LookUp List Information

CEDEN LookUp List: AnalytewithUnitperMatrix

AnalyteName	AnalyteDescr	CASNumber	pHab_Unit	Water_Unit	Sediment_Unit	Tox_Unit	Fish_Unit	Bivalve_Unit	Group1	Group2	Group3	Group4	Group5	Group6
[DAsp3]Microcystin-RR	[Deaspartic acid3] Microcystin-RR	0		ug/L
13C2-Perfluorooctanoic acid (PFOA)	13C2-Perfluorooctanoic acid (PFOA)	0		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
13c8-Perfluorooctanesulfonic acid (PFOS)	13c8-Perfluorooctanesulfonic acid (PFOS)	0		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
18a-Oleanane	18a-Oleanane	30759923					ng/g ww	ng/g dw	Organics	Hopanes
2,4,6-tribromophenyl allyl ether	2,4,6-tribromophenyl allyl ether (ATE)	3278895			ng/g dw				Organics	FlameRetardants
2-ethyl-1-hexyl-2,3,4,5-tetrabromobenzoate	2-ethyl-1-hexyl-2,3,4,5-tetrabromobenzoate (EHTBB)	183658277			ng/g dw				Organics	FlameRetardants
2-Ethylhexyl-diphenyl phosphate	2-Ethylhexyl-diphenyl phosphate (EHDPP)	1241947			ng/g dw				Organics	FlameRetardants
6-Pack Ring	6-Pack Ring	0	pieces						Debris	Trash	Plastics	FoodService
6PPD-quinone	6PPD-quinone (N-(1,3-dimethylbutyl)-N'-phenyl-p-phenylenediamine-quinone)	2754428185		ng/L					Organics	para-Phenylenediamine (PPD) Derivatives
6PPD-quinone-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: 6PPD-quinone-13C6	0		ng/L					Organics	para-Phenylenediamine (PPD) Derivatives
Abamectin	Abamectin	71751412		ug/L					Organics	Pesticides
AccesstoWaterbody_BikePath	AccesstoWaterbody_BikePath	0	none						Habitat	Debris
AccesstoWaterbody_Fence	AccesstoWaterbody_Fence	0	none						Habitat	Debris
AccesstoWaterbody_HeavyVegetation	AccesstoWaterbody_HeavyVegetation	0	none						Habitat	Debris
AccesstoWaterbody_ParkingLot	AccesstoWaterbody_ParkingLot	0	none						Habitat	Debris
AccesstoWaterbody_PicnicArea	AccesstoWaterbody_PicnicArea	0	none						Habitat	Debris
AccesstoWaterbody_RestrictedAccessMaintenanceRoad	AccesstoWaterbody_RestrictedAccessMaintenanceRoad	0	none						Habitat	Debris
AccesstoWaterbody_Roadway	AccesstoWaterbody_Roadway	0	none						Habitat	Debris
AccesstoWaterbody_Walkway	AccesstoWaterbody_Walkway	0	none						Habitat	Debris
Accumulation	Accumulation using Trash Protocol	0	score						Trash
Acenaphthene	Acenaphthene	83329		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors
Acenaphthene-d10(Surrogate)	Surrogate: Acenaphthene-d10	15067262		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors
Acenaphthenes, C1-	C1-Acenaphthenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	LMW_PAH
Acenaphthylene	Acenaphthylene	208968		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Acenaphthylene-d10(Surrogate)	Surrogate: Acenaphthylene-d10	0			ng/g dw
Acenaphthylene-d8(IsoDilAnalogue)	Isotope Dilution Analogue: Acenaphthylene-d8	93951974		% recovery					Organics	PAHs	IDA
Acenaphthylene-d8(Surrogate)	Surrogate: Acenaphthylene-d8	93951974		% recovery	% recovery		% recovery	% recovery	Organics	PAHs
Acetaminophen	Acetaminophen	103902		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Acetaminophen(Surrogate)	Surrogate: Acetaminophen	0					% recovery	% recovery	Organics
Acetaminophen-13C2-15N(Surrogate)	Surrogate: Acetaminophen-13C2-15N	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Acetamiprid	Acetamiprid	135410207		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Acetamiprid-d3(Surrogate)	Surrogate: Acetamiprid-d3	1353869358		% recovery					Organics	Pesticides	Insecticides	Neonicotinoids
Acetone	Acetone	67641		ug/L					Organics	VOCs
Acetophenone	Acetophenone	98862			ug/Kg dw				Organics
Acibenzolar-S-methyl	Acibenzolar-S-methyl	135158542		ng/L					Organics	Pesticides	Fungicides
Acid Mine Drainage Extent	Acid Mine Drainage Extent	0	none						Habitat
Acid Mine Drainage Intensity	Acid Mine Drainage Intensity	0	none						Habitat
