171 | PCB 171 Congener |
| PCB 171/173 | PCB 171/173 Congener |
| PCB 171/202 | PCB 171/202 Congener |
| PCB 172 | PCB 172 Congener |
| PCB 173 | PCB 173 Congener |
| PCB 174 | PCB 174 Congener |
| PCB 175 | PCB 175 Congener |
| PCB 176 | PCB 176 Congener |
| PCB 177 | PCB 177 Congener |
| PCB 178 | PCB 178 Congener |
| PCB 178(Surrogate) | Surrogate: PCB 178 Congener |
| PCB 178-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 178-13C12 |
| PCB 179 | PCB 179 Congener |
| PCB 180 | PCB 180 Congener |
| PCB 180(Surrogate) | Surrogate: PCB 180 Congener |
| PCB 180/193 | PCB 180/193 Congener |
| PCB 180/193(Surrogate) | Surrogate: PCB 180/193 |
| PCB 180-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 180-13C12 |
| PCB 181 | PCB 181 Congener |
| PCB 182 | PCB 182 Congener |
| PCB 182/187 | PCB 182/187 Congener |
| PCB 183 | PCB 183 Congener |
| PCB 183/185 | PCB 183/185 Congener |
| PCB 184 | PCB 184 Congener |
| PCB 185 | PCB 185 Congener |
| PCB 186 | PCB 186 Congener |
| PCB 187 | PCB 187 Congener |
| PCB 188 | PCB 188 Congener |
| PCB 188(Surrogate) | Surrogate: PCB 188 Congener |
| PCB 188-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 188-13C12 |
| PCB 189 | PCB 189 Congener |
| PCB 189 (TEQ ND=0) | PCB 189 (TEQ ND=0) |
| PCB 189 (TEQ ND=1/2 DL) | PCB 189 (TEQ ND=1/2 DL) |
| PCB 189 (TEQ ND=DL) | PCB 189 (TEQ ND=DL) |
| PCB 189(Surrogate) | Surrogate: PCB 189 Congener |
| PCB 189-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 189-13C12 |
| PCB 190 | PCB 190 Congener |
| PCB 191 | PCB 191 Congener |
| PCB 191(Surrogate) | Surrogate: PCB 191 Congener |
| PCB 192 | PCB 192 Congener |
| PCB 193 | PCB 193 Congener |
| PCB 194 | PCB 194 Congener |
| PCB 194(Surrogate) | Surrogate: PCB 194 Congener |
| PCB 194-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 194-13C12 |
| PCB 195 | PCB 195 Congener |
| PCB 195/208 | PCB 195/208 Congener |
| PCB 196 | PCB 196 Congener |
| PCB 196/203 | PCB 196/203 Congener |
| PCB 197 | PCB 197 Congener |
| PCB 197/200 | PCB 197/200 Congener |
| PCB 198 | PCB 198 Congener |
| PCB 198(Surrogate) | Surrogate: PCB 198 Congener |
| PCB 198/199 | PCB 198/199 Congener |
| PCB 199 | PCB 199 Congener |
| PCB 199/200 | PCB 199/200 Congener |
| PCB 200 | PCB 200 Congener |
| PCB 201 | PCB 201 Congener |
| PCB 202 | PCB 202 Congener |
| PCB 202(Surrogate) | Surrogate: PCB 202 Congener |
| PCB 202-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 202-13C12 |
| PCB 203 | PCB 203 Congener |
| PCB 204 | PCB 204 Congener |
| PCB 205 | PCB 205 Congener |
| PCB 205(Surrogate) | Surrogate: PCB 205 Congener |
| PCB 205-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 205-13C12 |
| PCB 206 | PCB 206 Congener |
| PCB 206(Surrogate) | Surrogate: PCB 206 Congener |
| PCB 206-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 206-13C12 |
| PCB 207 | PCB 207 Congener |
| PCB 207(Surrogate) | Surrogate: PCB 207 Congener |
| PCB 208 | PCB 208 Congener |
| PCB 208(Surrogate) | Surrogate: PCB 208 Congener |
| PCB 208-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 208-13C12 |
| PCB 209 | PCB 209 Congener (Decachlorobiphenyl) (DCB) |
| PCB 209(Surrogate) | Surrogate: PCB 209 Congener (Decachlorobiphenyl) (DCB) |
| PCB 209(Surrogate)DB-608 | Surrogate: PCB 209 run on DB-608 (Decachlorobiphenyl) (DCB) |
| PCB 209(Surrogate)HP-5 | Surrogate: PCB 209 run on HP-5 (Decachlorobiphenyl) (DCB) |
| PCB 209-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 209-13C |
| PCB 209-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 209-13C12 |
| PCB AROCLOR 1016 | PCB Aroclor 1016 |
| PCB AROCLOR 1221 | PCB Aroclor 1221 |
| PCB AROCLOR 1232 | PCB Aroclor 1232 |
| PCB AROCLOR 1242 | PCB Aroclor 1242 |
| PCB AROCLOR 1248 | PCB Aroclor 1248 |
| PCB AROCLOR 1254 | PCB Aroclor 1254 |
| PCB AROCLOR 1260 | PCB Aroclor 1260 |
| PCB AROCLOR 1262 | PCB Aroclor 1262 |
| PCB AROCLOR 1268 | PCB AROCLOR 1268 |
| PCB TEQ (3 PCBs) | PCB TEQ (3 PCBs) |
| PCB TEQ (5 PCBs) | PCB TEQ (5 PCBs) |
| PCB TOTAL (TEQ ND=0) | PCB TOTAL (TEQ ND=0) |
| PCB TOTAL (TEQ ND=1/2 DL) | PCB TOTAL (TEQ ND=1/2 DL) |
| PCB TOTAL (TEQ ND=DL) | PCB TOTAL (TEQ ND=DL) |
| PCT AROCLOR 5432 | Polychlorinated Terphenyl AROCLOR 5432 |
| PCT AROCLOR 5442 | Polychlorinated Terphenyl AROCLOR 5442 |
| PCT AROCLOR 5460 | Polychlorinated Terphenyl AROCLOR 5460 |
| PCT_DR | Percent dry channel |
| PCT_FAST | Percent fast-water habitat of reach |
| PCT_POOL | Percent pool habitat of reach |
| PCT_RC | Percent concrete or asphalt streambed substrate physical-habitat metric |
| PCT_SAFN | Percent sands and fines streambed substrate physical-habitat metric |
| PCT_SLOW | Percent slow-water habitat of reach |
| Pebble | Pebble |
| Pebulate | Pebulate (PEBC) |
| PeCDD, 1,2,3,7,8- | 1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD) |
| PeCDD, 1,2,3,7,8-(Surrogate) | Surrogate: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD) |
| PeCDD-13C12, 1,2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin-13C12 (PeCDD-13C12) |
| PeCDF, 1,2,3,7,8- | 1,2,3,7,8-Pentachlorodibenzofuran (PeCDF) |
| PeCDF, 1,2,3,7,8-(Surrogate) | Surrogate: 1,2,3,7,8-Pentachlorodibenzofuran (PeCDF) |
| PeCDF, 2,3,4,7,8- | 2,3,4,7,8-Pentachlorodibenzofuran (PeCDF) |
| PeCDF, 2,3,4,7,8-(Surrogate) | Surrogate: 2,3,4,7,8-Pentachlorodibenzofuran (PeCDF) |
| PeCDF-13C12, 1,2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,7,8-Pentachlorodibenzofuran-13C12 (PeCDF-13C12) |
| PeCDF-13C12, 2,3,4,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,4,7,8-Pentachlorodibenzofuran-13C12 (PeCDF-13C12) |
| Pen/Marker | Pen/Marker |
| Pendimethalin | Pendimethalin (Prowl) |
| Penicillin G | Penicillin G |
| Penicillin V | Penicillin V |
| Penoxsulam | Penoxsulam |
| Pentabromobenzene | Pentabromobenzene (PBBZ) |
| Pentabromobenzyl acrylate | Pentabromobenzyl acrylate (PBBA) |
| Pentabromobenzyl bromide | Pentabromobenzyl bromide (PBBB) |
| Pentabromobenzyl Bromide-1/Pentabromotoluene | Pentabromobenzyl Bromide (isomer 1)/Pentabromotoluene (PBBB-1/PBT coeluants) |
| Pentabromobenzyl Bromide-2/Polybrominated Biphenyl 101 | Pentabromobenzyl bromide (isomer 2)/Polybrominated Biphenyl 101 (PBBB-2/BB-101 coeluants) |
| Pentabromoethylbenzene | Pentabromoethylbenzene (PBEB) |
| Pentabromotoluene | Pentabromotoluene (PBT) |
| Pentachloroanisole | Pentachloroanisole |
| Pentachlorobenzene | Pentachlorobenzene |
| Pentachlorobenzene(Surrogate) | Surrogate: Pentachlorobenzene |
| Pentachlorobenzene-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Pentachlorobenzene-13C6 |
| Pentachloroethane | Pentachloroethane |
| Pentachloronitrobenzene | Pentachloronitrobenzene (PCNB) |
| Pentachlorophenol | Pentachlorophenol |
| Pentacosane, n- | n-Pentacosane |
| Pentadecane, n- | n-Pentadecane |
| Penthiopyrad | Penthiopyrad |
| Pentoxifylline | Pentoxifylline |
| Percent normal pluteus stage | Percent normal pluteus stage |
| Perchlorate | Perchlorate |
| Perfluoro(2-ethoxyethane)sulfonic Acid | Perfluoro(2-ethoxyethane)sulfonic acid (PFEESA) |
| Perfluoro(4-Ethylcyclohexane)Sulfonic Acid | Perfluoro(4-Ethylcyclohexane)Sulfonic Acid (Perfluoro(Perfluoroethyl)Cyclohexanesulfonic Acid) (PFecHS) |
| Perfluoro-2-Ethoxypropanoic Acid | Perfluoro-2-Ethoxypropanoic Acid (PEPA) |
| Perfluoro-2-Methoxyacetic Acid | Perfluoro-2-Methoxyacetic Acid (PFMOAA) |
| Perfluoro-2-Propoxypropanoic Acid | Perfluoro-2-Propoxypropanoic Acid |
| Perfluoro-3-([1-(Ethenyloxy)Propan-2-yl]oxy)Propanoic Acid | Perfluoro-3-([1-(Ethenyloxy)Propan-2-yl]oxy)Propanoic Acid (EVE Acid) |
| Perfluoro-3,5,7,9,11-Pentaoxadodecanoic Acid | Perfluoro-3,5,7,9,11-Pentaoxadodecanoic Acid (PFO5DoDA) |
| Perfluoro-3,5,7,9-Butaoxadecanoic Acid | Perfluoro-3,5,7,9-Butaoxadecanoic Acid (Perfluoro-3,5,7,9-Tetraoxadecanoic Acid) (PFO4DA) |
| Perfluoro-3,5,7-Trioxaoctanoic Acid | Perfluoro-3,5,7-Trioxaoctanoic Acid (PFO3OA) |
| Perfluoro-3,5-Dioxahexanoic Acid | Perfluoro-3,5-Dioxahexanoic Acid (PFO2HxA) |
| Perfluoro-3,6-Dioxa-4-Methyl-7-Octene-1-Sulfonic Acid | Perfluoro-3,6-Dioxa-4-Methyl-7-Octene-1-Sulfonic Acid (PS Acid) (Nafion Byproduct 1) |
| Perfluoro-3-methoxypropanoic Acid | Perfluoro-3-methoxypropanoic Acid (PFMPA) |
| Perfluoro-4-(2-Sulfoethoxy)Pentanoic Acid | Perfluoro-4-(2-Sulfoethoxy)Pentanoic Acid (R-PSDA) (Nafion Byproduct 4) |
| Perfluoro-4-Isopropoxybutanoic Acid | Perfluoro-4-Isopropoxybutanoic Acid (PFECA G) (PFPE-1) |
| Perfluoro-4-methoxybutanoic Acid | Perfluoro-4-methoxybutanoic Acid (PFMBA) |
| Perfluoro-4-Methyl-3,6-Dioxaoctanesulfonic Acid, 7H- | 7H-Perfluoro-4-Methyl-3,6-Dioxaoctanesulfonic Acid (Hydro-PS Acid) (Nafion Byproduct 2) |
| Perfluorobutanesulfonic Acid | Perfluorobutanesulfonic Acid (PFBS) |
| Perfluorobutanesulfonic Acid-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorobutanesulfonic Acid-13C3 (PFBS-13C3) |
| Perfluorobutanoic Acid | Perfluorobutanoic Acid (PFBA) |
| Perfluorobutanoic Acid-13C4(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorobutanoic Acid-13C4 (PFBA-13C4) |
| Perfluorodecane Sulfonic acid, 1H,1H,2H,2H- | 1H,1H,2H,2H-Perfluorodecane Sulfonic Acid (8:2FTS) |
| Perfluorodecane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue) | Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorodecane Sulfonic Acid-13C2 (8:2FTS-13C2) |
| Perfluorodecanesulfonic Acid | Perfluorodecanesulfonic Acid (PFDS) |
| Perfluorodecanoic Acid | Perfluorodecanoic Acid (PFDA) |
| Perfluorodecanoic Acid-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorodecanoic Acid-13C2 (PFDA-13C2) |
| Perfluorodecanoic Acid-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorodecanoic Acid-13C6 (PFDA-13C6) |
| Perfluorodecylphosphate, 1H,1H,2H,2H- | 1H,1H,2H,2H-perfluorodecylphosphate (8:2 monoPAP) |
| Perfluorodecylphosphate-13C2, 1H,1H,2H,2H-(Surrogate) | Surrogate: 1H,1H,2H,2H-perfluorodecylphosphate-13C2 |
| Perfluorododecane Sulfonic Acid, 1H,1H,2H,2H- | 1H,1H,2H,2H-Perfluorododecane Sulfonic Acid (10:2 FTS) |