Acid Mine Drainage Proximity	Acid Mine Drainage Proximity	0	none						Habitat
Acid Neutralizing Capacity	Acid Neutralizing Capacity (ANC)	0		ueq/L					Inorganics	Conventionals
Acid Volatile Sulfides	Acid Volatile Sulfides (AVS)	0		ug/L	umol/g dw				Inorganics	Conventionals
Acifluorfen	Acifluorfen	50594666		ug/L					Organics	Herbicides
Acrinathrin	Acrinathrin	0			ug/Kg ww				Organics	Pesticides	Pest-Pyrethroids
Acrolein	Acrolein	107028		ug/L			ug/Kg ww	ug/Kg dw	Organics	OrganochlorinePesticides
Acrylonitrile	Acrylonitrile	107131		ug/L					Organics	VOCs
Adsorbable Organic Fluorine	Adsorbable Organic Fluorine (AOF) [detected as Fluoride]	0		ug/L					Organics	PFAS
Aesthetic Condition	Aesthetic Condition	0	none						Habitat	Debris
AFDM_Algae	Ash Free Dry Mass primarily of Algae but other items may be weighed	0		mg/m3					Inorganics	Conventionals
Age	Age	0					yr		Tissue
Age Diversity and Natural Regeneration Metric	Metric assesses the age diversity and natural regeneration potential of woody species in the riparian and channel zones (excluding low-flow).	0	score						Habitat
Age_Pond	Age (in years) of the pond if it is created	0	yr						Habitat
Agricultural Other Extent	Agricultural Other Extent	0	none						Habitat
Agricultural Other Intensity	Agricultural Other Intensity	0	none						Habitat
Agricultural Other Proximity	Agricultural Other Proximity	0	none						Habitat
Agricultural Runoff Extent	Agricultural Runoff Extent	0	none						Habitat
Agricultural Runoff Intensity	Agricultural Runoff Intensity	0	none						Habitat
Agricultural Runoff Proximity	Agricultural Runoff Proximity	0	none						Habitat
Air Traffic Extent	Air Traffic Extent	0	none						Habitat
Air Traffic Intensity	Air Traffic Intensity	0	none						Habitat
Air Traffic Proximity	Air Traffic Proximity	0	none						Habitat
Alachlor	Alachlor (Lasso)	15972608		ug/L	ug/Kg dw				Organics	Herbicides	Endocrine Disruptors
Alachlor ethanesulfonic acid	Alachlor ethanesulfonic acid (ESA)	142363539		ug/L					Organics	Pesticides
Alachlor oxanilic acid	Alachlor oxanilic acid (OXA)	0		ug/L					Organics	Pesticides
Albuterol	Albuterol	18559949		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Albuterol-d3(Surrogate)	Surrogate: Albuterol-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Aldicarb	Aldicarb	116063		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides
Aldicarb Sulfone	Aldicarb Sulfone	1646884		ug/L	ug/Kg dw				Organics	Pesticides	Insecticides	Carbamates
Aldicarb Sulfoxide	Aldicarb Sulfoxide	1646873		ug/L					Organics	Pesticides	Insecticides	Carbamates
Aldrin	Aldrin	309002		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors
Aldrin(Surrogate)	Surrogate: Aldrin	309002		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Aldrin-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Aldrin-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Aldrin-13C12(Surrogate)	Surrogate: Aldrin-13C12	309002			% recovery				Organics	Pesticides
Algae Cover	Percent of stream's water surface upstream of sample location estimated to be covered with algae	0	%						FieldObservations	Habitat
Algae Cover Filamentous	Percent of stream's water surface upstream of sample location estimated to be covered with filamentous algae	0	%						FieldObservations	Habitat
Algae-attached	Percent of substrate in wetted channel upstream of sample location estimated to be covered with Algae-attached	0	%						FieldObservations	Habitat
Algae-floating Mats	Percent of stream's water surface upstream of sample location estimated to be covered with Algae-floating Mats	0	%						FieldObservations	Habitat
Algal Cover Periphyton	Percent of substrate in wetted channel upstream of sample location estimated to be covered with periphyton [living community attached to substrate including algae (not green filamentous type), aquatic mosses, fungi, diatoms & sessile invertebrates]	0	%						FieldObservations	Habitat