| Perfluorododecane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue) | Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorododecane Sulfonic Acid-13C2 (10:2 FTS-13C2) |
| Perfluorododecanesulfonic Acid | Perfluorododecanesulfonic Acid (PFDoS) |
| Perfluorododecanoic Acid | Perfluorododecanoic Acid (PFDoA) |
| Perfluorododecanoic Acid-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorododecanoic Acid-13C2 (PFDoA-13C2) |
| Perfluoroethanesulfonic Acid, 2-(1,2,2,2-Tetrafluoroethoxy) | 2-(1,2,2,2-Tetrafluoroethoxy)Perfluoroethanesulfonic Acid (NVHOS) |
| Perfluoroheptanesulfonic Acid | Perfluoroheptanesulfonic Acid (PFHpS) |
| Perfluoroheptanoic Acid | Perfluoroheptanoic Acid (PFHpA) |
| Perfluoroheptanoic acid-13C4(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluoroheptanoic Acid-13C4 (PFHpA-13C4) |
| Perfluoroheptyl Propanoic Acid, 3- | 3-Perfluoroheptyl Propanoic Acid (7:3FTCA) |
| Perfluorohexadecanoic Acid | Perfluorohexadecanoic acid (PFHxDA) |
| Perfluorohexadecanoic Acid-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorohexadecanoic Acid-13C2 (PFHxDA-13C2) |
| Perfluorohexane Sulfonic Acid, 1H,1H,2H,2H- | 1H,1H,2H,2H-Perfluorohexane Sulfonic Acid (4:2FTS) |
| Perfluorohexane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue) | Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorohexane Sulfonic Acid-13C2 (4:2FTS-13C2) |
| Perfluorohexanesulfonic Acid | Perfluorohexanesulfonic Acid (PFHxS) |
| Perfluorohexanesulfonic Acid-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorohexanesulfonic Acid-13C3 (PFHxS-13C3) |
| Perfluorohexanesulfonic Acid-18O2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorohexanesulfonic Acid-18O2 (PFHxS-18O2) |
| Perfluorohexanoic Acid | Perfluorohexanoic Acid (PFHxA) |
| Perfluorohexanoic Acid-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorohexanoic Acid-13C2 (PFHxA-13C2) |
| Perfluorohexanoic Acid-13C5(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorohexanoic Acid-13C5 (PFHxA-13C5) |
| Perfluorohexylperfluorooctylphosphinate | Perfluorohexylperfluorooctylphosphinate (6:8 PFPi) |
| Perfluorohexylphosphonate | Perfluorohexylphosphonate (PFHxPA) |
| Perfluorohexylphosphonate-Cl(Surrogate) | Surrogate: Perfluorohexylphosphonate-Cl |
| Perfluorononanesulfonic Acid | Perfluorononanesulfonic Acid (PFNS) |
| Perfluorononanoic Acid | Perfluorononanoic Acid (PFNA) |
| Perfluorononanoic Acid-13C5(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorononanoic Acid-13C5 (PFNA-13C5) |
| Perfluorononanoic Acid-13C9(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorononanoic Acid-13C9 (PFNA-13C9) |
| Perfluorooctadecanoic Acid | Perfluorooctadecanoic Acid (PFODA) (PFOcDA) |
| Perfluorooctane Sulfonamido Acetic Acid | Perfluorooctane Sulfonamido Acetic Acid (FOSAA) |
| Perfluorooctane Sulfonic Acid, 1H,1H,2H,2H- | 1H,1H,2H,2H-Perfluorooctane Sulfonic Acid (6:2FTS) |
| Perfluorooctane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue) | Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorooctane Sulfonic Acid-13C2 (6:2FTS-13C2) |
| Perfluorooctanesulfonamide | Perfluorooctanesulfonamide (PFOSA) |
| Perfluorooctanesulfonamide-13C8(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanesulfonamide-13C8 (PFOSA-13C8) |
| Perfluorooctanesulfonamide-13C8(Surrogate) | Surrogate: Perfluorooctanesulfonamide-13C8 |
| Perfluorooctanesulfonic Acid | Perfluorooctanesulfonic Acid (PFOS) |
| Perfluorooctanesulfonic Acid-13C4(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanesulfonic Acid-13C4 (PFOS-13C4) |
| Perfluorooctanesulfonic Acid-13C4(Surrogate) | Surrogate: Perfluorooctanesulfonic Acid-13C4 (PFOS-13C4) |
| Perfluorooctanesulfonic Acid-13C8(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanesulfonic Acid-13C8 (PFOS-13C8) |
| Perfluorooctanesulfonic Acid-13C8(Surrogate) | Surrogate: Perfluorooctanesulfonic Acid-13C8 (PFOS-13C8) |
| Perfluorooctanoic Acid | Perfluorooctanoic Acid (PFOA) |
| Perfluorooctanoic Acid, 2H,2H,3H,3H- | 2H,2H,3H,3H-Perfluorooctanoic Acid (5:3FTCA) |
| Perfluorooctanoic Acid-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanoic Acid-13C2 (PFOA-13C2) |
| Perfluorooctanoic Acid-13C2(Surrogate) | Surrogate: Perfluorooctanoic Acid-13C2 (PFOA-13C2) |
| Perfluorooctanoic Acid-13C4(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanoic Acid-13C4 (PFOA-13C4) |
| Perfluorooctanoic Acid-13C8(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanoic Acid-13C8 (PFOA-13C8) |
| Perfluorooctylphosphate, 1H,1H,2H,2H- | 1H,1H,2H,2H-perfluorooctylphosphate (6:2 monoPAP) |
| Perfluorooctylphosphate-13C2, 1H,1H,2H,2H-(Surrogate) | Surrogate: 1H,1H,2H,2H-perfluorooctylphosphate-13C2 |
| Perfluorooctylphosphonate | Perfluorooctylphosphonate (PFOPA) |
| Perfluoropentanesulfonic Acid | Perfluoropentanesulfonic Acid (PFPeS) |
| Perfluoropentanoic Acid | Perfluoropentanoic Acid (PFPeA) |
| Perfluoropentanoic Acid, 4-(2-Carboxy-1,1,2,2-Tetrafluoroethoxy)- | 4-(2-Carboxy-1,1,2,2-Tetrafluoroethoxy)-Perfluoropentanoic Acid (R-EVE) |
| Perfluoropentanoic Acid-13C5(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluoropentanoic Acid-13C5 (PFPeA-13C5) |
| Perfluoropropanesulfonic Acid | Perfluoropropanesulfonic Acid (PFPrS) |
| Perfluoropropanoic Acid | Perfluoropropanoic Acid (PFPrA) |
| Perfluoropropyl Propanoic Acid, 3- | 3-Perfluoropropyl Propanoic Acid (3:3FTCA) |
| Perfluorotetradecanoic Acid | Perfluorotetradecanoic Acid (PFTeDA) |
| Perfluorotetradecanoic Acid-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorotetradecanoic Acid-13C2 (PFTeDA-13C2) |
| Perfluorotridecanoic Acid | Perfluorotridecanoic Acid (PFTrDA) |
| Perfluorotridecanoic Acid-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorotridecanoic Acid-13C2 (PFTrDA-13C2) |
| Perfluoroundecanoic Acid | Perfluoroundecanoic Acid (PFUnA) |
| Perfluoroundecanoic Acid-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluoroundecanoic Acid-13C2 (PFUnA-13C2) |
| Perfluoroundecanoic Acid-13C7(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluoroundecanoic Acid-13C7 (PFUnA-13C7) |
| Periphyton Biomass Index | Periphyton Biomass Index |
| Permethrin, cis- | cis-Permethrin, formerly peak 1 |
| Permethrin, cis-(Surrogate) | Surrogate: cis-Permethrin |
| Permethrin, Total | Total Permethrin, sum peaks cis and trans (formerly 1 & 2) |
| Permethrin, trans- | trans-Permethrin formerly peak 2 |
| Permethrin, trans-(Surrogate) | Surrogate: trans-Permethrin |
| Permethrin-13C6, cis-(IsoDilAnalogue) | Isotope Dilution Analogue: cis-Permethrin-13C6 |
| Permethrin-13C6, cis-(Surrogate) | Surrogate: cis-Permethrin-13C6 |
| Permethrin-13C6, trans-(IsoDilAnalogue) | Isotope Dilution Analogue: trans-Permethrin-13C6 |
| Personal hygiene | Hygiene products |
| Perthane | Perthane |
| Perylene | Perylene |
| Perylene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Perylene-d12 |
| Perylene-d12(Surrogate) | Surrogate: Perylene-d12 |
| pH | pH |
| pH, Daily Maximum | Daily Maximum pH |
| pH, Daily Minimum | Daily Minimum pH |
| Phenanthrene | Phenanthrene |
| Phenanthrene/Anthracene, C1- | C1-Phenanthrene/Anthracene |
| Phenanthrene/Anthracene, C2- | C2-Phenanthrene/Anthracene |
| Phenanthrene/Anthracene, C3- | C3-Phenanthrene/Anthracene |
| Phenanthrene/Anthracene, C4- | C4-Phenanthrene/Anthracene |
| Phenanthrene-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Phenanthrene-d10 |
| Phenanthrene-d10(Surrogate) | Surrogate: Phenanthrene-d10 |
| Phenmedipham | Phenmedipham |
| Phenol | Phenol |
| Phenol, 2-(2H-Benzotriazol-2-yl)-4,6-bis(1-Methyl-1-Phenylethyl)- | 2-(2H-Benzotriazol-2-yl)-4,6-bis(1-methyl-1-phenylethyl)phenol (UV-234) |
| Phenol-d5(Surrogate) | Surrogate: Phenol-d5 |
| Phenol-d6(Surrogate) | Surrogate: Phenol-d6 |
| Phenolic Resin Fragment | Phenolic resin Fragment |
| Phenolics, Total | Total Phenolics, classification of phenols |
| Phenothrin | Phenothrin |
| Phenyl-p-phenylenediamine-quinone, N-Isopropyl-N'- | N-Isopropyl-N'-phenyl-p-phenylenediamine-quinone (IPPD-quinone) |
| Phenylpyrazole, 1-(Surrogate) | Surrogate: 1-Phenylpyrazole |
| Phenytoin | Phenytoin |
| Pheophytin a | Pheophytin a |
| PhiX174 | phi X 174 bacteriophage |
| Phone | Phone |
| Phorate | Phorate |
| Phorate sulfone | Phorate sulfone |
| Phorate sulfoxide | Phorate sulfoxide |
| Phoratoxon | Phoratoxon |
| Phoratoxon Sulfone | Phoratoxon Sulfone |
| Phoratoxon Sulfoxide | Phoratoxon Sulfoxide |
| Phosalone | Phosalone |
| Phosalone Oxon | Phosalone Oxon |
| Phosmet | Phosmet |
| Phosmet-Oxon | Phosmet-Oxon |
| Phosphamidon | Phosphamidon |
| Phosphate as P | Phosphate as P |
| Phosphorus as P | Phosphorus as P |
| Phosphorus as P, Total Organic | Total Organic Phosphorus (P-org) |
| Phosphorus, Inorganic | Inorganic Phosohorus |
| Phosphorus, Iron Bound | Phosphorus, Iron Bound |
| Phosphorus, loosely bound | Phosphorus, loosely bound |
| Photomirex | Photomirex |
| Phytane | Phytane |
| Picarbutrazox | Picarbutrazox |
| Picloram | Picloram |
| Picoxystrobin | Picoxystrobin |
| PictureCode | Picture code idenifier |
| Pipe, PVC | Pipe, PVC |
| Piperalin | Piperalin |
| Piperonyl Butoxide | Piperonyl Butoxide |
| Piperonyl Butoxide-d9(Surrogate) | Surrogate: Piperonyl Butoxide-d9 |
| Piperonyl Cyclonene | Piperonyl Cyclonene |
| Pipes, Drains | Pipes, Drains |
| Pirimicarb | Pirimicarb |
| Pirimicarb sulfone | Pirimicarb sulfone |
| Pirimicarb sulfoxide | Pirimicarb sulfoxide |
| Pirimiphos Methyl | Pirimiphos Methyl |
| Plastic | Plastic using Trash Protocol |
| Plastic MicroDebris, > 4.75 mm | Plastic MicroDebris, > 4.75 mm |
| Plastic MicroDebris, 0.355 mm | Plastic MicroDebris, 0.355 mm |
| Plastic MicroDebris, 0.500 mm | Plastic MicroDebris, 0.500 mm |
| Plastic MicroDebris, 1.0 mm | Plastic MicroDebris, 1.0 mm |
| Plastic MicroDebris, 2.0 mm | Plastic MicroDebris, 2.0 mm |
| Plastic MicroDebris, 4.75 mm | Plastic MicroDebris, 4.75 mm |
| Plastic MicroDebris, Black | Plastic MicroDebris, Black |
| Plastic MicroDebris, Blue | Plastic MicroDebris, Blue |
| Plastic MicroDebris, Clear | Plastic MicroDebris, Clear |
| Plastic MicroDebris, Green | Plastic MicroDebris, Green |
| Plastic MicroDebris, Grey | Plastic MicroDebris, Grey |
| Plastic MicroDebris, Orange | Plastic MicroDebris, Orange |
| Plastic MicroDebris, Peach | Plastic MicroDebris, Peach |
| Plastic MicroDebris, Pink | Plastic MicroDebris, Pink |
| Plastic MicroDebris, Red | Plastic MicroDebris, Red |
| Plastic MicroDebris, Tan | Plastic MicroDebris, Tan |
| Plastic MicroDebris, White | Plastic MicroDebris, White |
| Plastic MicroDebris, Yellow | Plastic MicroDebris, Yellow |
| Plastic, Other | Plastic, Other |
| Plate, Waxed Paper | Plate, Waxed Paper |
| PMMoV | Pepper mild mottle virus |
| Point Source Discharges Extent | Point Source Discharges Extent |
| Point Source Discharges Intensity | Point Source Discharges Intensity |
| Point Source Discharges Proximity | Point Source Discharges Proximity |
| Poly(acrylonitrile) fiber | Poly(acrylonitrile) fiber, that can be grouped under plastic category |
| Poly(Aryletherketone) Film | Poly(Aryletherketone) Film |
| Poly(methylhydrosiloxane) fiber | Poly(methylhydrosiloxane) fiber, that can be grouped under plastic category |
| Polyacrolein Fiber | Polyacrolein Fiber |
| Polyacrolein Fragment | Polyacrolein Fragment |
| Polyacrylamide fiber | Polyacrylamide fiber, that can be grouped under plastic category |
| Polycaprolactone Fiber | Polycaprolactone Fiber |
| Polycarbonate Fragment | Polycarbonate Fragment |
| Polyester fiber | Polyester fiber, including polyester blends (blended with cotton or other natural-based fibers), that can be grouped under plastic category |
| Polyester Fiber Bundle | Polyester Fiber Bundle |
| Polyether block amide Film | Polyether block amide Film |
| Polyethylene Co-acrylic Acid Film | Polyethylene co-acrylic acid Film |
| Polyethylene Co-acrylic Acid Foam | Polyethylene co-acrylic acid Foam |
| Polyethylene Co-acrylic Acid Fragment | Polyethylene co-acrylic acid Fragment |
| Polyethylene Co-acrylic Acid Sphere | Polyethylene co-acrylic acid Sphere |
| Polyethylene co-polymer fragment | Polyethylene co-polymer, that can be grouped under plastic category |
| Polyethylene Fiber | Polyethylene Fiber |
| Polyethylene Fiber Bundle | Polyethylene Fiber Bundle |
| Polyethylene Film | Polyethylene Film |
| Polyethylene Foam | Polyethylene Foam |
| Polyethylene fragment | Polyethylene fragment, that can be grouped under plastic category |
| Polyethylene pellet | Polyethylene pellet, with cylindrical or round shape but not perfectly spherical, that was clearly manufactured at this size (not a fragment), that can be grouped under plastic category |
| Polyethylene sphere | Polyethylene sphere, perfectly spherical shape and smaller than a pellet, that was clearly manufactured at this size (not a fragment), that can be grouped under plastic category |
| Polyethylene Terephthalate Film | Polyethylene terephthalate Film |
| Polyethylene Terephthalate Foam | Polyethylene terephthalate Foam |
| Polyethylene terephthalate fragment | Polyethylene terephthalate (PET) fragment that can be grouped under plastic category |
| Polyethylene Terephthalate/Polyurethane Fiber | Polyethylene terephthalate/polyurethane Fiber |
| Polyethylene wax fragment | Polyethylene wax fragment, that can be grouped under plastic category |
| Polyethylene wax sphere | Polyethylene wax sphere, that can be grouped under plastic category |
| Polyethylene/Polypropylene Co-polymer Fiber | Polyethylene/polypropylene copolymer Fiber |
| Polyethylene/Polypropylene Co-polymer Film | Polyethylene/polypropylene copolymer Film |
| Polyethylene/Polypropylene Co-polymer Fragment | Polyethylene/polypropylene copolymer Fragment |
| Polyethylene/Polypropylene Co-polymer Sphere | Polyethylene/polypropylene copolymer Sphere |
| Polyethylenimine Fiber | Polyethylenimine Fiber |
| Polyoxymethylene fragment | Polyoxymethylene fragment that can be grouped under the plastic category |
| Polypropylene fiber | Polypropylene fiber, that can be grouped under plastic category |
| Polypropylene Fiber Bundle | Polypropylene Fiber Bundle |
| Polypropylene film | Polypropylene film that can be grouped under the plastic category |
| Polypropylene Foam | Polypropylene Foam |
| Polypropylene fragment | Polypropylene fragment, that can be grouped under plastic category |
| Polypropylene Sphere | Polypropylene Sphere |
| Polystyrene Fiber | Polystyrene Fiber |
| Polystyrene Fiber Bundle | Polystyrene Fiber Bundle |
| Polystyrene Film | Polystyrene Film |
| Polystyrene foam | Polystyrene foam fragment, that can be grouped under plastic category |
| Polystyrene fragment | Polystyrene fragment, that can be grouped under plastic category |
| Polystyrene Sphere | Polystyrene Sphere |
| Polystyrene/Acrylic Co-polymer Fiber | Polystyrene/Acrylic Co-polymer Fiber |
| Polystyrene/Acrylic Co-polymer Film | Polystyrene/Acrylic Co-polymer Film |
| Polystyrene/Acrylic Co-polymer Foam | Polystyrene/Acrylic Co-polymer Foam |
| Polystyrene/Acrylic Co-polymer Fragment | Polystyrene/Acrylic Co-polymer Fragment |
| Polystyrene/Acrylic Co-polymer Sphere | Polystyrene/Acrylic Co-polymer Sphere |
| Polytetrafluoroethylene fiber | Polytetrafluoroethylene fiber, that can be grouped under plastic category |
| Polytetrafluoroethylene Fiber Bundle | Polytetrafluoroethylene Fiber Bundle |
| Polytetrafluoroethylene Film | Polytetrafluoroethylene Film |
| Polytetrafluoroethylene Fragment | Polytetrafluoroethylene Fragment |
| Polyurethane fiber | Polyurethane fiber, that can be grouped under plastic category |
| Polyurethane Film | Polyurethane Film |
| Polyurethane foam | Polyurethane foam fragment, that can be grouped under plastic category |
| Polyurethane fragment | Polyurethane fragment, not foam, that can be grouped under plastic category |
| Polyurethane Sphere | Polyurethane Sphere |
| Polyvinyl Acetate Fiber | Polyvinyl Acetate Fiber |
| Polyvinyl Acetate Film | Polyvinyl Acetate Film |
| Polyvinyl Acetate Fragment | Polyvinyl Acetate Fragment |
| Polyvinyl Alcohol Fiber | Polyvinyl Alcohol Fiber |
| Polyvinyl Alcohol Film | Polyvinyl Alcohol Film |
| Polyvinyl Alcohol Foam | Polyvinyl Alcohol Foam |
| Polyvinyl Alcohol Fragment | Polyvinyl Alcohol Fragment |
| Polyvinyl Butyral Fiber | Polyvinyl Butyral Fiber |
| Polyvinyl Butyral Film | Polyvinyl Butyral Film |
| Polyvinyl Butyral Foam | Polyvinyl Butyral Foam |
| Polyvinyl Butyral Fragment | Polyvinyl Butyral Fragment |
| Polyvinyl Chloride Fiber | Polyvinyl Chloride Fiber |
| Polyvinyl Chloride Film | Polyvinyl Chloride Film |
| Polyvinyl Chloride Foam | Polyvinyl Chloride Foam |
| Polyvinyl Chloride Fragment | Polyvinyl Chloride Fragment |
| Polyvinyl Ether Fiber | Polyvinyl Ether Fiber |
| Polyvinyl Ether Film | Polyvinyl Ether Film |
| Ponded | Ponded water that either evaporates and/or infiltrates and does not flow to a surface receiving water |
| Pool | Pool |
| Pool Form | Pool Form |
| Porosity | Porosity |
| Position | Position along transect where sample collected |
| Potassium | Potassium |
| Potential Non-Stormwater Source | Potential Non-Stormwater Source |
| Poultry | Poultry |
| Power Plants | Power Plants |
| Prallethrin | Prallethrin |
| Praziquantel | Praziquantel |
| Precipitation | Precipitation |
| PrecipitationLast24hrs | PrecipitationLast24hrs |
| Precipitationlast72hrs | Precipitation within the last 72 hours |
| Prednisolone | Prednisolone |
| Prednisone | Prednisone |
| Pressure | Pressure |
| Primidone | Primidone |
| Primitive Parks, Camping | Primitive Parks, Camping |
| Pristane | Pristane |
| Procambarus clarkia (SPY) | Procambarus clarkia, Assay name: SPY, 5’ AACTAGGGGTATAGTTGAGAG 3’, 5’ CAGAAGCTAAAGGAGGATAA 3’, 5HEX-AGGAGTTG AACAGGATGGACT-3IABkFQ |
| Procymidone | Procymidone |
| Prodiamine | Prodiamine |
| Profenofos | Profenofos |
| Profluralin | Profluralin |
| Progesterone | Progesterone |
| Progesterone-d9(IsoDilAnalogue) | Isotope Dilution Analogue: Progesterone-d9 |
| Promecarb | Promecarb (3-methyl-5-(1-methylethyl)phenyl methylcarbamate) |
| Promethazine | Promethazine |
| Promethazine-d4(Surrogate) | Surrogate: Promethazine-d4 |
| Prometon | Prometon |
| Prometryn | Prometryn |
| Pronamide | Pronamide (Propyzamide) |
| Propachlor | Propachlor |
| Propanil | Propanil |
| Propargite | Propargite |
| Propazine | Propazine |
| Propetamphos | Propetamphos |
| Propham | Propham |
| Propiconazole | Propiconazole |
| Proportion | Proportion |
| Propoxur | Propoxur |
| Propoxyphene | Propoxyphene |
| Propoxyphene-d5(Surrogate) | Surrogate: Propoxyphene-d5 |
| Propranolol | Propranolol |
| Propranolol-d7(Surrogate) | Surrogate: Propranolol-d7 |
| Propylbenzene, n- | n-Propylbenzene |
| Propylparaben | Propylparaben |
| Propyzamide | Propyzamide |
| Propyzamide metabolite | Propyzamide metabolite |
| Prosulfuron | Prosulfuron |
| Pseudo-nitzschia | Pseudo-nitzschia |
| p-Terphenyl-d14(Surrogate) | Surrogate: p-Terphenyl-d14 |
| Public Access | Public Access |
| Pydiflumetofen | Pydiflumetofen |
| Pymetrozin | Pymetrozin |
| Pymetrozine | Pymetrozine |
| Pyraclostrobin | Pyraclostrobin |
| Pyrazon | Pyrazon (Chloridazon) |
| Pyrene | Pyrene |
| Pyrene-d10(Surrogate) | Surrogate: Pyrene-d10 |
| Pyrethrin-1 | Pyrethrin-1 |
| Pyrethrin-2 | Pyrethrin-2 (Pyrethrin II) |
| Pyridaben | Pyridaben |
| Pyridine | Pyridine |
| Pyrimethanil | Pyrimethanil |
| Pyriproxifen | Pyriproxifen |
| Pyriproxyfen | Pyriproxyfen |
| Quinoline | Quinoline |
| Quinoxyfen | Quinoxyfen |
| Radium-226 | Radium-226 |
| Radium-228 | Radium-228 |
| Railroad Extent | Railroad Extent |
| Railroad Intensity | Railroad Intensity |
| Railroad Proximity | Railroad Proximity |
| Rangeland Extent | Rangeland Extent |
| Rangeland Intensity | Rangeland Intensity |
| Rangeland Proximity | Rangeland Proximity |
| Ranitidine | Ranitidine |
| Rapid | Rapid |
| Ratio of SEM/AVS | Ratio of SEM/AVS |
| RBI | Score for the Relative Benthic Index (RBI) |