Algal/Surface Mats/Benthic Algal Growth Extent	Algal/Surface Mats/Benthic Algal Growth Extent	0	none						Habitat
Algal/Surface Mats/Benthic Algal Growth Intensity	Algal/Surface Mats/Benthic Algal Growth Intensity	0	none						Habitat
Algal/Surface Mats/Benthic Algal Growth Proximity	Algal/Surface Mats/Benthic Algal Growth Proximity	0	none						Habitat
Alkalinity as CaCO3	Alkalinity as CaCO3	471341		ug/L	mg/Kg dw				Inorganics	Conventionals	WaterQualityMeasurements	Habitat
Allethrin	Allethrin	584792		ug/L	ug/Kg ww				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Alpha Linolenic Acid	Alpha Linolenic Acid	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid
Alprazolam	Alprazolam	28981977		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Alprazolam-d5(Surrogate)	Surrogate: Alprazolam-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Aluminum	Aluminum	7429905		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Aluminum Foil	Aluminum Foil	0	pieces						Debris	Trash	Non-Plastics	Metals
Aluminum, Organic Monomeric	Organic Monomeric Aluminum (Organic Reactive)	0		ug/L					Inorganics	TraceElements	Metals
Aluminum, Total Monomeric	Total Monomeric Aluminum (Organic + Inorganic Reactive)	0		ug/L					Inorganics	TraceElements	Metals
Aluminum/Steel Can	Aluminum/Steel Can	0	pieces						Debris	Trash	Non-Plastics	Metals
Ametryn	Ametryn	834128		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	Pest-Triazines	Herbicides
Aminobenzothiazole, 2-	2-Aminobenzothiazole (ABT)	136958		ng/L					Organics	Benzotriazoles and Benzothiazoles
Aminocarb	Aminocarb	2032599		ug/L					Organics	Pesticides	Pest-Carbamates	Insecticides
Aminomethyl Phosphonic Acid	Aminomethyl Phosphonic Acid (AMPA)	1066519		ug/L					Organics	Pesticides	Herbicides
Aminopyralid	Aminopyralid	150114719		ug/L					Organics	Herbicides
Amitriptyline	Amitriptyline	50486		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Amitriptyline-d5(Surrogate)	Surrogate: Amitriptyline-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Amlodipine	Amlodipine	88150429		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Ammonia as N	Ammonia as N	7664417		umol/L	ug/g ww				Inorganics	Conventionals	Nutrients
Ammonia as N, Unionized	Unionized Ammonia as N	7664417		mg/L					Inorganics	Conventionals	Nutrients
Ammonia as NH3	Ammonia as NH3	7664417		mg/L					Inorganics	Conventionals	Nutrients	WaterQualityMeasurements
Ammonia as NH3, Unionized	Unionized Ammonia as NH3	7664417		mg/L					Inorganics	Conventionals	Nutrients	WaterQualityMeasurements
Ammonium as N	Ammonium as N (NH4)	0		ug/L					Inorganics	Conventionals	Nutrients
Amoxicillin	Amoxicillin	26787780		ng/L
AMPA(Surrogate)	Surrogate: Aminomethyl Phosphonic Acid (AMPA)	77521290		% recovery					Organics	Pesticides
Amphetamine	Amphetamine	300629		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Amphetamine-d5(Surrogate)	Surrogate: Amphetamine-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
AnalysisWeight	Analysis weight of sample	0			mg		mg	mg	Laboratory	Ancillary
Anatoxin-A	Anatoxin-A	64285069		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Angling Pressure	Angling Pressure	0	none						Habitat
Anilazine	Anilazine	101053		ug/L					Organics	Pesticides	Fungicides
Aniline	Aniline (Aminobenzene)(Phenylamine)	0		ug/L					Organics	VOCs
Animal Burrows Extent	Animal Burrows Extent	0	none						Habitat
Animal Burrows Intensity	Animal Burrows Intensity	0	none						Habitat
Animal Burrows Proximity	Animal Burrows Proximity	0	none						Habitat
AnimalPresence	describes presence of animals which may include tracks, scat, sounds or physical presence	0	none						FieldObservations	Habitat