| Rebar | Rebar |
| Reburial | Reburial |
| Relative Luminescence | Relative Luminescence |
| Reproduction | Reproduction |
| Residences | Residences |
| Residential Dumping | Residential Dumping |
| Residual Phosphorus | Residual Phosphorus |
| Resmethrin | Resmethrin |
| Resorcinol bis(Diphenyl Phosphate) | Resorcinol bis(Diphenyl Phosphate) |
| Retene | Retene |
| Ribbon, Non-plastic | Ribbon, Non-plastic |
| Ribbon, Packaging | Ribbon, Packaging |
| Richness | Richness |
| Riffle | Riffle |
| Riffle/Run Bank Stability | Riffle/Run Bank Stability (used for EMAP RBP 20-score habitat characterization) |
| Riffle/Run Channel Alteration | Riffle/Run Channel Alteration |
| Riffle/Run Channel Flow Status | Riffle/Run Channel Flow Status |
| Riffle/Run Embeddedness | Riffle/Run Embeddedness |
| Riffle/Run Epifaunal Substrate | Riffle/Run Epifaunal Substrate |
| Riffle/Run Frequency | Riffle/Run Frequency |
| Riffle/Run Riparian Zone Width | Riffle/Run Riparian Zone Width |
| Riffle/Run Sediment Deposition | Riffle/Run Sediment Deposition |
| Riffle/Run Vegetative Protection | Riffle/Run Vegetative Protection |
| Riffle/Run Velocity/Depth Regime | Riffle/Run Velocity/Depth Regime scale data |
| Rimsulfuron | Rimsulfuron |
| Riparian Bridges/Abutments | Riparian Bridges/Abutments |
| Riparian Buildings | Riparian Buildings |
| Riparian Canopy Big Trees | EMAP BA Specific - Riparian Canopy Big Trees (Trunk > 0.3m DBH) |
| Riparian Canopy Small Trees | EMAP BA Specific - Riparian Canopy Small Trees (Trunk < 0.3 m DBH) |
| Riparian Canopy Veg Type | Riparian Canopy Vegetation Type |
| Riparian Corridor Shading | Percent of stream's water surface upstream of sample location estimated to be shaded if the sun was directly over the stream |
| Riparian Cover Metric | Metric assesses total vegetation cover in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte. |
| Riparian Grasses | Riparian Grasses |
| Riparian GroundCover Barren | Riparian Ground Cover Barren, Bare Dirt or Duff |
| Riparian GroundCover NonWoody Plants | Riparian Ground Cover Non-woody Herbs, Grasses & Forbes |
| Riparian GroundCover Woody Shrubs | Riparian Ground Cover Woody Shrubs & Saplings |
| Riparian Landfill/Trash | Riparian Landfill/Trash |
| Riparian Logging | Riparian Logging Operations |
| Riparian Lower Canopy All Vegetation | Riparian Lower Canopy All Vegetation (merge of Riparian Understory Non-Woody Plants and Riparian Understory Woody Shrubs in EMAP BA) |
| Riparian Mining | Riparian Mining Activity |
| Riparian NonWoody Veg | Riparian NonWoody Veg |
| Riparian Orchards/Vineyards | Riparian Orchards/Vineyards |
| Riparian Park/Lawn | Riparian Park/Lawn |
| Riparian Pasture/Range | Riparian Pasture/Range/Hay field |
| Riparian Pavement | Riparian Pavement/Cleared Lot |
| Riparian Pipes | Riparian Piles (Inlet/Outlet) |
| Riparian Powerline | Human disturbance measure for powerlines |
| Riparian Road | Riparian Road/Railroad |
| Riparian Row Crops | Riparian Row Crops |
| Riparian Sub Condition/Vert Connectivity Metric | Metric assesses riparian substratum condition influencing natural infiltration capacity and vertical connectivity affecting alluvial permeability, subsurface flows and groundwater connectivity. |
| Riparian Trail | Human disturbance measure for trails |
| Riparian Understory NonWoody Plants | EMAP BA specific - Riparian Understory Non-woody Herbs, Grasses & Forbes |
| Riparian Understory Veg Type | Riparian Understory Vegetation Type |
| Riparian Understory Woody Shrubs | EMAP BA Specific - Riparian Understory Woody Shrubs & Saplings |
| Riparian Upper Canopy All Trees | Riparian Upper Canopy All Trees (merge of Riparian Canopy Big Trees and Small Trees in EMAP BA) |
| Riparian Upper Canopy Deciduous | Riparian Upper Canopy Deciduous |
| Riparian Upper Canopy Evergreen | Riparian Upper Canopy Evergreen |
| Riparian Vegetation Management | Riparian Vegetation Management |
| Riparian Vegetation Width Metric | Metric assesses the average width of the defined riparian zone along the assessment area. |
| Riparian Wall/Dike | Riparian Wall/Dike/Revetment/Riprap/Dam |
| Riparian Woody Veg | Riparian Woody Veg |
| RipRAM Index | Riparian Rapid Assessment Method (RAM) for California index score based on the average score of eight component metrics. |
| RipRap/Armored Channel bed/bank Extent | RipRap/Armored Channel bed/bank Extent |
| RipRap/Armored Channel bed/bank Intensity | RipRap/Armored Channel bed/bank Intensity |
| RipRap/Armored Channel bed/bank Proximity | RipRap/Armored Channel bed/bank Proximity |
| RisingGroundwater | Rising groundwater (i.e., a spring) that is the source of water in a receiving water and may contribute (or even define) the receiving water quality |
| RIVPACS_BI | Score for River Invertebrate Prediction and Classification System (RIVPACS) Benthic Index |
| Roads | Roads |
| Rope, Polypropylene | Rope, Polypropylene |
| Rope/Tie | Rope/Tie |
| Rotenolone | Rotenolone |
| Rotenone | Rotenone |
| Roxithromycin | Roxithromycin |
| Rubber Fiber | Rubber Fiber |
| Rubber Film | Rubber Film |
| Rubber Foam | Rubber Foam |
| Rubber fragment | Rubber fragment, including from tires |
| Rubber Materials (Non-Specific) | Rubber Materials (Non-Specific) |
| Rubber Piece | Rubber Piece |
| Rubber Sphere | Rubber Sphere |
| Run | Run |
| Rural Residential Extent | Rural Residential Extent |
| Rural Residential Intensity | Rural Residential Intensity |
| Rural Residential Proximity | Rural Residential Proximity |
| Sachets, Beverage | Beverage, Sachets/packets, e.g., Caprisuns |
| Safrotin | Safrotin |
| Salicylic Acid | Salicylic Acid |
| Salicylic Acid-d4(IsoDilAnalogue) | Isotope Dilution Analogue: Salicylic Acid-d4 |
| Salinity | Salinity |
| Salinity, Daily Mean | Daily Mean Salinity (Calculated) |
| Salmonella | Salmonella |
| Salmonella-invA | Salmonella-invA |
| Salmonella-ttr | Salmonella-ttr |
| SampleMassCollected | Mass of sample collected in the field |
| SampleVolume | Volume of water collected in the field |
| SamplingCrew | Sampling Crew |
| Sand | Sand |
| Sand + Fine | Sand + Fine |
| Sarafloxacin | Sarafloxacin |
| Saxitoxins | Saxitoxins |
| Scandium | Scandium |
| Seagrass | Seagrass |
| Sealed Shell Volume | Sealed Shell Volume (weight (in grams) of water displaced by each bivalve) |
| SeaState | SeaState |
| Secbumeton | Secbumeton |
| Secchi Depth | Measurement of clarity based on the depth at which the Secchi disk can be differentiated |
| Sedaxane | Sedaxane |
| Sediment Disturbance Other Extent | Sediment Disturbance Other Extent |
| Sediment Disturbance Other Intensity | Sediment Disturbance Other Intensity |
| Sediment Disturbance Other Proximity | Sediment Disturbance Other Proximity |
| Sediment Load Estimate | Sediment Load Estimate |
| Sediment reworking rate | Sediment reworking rate |
| SedimentExposure | SedimentExposure |
| Selenate as Se | Selenate as Se (Se VI) |
| Selenite as Se | Selenite as Se (Se IV) |
| Selenium | Selenium |
| Selenium, Methyl | Methyl Selenium (Dimethly Selenide) |
| Selenomethionine | Selenomethionine |
| SEM | SEM (Simultaneously Extracted Metals) |
| Sertraline | Sertraline |
| Sethoxydim | Sethoxydim |
| Settleable Solids | Settleable Solids |
| Sewage Treatment | Sewage Treatment |
| Shade | Amount of shade within the algae sampling area (1 m2) |
| Shoe | Shoe |
| Shopping Cart | Shopping Cart |
| Side Channel | Side Channel present |
| Siduron | Siduron |
| Silica as SiO2 | Silica as SiO2 |
| Silicate as Si | Silicate as Si (Si(OH)4) |
| Silicon | Silicon |
| Silicone Film | Silicone Film |
| Silicone Foam | Silicone Foam |
| Silicone Fragment | Silicone Fragment |
| Silt | Silt |
| Silt + Clay | Silt + Clay |
| Silver | Silver |
| Simazine | Simazine |
| Simazine(Surrogate) | Surrogate: Simazine |
| Simazine-D10(Surrogate) | Surrogate: Simazine-D10 |
| Simetone | Simetone |
| Simetryn | Simetryn |
| Simulium sp. (Simul) | Simulium sp., Assay name: Simul, 5’ TGGAGGATTTGGTAATTGACTTG 3’, 5’ GTTAAGGAAGGAGGAAGTATTCAAA 3’, 5HEX-AGCACCTGATATGGCATTTCCTCGA-3IABkFQ |
| Simvastatin | Simvastatin |
| Sinuosity | Ratio of the curvilinear length along a stream and the Euclidean (straight line) distance between two points along the stream |
| Site Length | Site Length |
| Site Width | Site Width |
| Sitosterol, beta- | beta-Sitosterol |
| SkyCode | SkyCode |
| Slope | Slope |
| SOD | Sediment Oxygen Demand (SOD) |
| Sodium | Sodium |
| Sodium Cacodylate | Sodium Cacodylate |
| Sodium chlorate | Sodium chlorate |
| Sodium cyanide | Sodium cyanide |
| Sodium Fluoroacetate (1080) | Sodium Fluoroacetate (1080) |
| Sodium methylarsonate | Sodium methylarsonate |
| Sodium tetraborate decahydrate | Sodium tetraborate decahydrate (Sodium borate) |
| Sodium Trichloroacetate | Sodium Trichloroacetate |
| Soft Plastic Piece, non-specific | Soft Plastic Piece, non-specific |
| Soft Sediment | Soft Sediment; indicates presence/absence of soft/small sediment at the point where depth is measured |
| Somatic Coliphage (E. coli CN-13) | Somatic Coliphage Plaques, Host Bacterium Strain: E. coli CN-13 |
| Soot | Soot/Black Carbon |
| SpecificConductivity | Specific Conductivity |
| Sports Ball | Sports Ball |
| Spray Paint Can | Spray Paint Can |
| Spring Boxes Extent | Spring Boxes Extent |
| Spring Boxes Intensity | Spring Boxes Intensity |
| Spring Boxes Proximity | Spring Boxes Proximity |
| SQO_CSI | Sediment Quality Objectives (SQO) Chemical Score Index (CSI) |
| SQO_LOE_Cat_Benthic | Sediment Quality Objectives Line of Evidence (SQO LOE) Benthic Community Condition Category Score. The score represents the disturbance levels of the benthic communities at a station in a bay/estuary compared to reference conditions. |
| SQO_LOE_Cat_Chemistry | Sediment Quality Objectives Line of Evidence (SQO LOE) Chemistry Category Score. The score represents the concentration of chemicals in sediments and potential risks the benthic organisms have from the pollutants in sediment at a station in a bay/estuary. |
| SQO_LOE_Cat_Toxicity | Sediment Quality Objectives Line of Evidence (SQO LOE) Toxicity Category Score. The score represents the response of invertebrates to bay/estuary sediment samples collected at a station but exposed in a controlled laboratory. |
| SQO_SA_Cat | Sediment Quality Objectives (SQO) Station Assessment Category. Overall SQO score for the station. The score represents the impact of pollutants in sediment to the aquatic life living in the sediment in bays/estuaries. |
| StationWaterDepth | Depth of waterbody where sample was collected |
| StationWaterDepth_Avg | Estimated average depth of the waterbody at the time of sampling |
| StationWaterDepth_Max | Estimated maximum depth of the waterbody at the time of sampling |
| Stearates, Lubricants, Waxes Film | Stearates, Lubricants, Waxes Film |
| Stearates, Lubricants, Waxes Foam | Stearates, Lubricants, Waxes Foam |
| Stearates, Lubricants, Waxes Fragment | Stearates, Lubricants, Waxes Fragment |
| Stick/Branch/Driftwood | Stick/Branch/Driftwood |
| Stigmastanol, beta | beta-Stigmastanol |
| Strapping bands, Plastic | Plastic bands used to strap things in place or together |
| Straw | Straw |
| Stream Confinement | Confinement based upon the valley width in relation to average bankfull width which the riverine system can migrate without encountering a hillside, terrace or other feature |
| Stream Gradient | Steepness of the stream |
| StreamBankCharacteristics_Concrete | StreamBankCharacteristics_Concrete |
| StreamBankCharacteristics_Earthen | StreamBankCharacteristics_Earthen |
| StreamBankCharacteristics_RipRap | StreamBankCharacteristics_RipRap |
| StreamBankCharacteristics_Sloped | StreamBankCharacteristics_Sloped |
| StreamBankCharacteristics_Vegetated | StreamBankCharacteristics_Vegetated |
| StreamBankCharacteristics_Vertical | StreamBankCharacteristics_Vertical |
| StreamBedCharacteristics_Concrete | StreamBedCharacteristics_Concrete |
| StreamBedCharacteristics_Earthen | StreamBedCharacteristics_Earthen |
| StreamBedCharacteristics_Rock | StreamBedCharacteristics_Rock |
| StreamBedCharacteristics_SubPlants | StreamBedCharacteristics_SubPlants |
| StreamMixing | Classification of stream mixing by stratification, well-mixed or poorly mixed |
| Streptococcus, Fecal | Fecal Streptococcus |
| Stretch | refers to stretch measurement in gillnet |
| Strontium | Strontium |
| Strontium-87/Strontium-86 Ratio | Strontium-87/Strontium-86 Ratio |
| Strontium-90 | Strontium-90 |
| Strychnine | Strychnine |
| Strychnine Sulfate | Strychnine Sulfate |
| Styrene | Styrene |
| Styrene Co-polymer Fiber | Styrene copolymer Fiber |
| Styrene Co-polymer Foam | Styrene copolymer Foam |
| Styrene Co-polymer Fragment | Styrene copolymer Fragment |
| Styrene Co-polymer Sphere | Styrene copolymer Sphere |
| Styrofoam Pellet | Styrofoam Pellet |
| SubreachesFished | Subreaches fished within a given waterbody |
| Substrate Modifier | Substrate Modifier |
| Substrate Size Class | Substrate Size Class |
| Suburban Residential Extent | Suburban Residential Extent |
| Suburban Residential Intensity | Suburban Residential Intensity |
| Suburban Residential Proximity | Suburban Residential Proximity |
| Sucralose | Sucralose |
| Sulfachloropyridazine | Sulfachloropyridazine |
| Sulfadiazine | Sulfadiazine |
| Sulfadimethoxine | Sulfadimethoxine |
| Sulfallate | Sulfallate (CDEC) |
| Sulfamerazine | Sulfamerazine |
| Sulfamethazine | Sulfamethazine |
| Sulfamethazine-13C6(Surrogate) | Surrogate: Sulfamethazine-13C6 |
| Sulfamethizole | Sulfamethizole |
| Sulfamethoxazole | Sulfamethoxazole |
| Sulfamethoxazole-13C6(Surrogate) | Surrogate: Sulfamethoxazole-13C6 |
| Sulfanilamide | Sulfanilamide |
| Sulfate | Sulfate |
| Sulfathiazole | Sulfathiazole |
| Sulfide, Dissolved | Dissolved Sulfide |
| Sulfide, Total | Total Sulfide |
| Sulfite as SO3 | Sulfite as SO3 |
| Sulfometuron Methyl | Sulfometuron Methyl |
| Sulfotep | Sulfotepp |
| Sulfoxaflor | Sulfoxaflor |
| Sulfoxaflor-A | Sulfoxaflor Peak A |
| Sulfoxaflor-B | Sulfoxaflor Peak B |
| Sulfur | Sulfur |
| Sulfur-34 | Sulfur-34 |
| Sum of 12 HPAHs (SFEI) | Sum of 12 HPAHs (SFEI) |
| Sum of 13 LPAHs (SFEI) | Sum of 13 LPAHs (SFEI) |
| Sum of 208 PCBs (SFEI) | Sum of 208 PCBs (SFEI) |
| Sum of 209 PCBs (SFEI) | Sum of 209 PCBs (SFEI) |
| Sum of 25 PAHs (SFEI) | Sum of 25 PAHs (SFEI) |
| Sum of 40 PCBs (SFEI) | Sum of 40 PCBs (SFEI) |
| Sum of Aroclors (SFEI) | Sum of Aroclors (SFEI) |
| Sum of Chlordanes (SFEI) | Sum of Chlordanes (SFEI) |
| Sum of Cyclopentadienes (SFEI) | Sum of Cyclopentadienes (SFEI) |
| Sum of DDTs (RWQCB3) | Sum of DDTs (RWQCB3) |
| Sum of DDTs (SFEI) | Sum of DDTs (SFEI) |
| Sum of Dioxin-Furan TEQs (WHO 2005;ND=0 SFEI) | Sum of Dioxin-Furan TEQs (WHO 2005;ND=0 SFEI) |
| Sum of Dioxin-Furan TEQs (WHO 2005;ND=MDL SFEI) | Sum of Dioxin-Furan TEQs (WHO 2005;ND=MDL SFEI) |
| Sum of Dioxins (SFEI) | Sum of Dioxins (SFEI) |
| Sum of Dioxins-Furans (SFEI) | Sum of Dioxins-Furans (SFEI) |
| Sum of Furans (SFEI) | Sum of Furans (SFEI) |
| Sum of HCHs (SFEI) | Sum of HCHs (SFEI) |
| Sum of Hexa-PBDE | Sum of Hexa-PBDE |
| Sum of Hexa-PBDEs (SFEI) | Sum of Hexa-PBDEs (SFEI) |
| Sum of HPAHs (Integral) | Sum of HPAHs (Integral) |
| Sum of HPAHs (OCEAN) | Sum of HPAHs (OCEAN) |
| Sum of LPAHs (Integral) | Sum of LPAHs (Integral) |
| Sum of LPAHs (OCEAN) | Sum of LPAHs (OCEAN) |
| Sum of PAHs (OCEAN) | Sum of PAHs (OCEAN) |
| Sum of PBDEs (SFEI) | Sum of PBDEs (SFEI) |
| Sum of PCBs (NOAA) | Sum of PCBs (NOAA) |
| Sum of PCBs (SFEI) | Sum of PCBs (SFEI) |
| Sum of Penta-PBDEs (SFEI) | Sum of Penta-PBDEs (SFEI) |
| Sum of PFCs (SFEI) | Sum of PFCs (SFEI) |
| Sum of Pyrethroids (SFEI) | Sum of Pyrethroids (SFEI) |
| Sum of SEM | Sum of SEM |
| Sum of Tetra-PBDEs (SFEI) | Sum of Tetra-PBDEs (SFEI) |
| Sum of Tri-PBDEs (SFEI) | Sum of Tri-PBDEs (SFEI) |
| Surface Films | Surface Films |
| SurfaceAreaOfMax | Estimate of the current surface area size as a fraction of the total surface area the waterbody would have at high water stage |
| SurfacewaterConnect | Discharge from an outfall that does or does not flow to and have hydrologic continuity with a surface receiving water and has or does not have the potential to contribute to the quality of the surface receiving water quality |
| Survival | Survival (%) |
| Suspended Sediment Concentration | Suspended Sediment Concentration (SSC) |
| Suspended Sediment Discharge | Suspended Sediment Discharge |
| Swim Normally | Swim Normally (Num/Rep) |
| Syringe/Pipette | Syringe/Pipette |
| Tampon/Applicator | Tampon/Applicator |
| Tantalum | Tantalum |
| Tape | Tape |
| Taricha torosa (CalN) | Taricha torosa, Assay name: CalN, 5’ ACTGTTGCTCTGACAGTTATT 3’, 5’ TCCCTTCTGTGAACTCATAATC 3’, 5FAM-AAGATGGAACAGCCAATGCAGGGT-3IABkFQ |
| Tarp | Tarp |
| TCDD, 2,3,7,8- | 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) |
| TCDD, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) |
| TCDD-13C12, 2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-13C12 (TCDD-13C12) |
| TCDD-13C6, 1,2,3,4-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4-TCDD-13C6 |
| TCDD-13C6, 1,2,3,4-(Surrogate) | Surrogate: 1,2,3,4-Tetrachlorodibenzo-p-dioxin-13C6 (TCDD) |
| TCDD-13C6,1,2,3,4-(Surrogate) | Surrogate: 1,2,3,4-Tetrachlorodibenzo-p-dioxin-13C6 (TCDD) |
| TCDD-37Cl4, 2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-37Cl4 (TCDD-37Cl4) |
| TCDF, 2,3,7,8- | 2,3,7,8-Tetrachlorodibenzofuran (TCDF) |
| TCDF, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzofuran (TCDF) |
| TCDF-13C12, 2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzofuran-13C12 (TCDF-13C12) |
| TCDF-2C, 2,3,7,8- | 2,3,7,8-TCDF-2C |
| TCDF-2C, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzofuran-2C (TCDF) |
| TCDF-C13, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzofuran-C13 (TCDF) |
| Tebuconazole | Tebuconazole (Folicur) |
| Tebuconazole-13C3(Surrogate) | Surrogate: Tebuconazole-13C3 |
| Tebuconazole-tert-Butylhydroxy | Tebuconazole-tert-Butylhydroxy |
| Tebufenozide | Tebufenozide |
| Tebupirimfos | Tebupirimfos |
| Tebupirimfos oxon | Tebupirimfos oxon |
| Tebuthiuron | Tebuthiuron |
| Tebuthiuron(Surrogate) | Surrogate: Tebuthiuron |
| Tecnazene | Tecnazene |
| Tedion | Tedion (Tetradifon) |
| Tefluthrin | Tefluthrin |
| Television | Television |
| Temephos | Temephos |
| Temperature | Temperature |
| Temperature, Daily Mean | Daily Mean Temperature (Calculated) |
| Terbacil | Terbacil |
| Terbium | Terbium |
| Terbium(Surrogate) | Surrogate: Terbium |
| Terbufos | Terbufos |
| Terbufos oxon sulfone | Terbufos oxon sulfone |
| Terbufos Sulfone | Terbufos Sulfone |
| Terbuthylazine | Terbuthylazine |
| Terbutryn | Terbutryn |
| Terphenyl-d14 | Terphenyl-d14 |
| Terphenyl-d14(Surrogate) | Surrogate: Terphenyl-d14 |
| Terpineol, alpha- | alpha-Terpineol |
| Terrazole | Terrazole (Etridiazole) |
| Tert-amyl Methyl Ether | Tert-amyl Methyl Ether |
| Tert-butyl Alcohol | Tert-butyl Alcohol |
| Tertbutylphenyl Diphenyl Phosphate | Tertbutylphenyl Diphenyl Phosphate |
| Testosterone | Testosterone |
| Testosterone-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Testosterone-d3 |
| Testosterone-d3(Surrogate) | Surrogate: Testosterone-d3 |
| Tetrabromobisphenyl A | Tetrabromobisphenyl A |
| Tetrabromocyclooctane, alpha-1,2,5,6- | alpha-1,2,5,6-Tetrabromocyclooctane (alpha-TBCO) |
| Tetrabromocyclooctane, beta-1,2,5,6- | beta-1,2,5,6-Tetrabromocyclooctane (beta-TBCO) |
| Tetrabromo-o-chlorotoluene | Tetrabromo-o-chlorotoluene (TBCT) |
| Tetrabromo-p-xylene | Tetrabromo-p-xylene (pTBX) |
| Tetrabutyltin as Sn | Tetrabutyltin as Sn |
| Tetrachlorobenzene, 1,2,3,4- | 1,2,3,4-Tetrachlorobenzene |
| Tetrachlorobenzene, 1,2,3,4-(Surrogate) | Surrogate: 1,2,3,4-Tetrachlorobenzene |
| Tetrachlorobenzene, 1,2,3,5/1,2,4,5- | 1,2,3,5-Tetrachlorobenzene/1,2,4,5-Tetrachlorobenzene |