Anion-Cation Balance	Anion-Cation Balance	0		none					Inorganics
AnoxicTransitionDepth	Depth of the oxic-anoxic transition zone, also called redox potential discontinuity	0			cm				FieldObservations	Habitat
Anthracene	Anthracene	120127		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors
Anthracene-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Anthracene-d10	1719068		% recovery
Anthracene-d10(Surrogate)	Surrogate: Anthracene-d10	0		% recovery	%				Organics	PAHs
Anthraquinone	Anthraquinone	84651			ug/Kg ww				Organics
Anthropogenic (unknown base) fiber	Fiber that is anthropogenic because it is DYED, but material type could not be identified as plastic or natural	0							Microdebris	Anthropogenic		Fiber
Anthropogenic Alt Channel Modification SubMetric	Metric assesses the impact of anthropogenic alterations based on channel modification	0	score						Habitat
Anthropogenic Alt Hydromodification SubMetric	Metric assesses the impact of anthropogenic alterations based on hydromodification and Channel Evolution Models (CEMS)	0	score						Habitat
Anthropogenic Alterations to Channel Morph Metric	Metric assesses the impact of anthropogenic alterations to channel morphology through hydromodification and channel modification. Metric is an average of the two previous submetrics.	0	score						Habitat
Antimony	Antimony	7440360		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	Metals	Metalloids
Appliance	Appliance	0	pieces						Debris	Trash	Non-Plastics	Large
AquaticLife	AquaticLife using Trash Protocol	0	score						Trash
Arachidonic	Arachidonic	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid
Area	Area	0	m2						Tissue	Habitat
Arsenate	Arsenate	0					ug/g ww	ug/g dw	Inorganics	Metals
Arsenic	Arsenic	7440382		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals	Metalloids
Arsenic, Inorganic	Inorganic Arsenic	7440382					ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Arsenite	Arsenite	0					ug/g ww	ug/g dw	Inorganics	Metals
Asbestos, Total	Total Asbestos	0		mf/L					Inorganics	Conventionals
Ash Free Dry Mass	Ash-Free Dry Mass (AFDM, AFDW)	0		mg/L					Inorganics	Conventionals	Benthic
Aspon	Aspon	3244904		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Atenolol	Atenolol	29122687		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Atenolol-d7(Surrogate)	Surrogate: Atenolol-d7	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Atorvastatin	Atorvastatin	134523005		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Atraton	Atraton	1610179		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Atrazine	Atrazine	1912249		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Triazines	Herbicides	Endocrine Disruptors
Atrazine-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Atrazine-13C3	0					% recovery	% recovery	Organics	Pest-Triazines	IDA
Atrazine-13C3(Surrogate)	Surrogate: Atrazine-13C3	0		% recovery					Organics	Pesticides	Pest-Triazines
Atrazine-d5(Surrogate)	Surrogate: Atrazine-d5	163165751		% recovery					Organics	Pesticides	Pest-Triazines	Herbicides	Endocrine Disruptors
Atrazine-Desisopropyl-2-Hydroxy	Atrazine-Desisopropyl-2-Hydroxy	7313544		ug/L					Organics	Omega Fatty Acid
ATVs Extent	ATVs Extent	0	none						Habitat
ATVs Intensity	ATVs Intensity	0	none						Habitat
ATVs Proximity	ATVs Proximity	0	none						Habitat
Autopart	Autopart	0	pieces						Debris	Trash	Non-Plastics	Metals
Avian_GFD	Avian_GFD	0		copies/100mL					Microbiological
Azinphos Ethyl	Azinphos Ethyl	2642719		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides
Azinphos Methyl	Azinphos Methyl (Guthion)	86500		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Azinphos Methyl oxon	Azinphos Methyl oxon	0		ng/L					Organics	Pesticides