| Tetrachlorobenzene, 1,2,4,5- | 1,2,4,5-Tetrachlorobenzene |
| Tetrachlorobenzene-13C6,1,2,3,4-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4-Tetrachlorobenzene-13C6 |
| Tetrachloroethane, 1,1,1,2- | 1,1,1,2-Tetrachloroethane |
| Tetrachloroethane, 1,1,2,2- | 1,1,2,2-Tetrachloroethane |
| Tetrachloroethylene | Tetrachloroethylene, Tetrachloroethene |
| Tetrachloro-m-xylene | Tetrachlorometaxylene (TCMX) |
| Tetrachloro-m-xylene(Surrogate) | Surrogate: Tetrachloro-m-xylene (TCMX) |
| Tetrachlorophenol | Tetrachlorophenol |
| Tetrachlorophenol, 2,3,4,5- | 2,3,4,5-Tetrachlorophenol |
| Tetrachlorophenol, 2,3,4,6- | 2,3,4,6-Tetrachlorophenol |
| Tetrachlorophenol, 2,3,5,6- | 2,3,5,6-Tetrachlorophenol |
| Tetrachlorophenyl-hexachloro-norbornene | Tetrachlorophenyl-hexachloro-norbornene (Cl4-DEC604) |
| Tetrachloroterephthalic acid | Tetrachloroterephthalic acid |
| Tetrachlorvinphos | Tetrachlorvinphos (Stirofos) |
| Tetraconazole | Tetraconazole (1-[2-(2,4-Dichlorophenyl)-3-(1,1,2,2-tetrafluoroethoxy)propyl]- 1H-1,2,4-triazole) |
| Tetracosane, n- | n-Tetracosane |
| Tetracosane, n-(Surrogate) | Surrogate: n-Tetracosane |
| Tetracycline | Tetracycline |
| Tetradecane, 2-phenyl- | 2-Phenyl-tetradecane |
| Tetradecane, 3-phenyl- | 3-Phenyl-tetradecane |
| Tetradecane, 4-phenyl- | 4-Phenyl-tetradecane |
| Tetradecane, 5-phenyl- | 5-Phenyl-tetradecane |
| Tetradecane, 6-phenyl- | 6-Phenyl-tetradecane |
| Tetradecane, 7-phenyl- | 7-Phenyl-tetradecane |
| Tetradecane, n- | n-Tetradecane |
| Tetradifon | Tetradifon |
| Tetraethyl Pyrophosphate | Tetraethyl Pyrophosphate (TEPP) |
| Tetraethyl pyrophosphate, TEPP | Tetraethyl pyrophosphate, TEPP |
| Tetrafluoro-2-[(1,1,1,2,3,3,4,4-Octafluorobutan-2-yl)oxy]Ethane-1-Sulfonic Acid, 1,1,2,2- | 1,1,2,2-Tetrafluoro-2-[(1,1,1,2,3,3,4,4-Octafluorobutan-2-yl)oxy]Ethane-1-Sulfonic Acid (R-PSDCA) (Nafion Byproduct 6) |
| Tetramethrin | Tetramethrin |
| Tetramethylnaphthalene, 1,4,6,7- | 1,4,6,7-Tetramethylnaphthalene |
| Tetratriacontane, n- | n-Tetratriacontane |
| Tetryl | Tetryl |
| T-Fluvalinate | T-Fluvalinate |
| Thallium | Thallium |
| Thanite | Thanite |
| Theobromine | Theobromine |
| Theophylline | Theophylline |
| Theophylline-13C1-15N2(Surrogate) | Surrogate: Theophylline-13C1-15N2 |
| Thiabendazole | Thiabendazole |
| Thiabendazole, hypophosphite salt | Thiabendazole, hypophosphite salt |
| Thiabendazole-d6(Surrogate) | Surrogate: Thiabendazole-d6 |
| Thiacloprid | Thiacloprid |
| Thiacloprid-13C6(Surrogate) | Surrogate: Thiacloprid-13C6 |
| Thiacloprid-amide | Thiacloprid-amide |
| Thiamethoxam | Thiamethoxam |
| Thiamethoxam Degradate (CGA-355190) | Thiamethoxam Degradate (CGA-355190) |
| Thiamethoxam Degradate (NOA-407475) | Thiamethoxam Degradate (NOA-407475) |
| Thiamethoxam-d3(Surrogate) | Surrogate: Thiamethoxam-d3 |
| Thiamethoxam-d4(Surrogate) | Surrogate: Thiamethoxam-d4 |
| Thiamethoxan | Thiamethoxan |
| Thiazopyr | Thiazopyr |
| Thidiazuron | Thidiazuron |
| Thiobencarb | Thiobencarb (Benthiocarb) (Bolero) |
| Thiobencarb sulfoxide | Thiobencarb sulfoxide |
| Thiobencarb(Surrogate) | Surrogate: Thiobencarb (Benthiocarb) (Bolero) |
| Thiodicarb | Thiodicarb |
| Thiofanox | Thiofanox |
| Thionazin | Thionazin (Thionzin) |
| Thiophanate | Thiophanate |
| Thiophanate-Methyl | Thiophanate-Methyl |
| Thiram | Thiram |
| Thorium | Thorium |
| Tidal Height | Tidal Height |
| Tidal State | Tidal State |
| TidalDirection | TidalDirection |
| Timber Harvest Extent | Timber Harvest Extent |
| Timber Harvest Intensity | Timber Harvest Intensity |
| Timber Harvest Proximity | Timber Harvest Proximity |
| Time | Time |
| Time to maturity | Time to maturity (days) |
| Time, Fishing | Time spent fishing within a given waterbody |
| Time, Shock | Time spent electroshocking within a given waterbody |
| TimeToSpinTest | Time the velocity meter spins during QA/QC calibration checks |
| TimeZone | Time Zone time was recorded in |
| Tin | Tin |
| Tire | Tire |
| Titanium | Titanium |
| Tokuthion | Tokuthion (Prothiofos) |
| Tolfenpyrad | Tolfenpyrad |
| Toluene | Toluene |
| Toluene-d8(Surrogate) | Surrogate: Toluene-d8 |
| Tonalide | Tonalide |
| Toothbrush | Toothbrush |
| Torrent 01 | Torrent 01 - Recently devegetated corridor two or more times the width of the low flow channel |
| Torrent 02 | Torrent 02 - Substrate cobbles or large gravel particles are not imbricated |
| Torrent 03 | Torrent 03 - Channel has little evidence of pool-riffle structure |
| Torrent 04 | Torrent 04 - Stream channel is scoured down to bedrock |
| Torrent 05 | Torrent 05 - Gravel and cobble berms above bankfull level |
| Torrent 06 | Torrent 06 - Massive deposits downstream of reach |
| Torrent 07 | Torrent 07 - Riparian trees have fresh bark scars |
| Torrent 08 | Torrent 08 - Riparian trees have fallen into channel as a result of scouring near their roots |
| Torrent 09 | Torrent 09 - Massive deposits of sediment, logs and debris within reach |
| Torrent 10 | Torrent 10 - Newly erroded deposites show evidence that the deposites are matrix supported |
| Torrent 11 | Torrent 11 - No evidence of torrent scouring or torrent deposits |
| Total Alkanes | Total Alkanes |
| Total Anions | Total Anions |
| Total Cations | Total Cations |
| Total Cell Count | Total Cell Count |
| Total Chlordanes | Total Chlordanes |
| Total DDDs | Total DDDs |
| Total DDEs | Total DDEs |
| Total DDTs | Total DDTs |
| Total DDTs - Lipid Basis | Total DDTs - Lipid Basis |
| Total DDTs(Surrogate) | Surrogate: Total DDTs |
| Total Debris, >2.5 cm | Total Debris >2.5 cm |
| Total Debris, 2.5 cm - 5 mm | Total Debris 2.5 cm - 5 mm |
| Total Dichlorobiphenyls | Total Dichlorobiphenyls |
| Total Di-ester Organophosphate Flame Retardants | Total Di-ester Organophosphate Flame Retardants |
| Total Di-PCB | Total Di-PCB |
| Total Dissolved Solids | Total Dissolved Solids |
| Total Endosulfans | Total Endosulfans |
| Total Endosulfans - Lipid Basis | Total Endosulfans - Lipid Basis |
| Total HCHs | Total HCHs |
| Total Heptachlorobiphenyls | Total Heptachlorobiphenyls |
| Total Hepta-Dioxins | Total Hepta-Dioxins |
| Total Hepta-Furans | Total Hepta-Furans |
| Total Hepta-PCB | Total Hepta-PCB |
| Total Hexachlorobiphenyls | Total Hexachlorobiphenyls |
| Total Hexa-Dioxins | Total Hexa-Dioxins |
| Total Hexa-Furans | Total Hexa-Furans |
| Total Hexa-PCB | Total Hexa-PCB |
| Total Hydrogen | Total Hydrogen |
| Total Inorganic Carbon | Total Inorganic Carbon (TIC) |
| Total MirexHCBChlorpy (SFEI) | Total MirexHCBChlorpy (SFEI) |
| Total Monochlorobiphenyls | Total Monochlorobiphenyls |
| Total Mono-PCB | Total Mono-PCB |
| Total Nonachlorobiphenyls | Total Nonachlorobiphenyls |
| Total Nonachlors | Total Nonachlors |
| Total Nona-PCB | Total Nona-PCB |
| Total Normal | Total Normal |
| Total Octachlorobiphenyls | Total Octachlorobiphenyls |
| Total Octa-PCB | Total Octa-PCB |
| Total Organic Carbon | Total Organic Carbon (TOC) |
| Total Organic Matter | Includes all the elements (hydrogen, oxygen, nitrogen, etc) that are components of organic compounds, not just carbon. |
| Total PAHs | Total PAHs |
| Total PAHs - Lipid Basis | Total PAHs - Lipid Basis |
| Total PBDEs | Total PBDEs |
| Total PCBs | Total PCBs |
| Total PCBs (Aroclors) | Total PCBs (Aroclors) |
| Total PCBs (Aroclors) - Lipid Basis | Total PCBs (Aroclors) - Lipid Basis |
| Total Pentachlorobiphenyls | Total Pentachlorobiphenyls |
| Total Penta-Dioxins | Total Penta-Dioxins |
| Total Penta-Furans | Total Penta-Furans |
| Total Penta-PBDE | Total Penta-PBDE |
| Total Penta-PCB | Total Penta-PCB |
| Total Pyrethrins | Total Pyrethrins |
| Total Solids | Total Solids |
| Total Suspended Solids | Total Suspended Solids |
| Total Suspended Solids and Salts | Total Suspended Solids and Dissolved Salts |
| Total TEQ (WHO 2005; ND=0) | Total TEQ (WHO 2005; ND=0) |
| Total TEQ (WHO 2005; ND=1/2DL) | Total TEQ (WHO 2005; ND=1/2DL) |
| Total Terphenyls | Total Terphenyls |
| Total Tetrachlorobiphenyls | Total Tetrachlorobiphenyls |
| Total Tetra-Dioxins | Total Tetra-Dioxins |
| Total Tetra-Furans | Total Tetra-Furans |
| Total Tetra-PBDE | Total Tetra-PBDE |
| Total Tetra-PCB | Total Tetra-PCB |
| Total Trichlorobiphenyls | Total Trichlorobiphenyls |
| Total Tri-ester Organophosphate Flame Retardants | Total Tri-ester Organophosphate Flame Retardants |
| Total Tri-PBDE | Total Tri-PBDE |
| Total Tri-PCB | Total Tri-PCB |
| TotalPieces | Total Pieces of Trash using Trash Protocol |
| Tox_Amphipod | Sediment Quality Objectives Line of Evidence (SQO LOE) short-term amphipod survival toxicity test result. The result represents the response of amphipods to bay/estuary sediment samples collected at a station but exposed in a controlled laboratory. |
| Tox_Mussel | Sediment Quality Objectives Line of Evidence (SQO LOE) sublethal mussel toxicity test result. The result represents the response of mussel embryos to bay/estuary sediment samples collected at a station but exposed in a controlled laboratory. |
| Tox_Polychaete | Sediment Quality Objectives Line of Evidence (SQO LOE) polychaete growth in sediment toxicity test result. The result represents the response of worms exposed to bay/estuary sediment samples collected at a station under controlled laboratory conditions. |
| Toxaphene | Toxaphene |
| Toxic | Toxic using Trash Protocol |
| Toxic, Other | Toxic, Other |
| Toy | Toy |
| TPH as Diesel C10-C22 | TPH as Diesel C10-C22 |
| TPH as Diesel C10-C23 | TPH as Diesel C10-C23 |
| TPH as Diesel C10-C24 | TPH as Diesel C10-C24 |
| TPH as Diesel C10-C25 | TPH as Diesel C10-C25 |
| TPH as Diesel C10-C28 | TPH as Diesel C10-C28 |
| TPH as Diesel C11-C12 | TPH as Diesel C11-C12 |
| TPH as Diesel C11-C25 | TPH as Diesel C11-C25 |
| TPH as Diesel C11-C28 | TPH as Diesel C11-C28 |
| TPH as Diesel C12-C24 | TPH as Diesel C12-C24 |
| TPH as Diesel C12-C25 | TPH as Diesel C12-C25 |
| TPH as Diesel C13-C14 | TPH as Diesel C13-C14 |
| TPH as Diesel C13-C22 | TPH as Diesel C13-C22 |
| TPH as Diesel C13-C28 | TPH as Diesel C13-C28 |
| TPH as Diesel C15-C16 | TPH as Diesel C15-C16 |
| TPH as Diesel C17-C18 | TPH as Diesel C17-C18 |
| TPH as Diesel C19-C20 | TPH as Diesel C19-C20 |
| TPH as Diesel C21-C22 | TPH as Diesel C21-C22 |
| TPH as Diesel C23-C24 | TPH as Diesel C23-C24 |
| TPH as Diesel C23-C40 | TPH as Diesel C23-C40 |
| TPH as Diesel C25-C28 | TPH as Diesel C25-C28 |
| TPH as Diesel C29-C40 | TPH as Diesel C29-C40 |
| TPH as Diesel C8-C21 | TPH as Diesel C8-C21 |
| TPH as Gasoline C11-C12 | TPH as Gasoline C11-C12 |
| TPH as Gasoline C3-C13 | TPH as Gasoline C3-C13 |
| TPH as Gasoline C4-C12 | TPH as Gasoline C4-C12 |
| TPH as Gasoline C4-C13 | TPH as Gasoline C4-C13 |
| TPH as Gasoline C4-C5 | TPH as Gasoline C4-C5 |
| TPH as Gasoline C5-C12 | TPH as Gasoline C5-C12 |
| TPH as Gasoline C6 | TPH as Gasoline C6 |
| TPH as Gasoline C6-C10 | TPH as Gasoline C6-C10 |
| TPH as Gasoline C6-C12 | TPH as Gasoline C6-C12 |
| TPH as Gasoline C6-C8 | TPH as Gasoline C6-C8 |
| TPH as Gasoline C7 | TPH as Gasoline C7 |
| TPH as Gasoline C7-C9 | TPH as Gasoline C7-C9 |
| TPH as Gasoline C8 | TPH as Gasoline C8 |
| TPH as Gasoline C8-C10 | TPH as Gasoline C8-C10 |
| TPH as Gasoline C9-C10 | TPH as Gasoline C9-C10 |
| TPH as Heavy Fuel C28-C40 | TPH as Heavy Fuel C28-C40 |
| TPH as Heavy Fuel Oils C22-C36 | TPH as Heavy Fuel Oils C22-C36 |
| TPH as JP4 C4-C14 | TPH as JP-4 C4-C14 (Jet Fuel 4) |
| TPH as JP8 C7-C18 | TPH as JP8 C7-C18 (Jet Fuel 8) |
| TPH as Motor Oil / Diesel C13-C44 | TPH as Motor Oil / Diesel C13-C44 |
| TPH as Motor Oil C14-C44 | TPH as Motor Oil C14-C44 |
| TPH as Motor Oil C17-C44 | TPH as Motor Oil C17-C44 |
| TPH as Motor Oil C18-C26 | TPH as Motor Oil C18-C26 |
| TPH as Motor Oil C18-C36 | TPH as Motor Oil C18-C36 |
| TPH as Motor Oil C18-C40 | TPH as Motor Oil C18-C40 |
| TPH as Motor Oil C21-C32 | TPH as Motor Oil C21-C32 |
| TPH as Motor Oil C22-C36 | TPH as Motor Oil C22-C36 |
| TPH as Motor Oil C23-C36 | TPH as Motor Oil C23-C36 |
| TPH as Motor Oil C23-C40 | TPH as Motor Oil C23-C40 |
| TPH as Motor Oil C23-C44 | TPH as Motor Oil C23-C44 |
| TPH as Motor Oil C24-C36 | TPH as Motor Oil C24-C36 |
| TPH as Motor Oil C24-C40 | TPH as Motor Oil C24-C40 |
| TPH as Motor Oil C25-C36 | TPH as Motor Oil C25-C36 |
| TPH as Motor Oil C28-C44 | TPH as Motor Oil C28-C44 |
| TPH as Motor Oil C29-C40 | TPH as Motor Oil C29-C40 |
| TPH as Oil C29-C44 | TPH as Oil C29-C44 |
| TPH as Residual C25-C36 | TPH as Residual C25-C36 |
| TPH as Residual C29-C32 | TPH as Residual C29-C32 |
| TPH as Residual C33-C36 | TPH as Residual C33-C36 |
| TPH as Residual C37-C40 | TPH as Residual C37-C40 |
| TPH as Residual C41-C44 | TPH as Residual C41-C44 |
| TPH as Residual C6-C44 | TPH as Residual C6-C44 |
| Tralomethrin | Tralomethrin |
| TransectsSampled | Number of transects sampled to attain sample material |
| Transfluthrin | Transfluthrin |
| Transmittance | Transmittance |
| Transparency | Transparency |
| Transportation Other Extent | Transportation Other Extent |
| Transportation Other Intensity | Transportation Other Intensity |
| Transportation Other Proximity | Transportation Other Proximity |
| Trash at >96" Drain | Trash at >96" Drain |
| Trash at 12" Drain | Trash at 12" Drain |
| Trash at 18" Drain | Trash at 18" Drain |
| Trash at 24" Drain | Trash at 24" Drain |
| Trash at 30" Drain | Trash at 30" Drain |
| Trash at 36" Drain | Trash at 36" Drain |
| Trash at 48" Drain | Trash at 48" Drain |
| Trash at 60" Drain | Trash at 60" Drain |
| Trash, Litter | Trash, Litter |
| Trash/Dumping Extent | Trash/Dumping Extent |
| Trash/Dumping Intensity | Trash/Dumping Intensity |
| Trash/Dumping Proximity | Trash/Dumping Proximity |
| TrashAssessment | RWQCB Trash Assessment |
| Tree_Diameter | Diameter at breast height of the largest potential legacy tree visible from the location |
| Tree_Distance | Distance from the wetted edge to the largest potential legacy tree visible from the location |
| Tree_Height | Height of the largest potential legacy tree visible from the location |
| Tree_TaxonomicCategoryCode | Taxonomic Category Code of the largest potential legacy tree visible from the location |
| Trenbolone | Trenbolone |
| Trenbolone Acetate | Trenbolone Acetate |
| Triacontane, n- | n-Triacontane |
| Triacontane, n-(Surrogate) | Surrogate: n-Triacontane |
| Triadimefon | Triadimefon |
| Triadimenol | Triadimenol |
| Triaholomethanes, Total | Total Triaholomethanes |
| Triallate | Triallate |
| Triamterene | Triamterene |
| Triasulfuron | Triasulfuron |
| Tribromobenzene, 1,3,5- | 1,3,5-Tribromobenzene (TBBZ) |
| Tribromophenol, 2,4,6- | 2,4,6-Tribromophenol |
| Tribromophenol, 2,4,6-(Surrogate) | Surrogate: 2,4,6-Tribromophenol |
| Tributyl Phosphate-d27(IsoDilAnalogue) | Isotope Dilution Analogue: Tributyl Phosphate-d27 (TBP-d27) |
| Tributyl Phosphorotrithioate, S,S,S- | S,S,S-Tributyl Phosphorotrithioate (Def) (Butifos) (Merphos) |
| Tributylphosphate | Tributylphosphate (TBP) |
| Tributylphosphate(Surrogate) | Surrogate: Tributylphosphate (Butyl Phosphate) |
| Tributyltin as Sn | Tributyltin as Sn (TBT) |
| Tributyltin as Sn-d27(Surrogate) | Surrogate: Tributyltin as Sn-d27 |
| Trichlorfon | Trichlorfon |
| Trichloro-1,2,2-trifluoroethane, 1,1,2- | 1,1,2-Trichloro-1,2,2-trifluoroethane |
| Trichloroacetic Acid | Trichloroacetic Acid (TCAA) |
| Trichlorobenzene, 1,2,3- | 1,2,3-Trichlorobenzene |
| Trichlorobenzene, 1,2,3-(Surrogate) | Surrogate: 1,2,3-Trichlorobenzene |
| Trichlorobenzene, 1,2,4- | 1,2,4-Trichlorobenzene |
| Trichlorobenzene, 1,2,4-(Surrogate) | Surrogate: 1,2,4-Trichlorobenzene |
| Trichlorobenzene, 1,3,5- | 1,3,5-Trichlorobenzene |
| Trichlorobenzene-13C6, 1,2,3-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3-Trichlorobenzene-13C6 |
| Trichloroethane, 1,1,1- | 1,1,1-Trichloroethane |
| Trichloroethane, 1,1,2- | 1,1,2-Trichloroethane |
| Trichloroethylene | Trichloroethylene (Trichloroethene) |
| Trichlorofluoromethane | Trichlorofluoromethane |
| Trichloronate | Trichloronate |
| Trichlorophenol, 2,3,6- | 2,3,6-Trichlorophenol |
| Trichlorophenol, 2,4,5- | 2,4,5-Trichlorophenol |
| Trichlorophenol, 2,4,5-(Surrogate) | Surrogate: 2,4,5-Trichlorophenol |
| Trichlorophenol, 2,4,6- | 2,4,6-Trichlorophenol |
| Trichlorophenol, 2,4,6-(Surrogate) | Surrogate: 2,4,6-Trichlorophenol |
| Trichlorophenoxy)propionic Acid, 2-(2,4,5- | 2-(2,4,5-Trichlorophenoxy)propionic Acid (2,4,5-TP) (Silvex) (Fenoprop) |
| Trichlorophenoxy)propionic Acid, 2-(2,4,5-(Surrogate) | Surrogate: 2-(2,4,5-trichlorophenoxy)propionic Acid (2,4,5-TP) (Silvex) (Fenoprop) |
| Trichlorophenoxyacetic Acid, 2,4,5- | 2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T) |
| Trichlorophenoxyacetic Acid, 2,4,5-(Surrogate) | Surrogate: 2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T) |
| Trichloropropane, 1,2,3- | 1,2,3-Tricloropropane |
| Triclocarban | Triclocarban |
| Triclocarban-13C6(Surrogate) | Surrogate: Triclocarban-13C6 |
| Triclopyr | Triclopyr |
| Triclopyr, butoxyethyl ester | Triclopyr, butoxyethyl ester |
| Triclosan | Triclosan |
| Triclosan-13C12(Surrogate) | Surrogate: Triclosan-13C12 |
| Triclosan-13C6(Surrogate) | Surrogate: Triclosan-13C6 |
| Triclosan-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Triclosan-d3 |
| Triclosan-d3(Surrogate) | Surrogate: Triclosan-d3 |
| Tricosane, n- | n-Tricosane |
| Tricresyl Phosphate | Tricresyl Phosphate (TCrP) |
| Tricyclazole | Tricyclazole (5-methyl-1,2,4-triazolo[3,4-b]benzothiazole) |
| Tridecane, 2-phenyl- | 2-Phenyl-tridecane |
| Tridecane, 3-phenyl- | 3-Phenyl-tridecane |
| Tridecane, 4-phenyl- | 4-Phenyl-tridecane |
| Tridecane, 5-phenyl- | 5-Phenyl-tridecane |
| Tridecane, 6/7-phenyl- | 6-Phenyltridecane/7-Phenyltridecane |
| Tridecane, n- | n-Tetratriacontane |
| Tridimephon | Triadimefon |
| Triethyl citrate | Triethyl citrate (ethyl citrate) |
| Triethyl Phosphate | Triethyl Phosphate (TEP) |
| Triethyl Phosphate-d15(IsoDilAnalogue) | Isotope Dilution Analogue: Triethyl Phosphate-d15 (TEP-d15) |
| Trifloxystrobin | Trifloxystrobin |
| Triflumizole | Triflumizole |
| Trifluorotolunene, a,a,a-(Surrogate) | Surrogate: a,a,a-Trifluorotoluene |
| Trifluralin | Trifluralin |
| Trifluralin-d14(Surrogate) | Surrogate: Trifluralin-d14 |
| Triforine | Triforine |
| Trihalomethanes, Total | Total Trihalomethanes |
| Triisobutyl Phosphate | Triisobutyl Phosphate (TIBP) |
| Trimethoprim | Trimethoprim |
| Trimethoprim-13C3(Surrogate) | Surrogate: Trimethoprim-13C3 |
| Trimethylbenzene, 1,2,4- | 1,2,4-Trimethylbenzene |
| Trimethylbenzene, 1,3,5- | 1,3,5-Trimethylbenzene |
| Trimethylnaphthalene, 1,6,7- | 1,6,7-Trimethylnaphthalene |
| Trimethylnaphthalene, 2,3,5- | 2,3,5-Trimethylnaphthalene |
| Trimethylnaphthalene, 2,3,6- | 2,3,6-Trimethylnaphthalene |
| Trimethylphenanthrene, 1,2,6- | 1,2,6-Trimethylphenanthrene |
| Trimethylphenol, 2,4,6-(Surrogate) | Surrogate: 2,4,6-Trimethylphenol |
| Trinitrophenylnitramine, Methyl-2,4,6- | Methyl-2,4,6-trinitrophenylnitramine (Tetryl) |
| Trinitrotoluene, 2,4,6- | 2,4,6-Trinitrotoluene (TNT) |
| Tripentyl Phosphate | Tripentyl Phosphate (TPeP) |
| Tripentyltin(Surrogate) | Surrogate: Tripentyltin |
| Triphenyl Phosphate | Triphenyl Phosphate |
| Triphenyl Phosphate(Surrogate) | Surrogate: Triphenyl Phosphate |
| Triphenyl Phosphate-13C18(IsoDilAnalogue) | Isotope Dilution Analogue: Triphenyl Phosphate-13C18 (TPhP-13C18) (TPP-13C18) |
| Triphenylene | Triphenylene |
| Tripropyl Phosphate | Tripropyl Phosphate (TPrP) |
| Tripropyl Phosphate-d21(IsoDilAnalogue) | Isotope Dilution Analogue: Tripropyl Phosphate-d21 (TPrP-d21) |
| Tripropyltin as Sn-d27(Surrogate) | Surrogate: Tripropyltin as Sn-d27 |
| Tripropyltin(Surrogate) | Surrogate: Tripropyltin |
| Tris(1,1-dimethylethyl)phenol, 2,4,6- | 2,4,6-Tris(1,1-dimethylethyl)phenol |
| Tris(1,3-dichloroisopropyl)phosphate | Tris(1,3-dichloroisopropyl)phosphate (TDCPP) |