Azinphos Methyl(Surrogate)	Surrogate: Azinphos Methyl	0		% recovery					Organics	Pesticides	OrganophosphatePest.	Insecticides
Azinphos-methyl oxygen analog	Azinphos-methyl oxygen analog	0		ug/L					Organics	Pesticides
Azinphos-Methyl-d6(IsoDilAnalogue)	Isotope Dilution Analogue: Azinphos-Methyl-d6	0					% recovery	% recovery	Organics	Pest-OPs	IDA
Azithromycin	Azithromycin	83905015		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Azobenzene	Azobenzene (Diphenyl Diimide)	103333		ug/L					Organics	SVOCs
Azoxystrobin	Azoxystrobin	131860338		ug/L	ug/Kg dw				Pesticides	Fungicides
Back Water	Back Water present	0	none						Habitat
Bacteriodales, Cow	Cow Bacteriodales	0		gc/mL					Microbiological	Pathogens	Conventionals
Bacteriodales, Dog	Dog Bacteriodales	0		gc/mL					Microbiological	Pathogens	Conventionals
Bacteriodales, Human	Human Bacteriodales	0		gc/mL					Microbiological	Pathogens	Conventionals
Bacteriodales, Universal	Universal Bacteriodales	0		gc/mL					Microbiological	Pathogens	Conventionals
Bacteriophage MS2	Bacteriophage MS2	0		PFU/L					Microbiological	Pathogens
Bacteroidales, Avian (LeeSeaGull)	Avian Bacteroidales, Assay name: LeeSeaGull, 5’ AGGTGCTAATACCGCATAATACAGAG 3’, 5’ GCCGTTACCTCACCGTCTA 3’	0		gc/mL					Microbiological	MST
Bacteroidales, Canine (BacCan)	Canine Bacteroidales, Assay name: BacCan, 5' GGAGCGCAGACGGGTTTT 3', 5' CAATCGGAGTTCTTCGTGATATCTA 3'	0		gc/mL					Microbiological	MST
Bacteroidales, Canine (DogBact)	Canine Bacteroidales, Assay Name: DogBact	0		copies/100mL
Bacteroidales, Cow	Cow Bacteroidales	0		gc/mL					Microbiological	Pathogens	Conventionals
Bacteroidales, Cow (BacCow)	Cow Bacteroidales, Assay name: BacCow, 5' CCAACYTTCCCGWTACTC 3', 5' GGACCGTGTCTCAGTTCCAGTG 3'	0		gc/mL					Microbiological	MST
Bacteroidales, Cow (CowM2)	Cow Bacteroidales, Assay name: CowM2, 5' CGGCCAAATACTCCTGATCGT 3', 5' GCTTGTTGCGTTCCTTGAGATAAT 3'	0		gc/mL					Microbiological	MST
Bacteroidales, Dog	Dog Bacteroidales	0		none	copies/g dw				Microbiological	Pathogens	Conventionals
Bacteroidales, Horse	Horse Bacteroidales	0		none					Microbiological	Pathogens	Conventionals
Bacteroidales, Horse (HoF597F)	Horse Bacteroidales, Assay name: HoF597F, 5' CCAGCCGTAAAATAGTCGG 3', 5' CAATCGGAGTTCTTCGTG 3'	0		gc/mL					Microbiological	MST
Bacteroidales, Human	Human Bacteroidales	0		none	copies/g dw				Microbiological	Pathogens	Conventionals
Bacteroidales, Human (BacH)	Human Bacteroidales Marker BacH	0		gc/mL
Bacteroidales, Human (HF183/BacR287)	Human Bacteroidales, Assay name: HF183/BacR287, 5'-ATCATGAGTTCACATGTCCG-3', 5'-CTTCCTCTCAGAACCCCTATCC-3'	0		gc/mL	none				Microbiological
Bacteroidales, Human (HF183/BFDrev)	Human Bacteroidales, Assay name: HF183/BFDrev, 5' ATCATGAGTTCACATGTCCG 3', 5' CGTAGGAGTTTGGACCGTGT 3'	0		gc/mL
Bacteroidales, Human (HF183TMCaMan)	Human Bacteroidales, Assay name: HF183TMCaMan, 5’ ATCATGAGTTCACATGTCCG 3’, 5’ CTTCCTCTCAGAACCCCTATCC 3’	0		copies/100 mL					Microbiological
Bacteroidales, Human (HumM2)	Human Bacteroidales, Assay name: HumM2, 5'-CGTCAGGTTTGTTTCGGTATTG-3', 5'-TCATCACGTAACTTATTTATATGCATTAGC-3'	0		copies/100 mL					Microbiological
Bacteroidales, Porcine (Pig2Bac)	Porcine Bacteroidales, Assay name: Pig2Bac	0		copies/100 mL					Microbiological
Bacteroidales, Ruminant (Rum2Bac)	Ruminant Bacteroidales, Asssay name: Rum2Bac, 5' ACAGCCCGCGATTGATACTGGTAA 3', 5' CAATCGGAGTTCTTCGTGAT 3'	0		gc/mL	none				Microbiological	MST
Bacteroidales, Universal	Universal Bacteroidales	0		none					Microbiological	Pathogens	Conventionals
Bacteroidales, Universal (UniB)	Universal Bacteroidales, Assay name: UniB, 5' GGGGTTCTGAGAGGAAGGT 3', 5' CCGTCATCCTTCACGCTACT 3'	0		gc/mL					Microbiological	Pathogens	Conventional
Bag, Large/Retail	Bag, Large/Retail	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Bag, Pet Waste	Bag, Pet Waste	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Bag, Single Use Plastic	Bag, Single Use Plastic	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Bag, Takeout	Bag, Takeout	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Bags/Packaging	Bags/Packaging	0	pieces						Debris	Trash	Plastics
Balloon, Latex	Balloon, Latex	0	pieces						Debris	Trash	Plastics	Miscellaneous
Balloon, Mylar	Balloon, Mylar	0	pieces						Debris	Trash	Plastics	Miscellaneous
Bandage/Bandaid	Bandage/Bandaid	0	pieces						Debris	Trash	Plastics	Miscellaneous
Bank Angle	Bank Angle	0	none						Habitat
Bank Cover	Bank Cover	0	none						Habitat
Bank Stability	Bank Stability (score zone 5m up and 5m downstream of transect between bankfull - wetted width)	0	none						Habitat
Bankfull Height	Bankfull Height	0	m						Habitat
Bankfull Width	Bankfull Width	0	m						Habitat
Bankfull Width Reach	Visual estimate of the average bankfull width of the reach	0	m						Habitat
Bar Present	Bar Present	0	none						Habitat
Bar Width	Bar Width	0	m						Habitat
Barban	Barban	101279		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Barban(Surrogate)	Surrogate: Barban	101279		% recovery					Organics	Pesticides	Pest-Carbamates
Barium	Barium	7440393		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals
Barometric Pressure	Barometric Pressure	0							Habitat
Batteries, Large	Batteries, Large	0	pieces						Debris	Trash	Non-Plastics	Toxic
Batteries, Small	Batteries, Small	0	pieces						Debris	Trash	Non-Plastics	Toxic
Battery Voltage	Battery Voltage	0							FieldMeasure
Bearing	Bearing	0	degrees						Habitat
BeaufortScale	BeaufortScale	0	none						FieldObservations	Habitat
Beaver Flow Modifications	Beaver Flow Modifications	0	none						Habitat
Beaver Signs	Beaver Signs	0	none						Habitat
Bendiocarb	Bendiocarb	22781233		ug/L					Organics	Pesticides	Pest-Carbamates
Benfluralin	Benfluralin	1861401		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides
Benomyl	Benomyl	17804352		ug/L					Organics	Pesticides	Pest-Carbamates	Endocrine Disruptors	Fungicides	Nematocides
Benomyl/Carbendazim	Benomyl/Carbendazim	0		ug/L					Organics	Pesticides
Bensulfuron Methyl	Bensulfuron Methyl	83055996		ug/L					Organics	Pesticides	Pest-Carbamates
Bensulide	Bensulide	741582		ug/L					Organics	Herbicides
Bentazon	Bentazon	25057890		ug/L					Organics	Pesticides
Benz(a)anthracene	Benz(a)anthracene	56553		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benz(a)anthracene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benz(a)anthracene-d12	1718532		% recovery					Organics	PAH	IDA
Benz(a)anthracene-d12(Surrogate)	Surrogate: Benz(a)anthracene-d12	1718532		% recovery	% recovery		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benz(a)anthracene-d12/Chrysene-d12(Surrogate)	Surrogate: Benz(a)anthracene-d12/Chrysene-d12	0		% recovery					Organics	PAHs
Benz(a)anthracenes/Chrysenes, C1-	C1-Benz(a)anthracenes/Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Benz(a)anthracenes/Chrysenes, C2-	C2-Benz(a)anthracenes/Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Benz(a)anthracenes/Chrysenes, C3-	C3-Benz(a)anthracenes/Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Benz(a)anthracenes/Chrysenes, C4-	C4-Benz(a)anthracenes/Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Benz(e)pyrene-d12(Surrogate)	Surrogate: Benz(e)pyrene-d12	205440820		% recovery	% recovery		% recovery	% recovery	Organics	PAHs	Semi-VOAs
Benzaldehyde	Benzaldehyde	100527		% recovery					Organics	VOCs
Benzene	Benzene	71432		ug/L					Organics	VOCs	MTBE_BTEX
Benzidine	Benzidine	92875		ug/L					Organics	SVOCs
Benzo(a)fluoranthene	Benzo(a)fluoranthene	203338		ug/L	ng/g dw				Organics	PAHs	SVOCs
Benzo(a)pyrene	Benzo(a)pyrene	50328		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(a)pyrene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(a)pyrene-d12	63466717		% recovery					Organics	PAHs	IDA