| Tris(1,3-Dichloroisopropyl)Phosphate-d15(IsoDilAnalogue) | Isotope Dilution Analogue: Tris(1,3-Dichloroisopropyl)Phosphate-d15 (TDCPP-d15) |
| Tris(1,3-dichloropropyl)phosphate | Tris(1,3-dichloropropyl)phosphate |
| Tris(1-Chloro-2-Propyl) Phosphate-d18(IsoDilAnalogue) | Isotope Dilution Analogue: Tris(1-Chloro-2-Propyl) Phosphate-d18 (TCPP-d18) |
| Tris(1-chloro-2-propyl)phosphate | Tris(1-chloro-2-propyl)phosphate (TCPP, multiple isomers) |
| Tris(2,3-dibromopropyl) phosphate | Tris(2,3-dibromopropyl) phosphate (TDBPP) |
| Tris(2,3-Dibromopropyl) Phosphate-d15(IsoDilAnalogue) | Isotope Dilution Analogue: Tris(2,3-Dibromopropyl) Phosphate-d15 (TDBPP-d15) |
| Tris(2-bromo-4-methylphenyl) phosphate | Tris(2-bromo-4-methylphenyl) phosphate (TBMPP) |
| Tris(2-Butoxyethyl) Phosphate-d27(IsoDilAnalogue) | Isotope Dilution Analogue: Tris(2-Butoxyethyl) Phosphate-d27 (TBEP-d27) |
| Tris(2-butoxyethyl)phosphate | Tris(2-butoxyethyl)phosphate (TBEP) |
| Tris(2-Chloroethyl) Phosphate-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Tris(2-Chloroethyl) Phosphate-d12 (TCEP-d12) |
| Tris(2-chloroethyl)phosphate | Tris(2-chloroethyl)phosphate (TCEP) |
| Tris(2-ethylhexyl) phosphate | Tris(2-ethylhexyl) phosphate (TEHP) |
| Tris(2-Ethylhexyl) Phosphate-d51(IsoDilAnalogue) | Isotope Dilution Analogue: Tris(2-Ethylhexyl) Phosphate-d51 (TEHP-d51) |
| Tris(2-isopropylphenyl)phosphate | Tris(2-isopropylphenyl)phosphate (TiPPP) |
| Tris(3,5-dimethylphenyl)phosphate | Tris(3,5-dimethylphenyl)phosphate (T35DMPP) |
| Tris(3-Isopropylphenyl) Phosphate | Tris(3-Isopropylphenyl) Phosphate (T3IPPP) |
| Tris(4-Chlorophenyl)Methane | Tris(4-Chlorophenyl)Methane (TCPM, T4CPM) |
| Tris(4-Isopropylphenyl) Phosphate | Tris(3-Isopropylphenyl) Phosphate (T4IPPP) |
| Tris(4-tert-Butylphenyl) Phosphate | Tris(4-tert-Butylphenyl) Phosphate (T4tBPP) |
| Tris(tribromoneopentyl) Phosphate | Tris(tribromoneopentyl) Phosphate |
| Tris-Methane | Tris-Methane |
| Tris-Methanol | Tris-Methanol |
| Trithion, Methyl | Methyl Trithion |
| Triticonazole | Triticonazole |
| Tritium | Tritium |
| Tritium 2scu | Tritium 2-sigma Combined Uncertainty |
| Tritriacontane, n- | n-Tritriacontane |
| TrophicStatus | General classification of trophic status based on observed algae and herbaceous plant levels |
| TRPH | Total Recoverable Petroleum Hydrocarbons (TRPH) |
| Tungsten | Tungsten |
| Turbidity | Turbidity |
| Tylosin | Tylosin |
| Ultraviolet Absorption (254nm) | Ultraviolet Absorption (254nm) |
| Undecane, 2-phenyl- | 2-Phenyl-undecane |
| Undecane, 3-phenyl- | 3-Phenyl-undecane |
| Undecane, 4-phenyl- | 4-Phenyl-undecane |
| Undecane, 5-phenyl- | 5-Phenyl-undecane |
| Undecane, 6-phenyl- | 6-Phenyl-undecane |
| Undecane, n- | n-Undecane |
| Undercut Distance | Undercut Distance |
| Unknown Fiber | Fiber particle unable to be characterized by spectroscopy |
| Unknown Fiber Bundle | Fiber Bundle particle unable to be characterized by spectroscopy |
| Unknown Film | Film particle unable to be characterized by spectroscopy |
| Unknown Foam | Foam particle unable to be characterized by spectroscopy |
| Unknown Fragment | Fragment particle unable to be characterized by spectroscopy |
| Unknown Macro Foam | Foam of unknown origin, not analyzed in a lab |
| Unknown Potentially Rubber Foam | Foam particle not definitively but potentially characterized as rubber |
| Unknown Potentially Rubber Fragment | Fragment particle not definitively but potentially characterized as rubber |
| Unknown Sphere | Sphere particle unable to be characterized by spectroscopy |
| Unnatural Inflows Extent | Unnatural Inflows Extent |
| Unnatural Inflows Intensity | Unnatural Inflows Intensity |
| Unnatural Inflows Proximity | Unnatural Inflows Proximity |
| Unpaved Roads Extent | Unpaved Roads Extent |
| Unpaved Roads Intensity | Unpaved Roads Intensity |
| Unpaved Roads Proximity | Unpaved Roads Proximity |
| UplandSlope | Slope of bank or upland area |
| Uranium | Uranium |
| Urban Commercial Extent | Urban Commercial Extent |
| Urban Commercial Intensity | Urban Commercial Intensity |
| Urban Commercial Proximity | Urban Commercial Proximity |
| Urban Residential Extent | Urban Residential Extent |
| Urban Residential Intensity | Urban Residential Intensity |
| Urban Residential Proximity | Urban Residential Proximity |
| Urban Water Quality Other Extent | Urban Water Quality Other Extent |
| Urban Water Quality Other Intensity | Urban Water Quality Other Intensity |
| Urban Water Quality Other Proximity | Urban Water Quality Other Proximity |
| Urea | Urea |
| Utensil | Utensil |
| Valifenalate | Valifenalate |
| Valley Width | Valley Width |
| Valsartan | Valsartan |
| Vanadium | Vanadium |
| Vector Control Extent | Vector Control Extent |
| Vector Control Intensity | Vector Control Intensity |
| Vector Control Proximity | Vector Control Proximity |
| VectorControl_Bs | Vector Control through Bs (Bacillus sphaericus) within waterbody |
| VectorControl_Bti | Vector Control through Bti (Bacillus Thuringensis Israelensis) within waterbody |
| VectorControl_Methoprene | Vector Control through Methoprene within waterbody |
| VectorControl_Mosquitofish | Vector Control through Mosquitofish within waterbody |
| VectorControl_Oil | Vector Control through Oil within waterbody |
| Veg_Emergent | Percent cover of emergent vegetation within a given area |
| Veg_Open | Percent cover of open space within a given area |
| Veg_SubmergedAlgae | Percent cover of submerged algae within a given area |
| Veg_SubmergedOther | Percent cover of submerged other (non-algae) within a given area |
| Veg_SurfaceAlgae | Percent cover of surface algae within a given area |
| Veg_SurfaceOther | Percent cover of surface other (non-algae) within a given area |
| Vegetation Cover Bank | Percent of both bank surfaces upstream of sample location estimated to be covered by vegetation (plants & roots at water's edge) |
| Vegetation Cover Instream | Percent of stream's water surface upstream of sample location estimated to be covered by aquatic vegetation |
| Vegetation Cover Quality Metric | Metric assesses the quality of vegetation cover in the riparian and channel zones |
| Vegetation Cover Structure Metric | Metric assesses structural complexity of the riparian environment in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte. Grasses are excluded. |
| Velocity | Velocity |
| Venlafaxine | Venlafaxine |
| Verapamil | Verapamil |
| Vernolate | S-propyl N,N-dipropylcarbamothioate |
| Versalide | Versalide |
| Vinclozolin | Vinclozolin |
| Vineyards Extent | Vineyards Extent |
| Vineyards Intensity | Vineyards Intensity |
| Vineyards Proximity | Vineyards Proximity |
| Vinyl Acetate | Vinyl Acetate |
| Vinyl Chloride | Vinyl Chloride |
| Virginiamycin | Virginiamycin |
| Virginiamycin M1 | Virginiamycin M1 |
| Volume | Volume |
| W1_HALL_SWAMP | Riparian human disturbance index, all types, proximity-weighted sum |
| Wadeability | Wadeability |
| Walking Path Extent | Walking Path Extent |
| Walking Path Intensity | Walking Path Intensity |
| Walking Path Proximity | Walking Path Proximity |
| Warfarin | Warfarin |
| Warfarin-d5(Surrogate) | Surrogate: Warfarin-d5 |
| Waste, Food | Waste, Food |
| Waste, Pet | Waste, Pet |
| Waste, Yard | Waste, Yard |
| Water Control Actions Other Extent | Water Control Actions Other Extent |
| Water Control Actions Other Intensity | Water Control Actions Other Intensity |
| Water Control Actions Other Proximity | Water Control Actions Other Proximity |
| Water Control Features Other Extent | Water Control Features Other Extent |
| Water Control Features Other Intensity | Water Control Features Other Intensity |
| Water Control Features Other Proximity | Water Control Features Other Proximity |
| Water level below Reference Point | Distance from reference point to water surface |
| Water Level Fluctuations | Water Level Fluctuations |
| Water Withdrawal | Water Withdrawal |
| Waterbody Appeal | Waterbody Appeal |
| Waterbody Disturbance | Waterbody Disturbance |
| WaterbodyOrigin | Origin of the waterbody |
| WaterClarity | WaterClarity |
| Wave Height | Wave Height |
| WaveAction | Wind Movement of Water on Surface |
| Weight | Weight |
| Weight using UV light | Weight using UV light (%) |
| Weirs Extent | Weirs Extent |
| Weirs Intensity | Weirs Intensity |
| Weirs Proximity | Weirs Proximity |
| WetlandClass | Class or type of wetland |
| WetlandFunction_FloodControl | Function of the wetland for flood control use |
| WetlandFunction_HumanUse | Function of the wetland for human use |
| WetlandFunction_Stormwater | Function of the wetland for stormwater use |
| WetlandFunction_Wildlife | Function of the wetland for wildlife use |
| Wetted habitat | Wetted habitat (standing or flowing surface water) |
| Wetted Width | Wetted Width |
| Width | Width |
| WindDirection | WindDirection |
| WindIntensity | Intensity of wind at the time of sampling |
| WindSpeed | WindSpeed |
| Wire | Wire |
| Wood Debris | Wood Debris |
| Wool Fiber | Wool Fiber |
| Wool Fiber Bundle | Wool Fiber Bundle |
| Wool Film | Wool Film |
| Wool Foam | Wool Foam |
| Wool Fragment | Wool Fragment |
| Wrapper, Food | Wrapper, Food |
| Wrapper, Other | Wrapper, Other |
| Wrapper, Plastic Straw | Wrapper, Plastic Straw |
| XBKF_W | Mean bankfull width of reach |
| XCDENMID | Mean percent mid-channel canopy density |
| XCMG | Riparian cover as sum of three layers physical-habitat metric |
| XCMGW | Mean riparian woody cover as sum of three layers |
| XFC_NAT_SWAMP | Mean sum of natural instream cover types |
| XSLOPE | Mean slope (water surface gradient) of reach |
| Xylene, m/p- | m-Xylene/p-Xylene |
| Xylene, o- | o-Xylene |
| Xylene, p- | p-Xylene |
| Xylenes, Total | Total Xylenes |
| Young/female | Young/female (#) |
| Ytterbium | Ytterbium |
| Yttrium | Yttrium |
| Zinc | Zinc |
| Zinc Phosphide | Zinc Phosphide |
| Zineb | Zineb |
| Ziram | Ziram |
| Zirconium | Zirconium |
| Zoxamide | Zoxamide |