Benzo(a)pyrene-d12(Surrogate)	Surrogate: Benzo(a)pyrene-d12	63466717		% recovery	% recovery		% recovery	% recovery	Organics	PAHs
Benzo(b)fluoranthene	Benzo(b)fluoranthene	205992		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(b)fluoranthene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(b)fluoranthene-d12	93951985		% recovery					Organics	PAHs	IDA
Benzo(b)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12	93951985		% recovery	% recovery		% recovery	% recovery	Organics	PAHs
Benzo(b)fluorene, 11H-	11H-Benzo(b)fluorene	243174			ng/g dw
Benzo(b/j/k)fluoranthene	Benzo(b)fluoranthene/Benzo(j)fluoranthene/Benzo(k)fluoranthene	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Semi-VOAs	HMW_PAH	Endocrine Disruptors
Benzo(b/j/k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12/Benzo(j)fluoranthene-d12/Benzo(k)fluoranthene-d12	0		% recovery					Organics	PAHs
Benzo(b/k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12/Benzo(k)fluoranthene-d12	0		% recovery					Organics	PAHs
Benzo(e)pyrene	Benzo(e)pyrene	192972		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(e)pyrene-d12(Surrogate)	Surrogate: Benzo(e)pyrene-d12	205440820		% recovery	% recovery				Organics	PAHs	SVOCs
Benzo(g,h,i)perylene	Benzo(g,h,i)perylene	191242		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(g,h,i)perylene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(g,h,i)perylene-d12	93951667		% recovery					Organics	PAHs	IDA
Benzo(g,h,i)perylene-d12(Surrogate)	Surrogate: Benzo(g,h,i)perylene-d12	93951667		% recovery	% recovery		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(j)fluoranthene	Benzo(j)fluoranthene	0					ug/Kg ww	ug/Kg dw	Organics	PAHs
Benzo(j/k)fluoranthene	Benzo(j)fluoranthene/Benzo(k)fluoranthene	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(k)fluoranthene	Benzo(k)fluoranthene	207089		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(k)fluoranthene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(k)fluoranthene-d12	93952013		% recovery					Organics	PAHs	IDA
Benzo(k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(k)fluoranthene-d12	0		% recovery	% recovery		% recovery	% recovery	Organics	PAHs
Benzobicyclon	Benzobicyclon pesticide	156963665		ug/L
Benzofluoranthenes/Benzopyrenes, C1-	C1-Benzofluoranthenes/Benzopyrenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Alkylated PAHs
Benzofluoranthenes/Benzopyrenes, C2-	C2-Benzofluoranthenes/Benzopyrenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Alkylated PAHs
Benzoic Acid	Benzoic Acid	0		ug/L	ug/Kg dw				Organics	Herbicides
Benzophenone	Benzophenone	119619			ug/Kg dw				Organics
Benzothiazole, 2-(4-Morpholinyl)	2-(4-Morpholinyl)Benzothiazole (2,4-MoBT)	4225267		ng/L					Organics	Benzotriazoles and Benzothiazoles
Benzothiazolone	Benzothiazolone (2-Benzothiazolinone) (2-Hydroxy-Benzothiazole)	934349		ng/L					Organics	Benzotriazoles and Benzothiazoles
Benzothiophene	Benzothiophene	95158		ng/L			ng/g ww	ng/g dw	Organics	PAHs
Benzothiophene, C1-	C1-Benzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs
Benzothiophene, C2-	C2-Benzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs
Benzothiophene, C3-	C3-Benzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs
Benzoylecgonine	Benzoylecgonine	519095		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Benzoylecgonine-d8(Surrogate)	Surrogate: Benzoylecgonine-d8	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Benztropine	Benztropine	86135		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Benztropine-d3(Surrogate)	Surrogate: Benztropine-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Benzyl Alcohol	Benzyl Alcohol	0		ug/L	ug/Kg dw				Organics	VOCs
Beryllium	Beryllium	7440417		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals
Betamethasone	Betamethasone	378449		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Bicarbonate	Bicarbonate	71523		ug/L	mg/Kg dw				Inorganics	Conventionals
Bicarbonate Alkalinity as CaCO3	Bicarbonate Alkalinity as CaCO3	471341		mg/L					Inorganics	Conventionals	WaterQualityMeasurements
Bifenox	Bifenox	42576023		ug/L					Organics	Pesticides	Herbicides
Bifenthrin	Bifenthrin	82657043		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Pyrethroids	Insecticides
Bifenthrin, Total(Surrogate)	Surrogate: Total Bifenthrin	0		% recovery
Bifenthrin-d5(Surrogate)	Surrogate: Bifenthrin-d5 ((rac-cis)-Z-Bifenthrin-d5)	2714484156		% recovery	% recovery				Organics	Pesticides	Pest-Pyrethroids
Bifenthrin-d6(Surrogate)	Surrogate: Bifenthrin-d6	0		% recovery	% recovery				SVOC	Pesticides
Biodegradable, Other	Biodegradable, Other	0	pieces						Debris	Natural	Non-Plastics	Biodegradable
Biomass (wt/orig indiv)	Biomass (weight/original individual)	0		mg/ind		mg/ind			Toxicity
Biphenyl	Biphenyl	92524		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Biphenyl-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Biphenyl-d10	1486017		% recovery					Organics	PAHs	IDA
Biphenyl-d10(Surrogate)	Surrogate: Biphenyl-d10	1486017		% recovery	% recovery		ng/g ww	ng/g dw	Organics	PAHs	SVOCs
Biphenyls, C1-	C1-Biphenyls	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	LMW_PAH
Biphenyls, C2-	C2-Biphenyls	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	LMW_PAH
Bis(1,3-dichloro-2-propyl) phosphate	Bis(1,3-dichloro-2-propyl) phosphate (BDCPP)	72236727			ng/g dw				Organics	FlameRetardants
Bis(2,4,6-tribromophenoxy)ethane-1,2	1,2-bis(2,4,6-tribromophenoxy)ethane (BTBPE)	37853591			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
Bis(2,4,6-tribromophenoxy)ethane-1,2-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2-bis(2,4,6-tribromophenoxy)ethane-13C12 (BTBPE-13C12)	0					% recovery	% recovery	Organics	FlameRetardants	IDA
Bis(2-chloro-1-methylethyl) ether	Bis(2-chloro-1-methylethyl) ether	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	SVOCs
Bis(2-chloroethoxy)methane	Bis(2-chloroethoxy)methane	111911		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Bis(2-chloroethyl)ether	Bis(2-chloroethyl)ether	111444		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Bis(2-chloroisopropyl) ether	Bis(2-chloroisopropyl) ether	39638329		ug/L	ug/Kg dw				Organics	SVOCs
Bis(2-ethly-1-hexyl)tetrabromophthalate	Bis(2-ethly-1-hexyl)tetrabromophthalate (BEHTBP)	26040517			ng/g dw				Organics	FlameRetardants
Bis(2-ethylhexyl)adipate	Bis(2-ethylhexyl)adipate	103231		ug/L					Organics	SVOCs
Bis(2-ethylhexyl)phthalate	Bis(2-ethylhexyl)phthalate	117817		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs	Endocrine Disruptors
Bis(2-ethylhexyl)phthalate-d4(Surrogate)	Surrogate: Bis(2-ethylhexyl)phthalate-d4	0		% recovery					Organics	SVOCs
Bis(alpha,alpha-Dimethylbenzyl)Diphenylamine, 4,4-	4,4-Bis(alpha,alpha-Dimethylbenzyl)Diphenylamine (SDPA-diAMS)	10081671		ng/L					Organics	Substituted Diphenylamines (SDPAs)
Bisphenol A	Bisphenol A	80057		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Bisphenol A-d16(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol A-d16	96210876		% recovery					Organics
Bisphenol A-d6(Surrogate)	Surrogate: Bisphenol A-d6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Bisphenol AF	Bisphenol AF	1478611		ng/L					Organics	PPCPs	Bisphenols
Bisphenol B	Bisphenol B	77407		ng/L					Organics	PPCPs	Bisphenols
Bisphenol E	Bisphenol E	2081085		ng/L					Organics	PPCPs	Bisphenols
Bisphenol F	Bisphenol F	620928		ng/L					Organics	PPCPs	Bisphenols
Bisphenol S	Bisphenol S	80091		ng/L					Organics	PPCPs	Bisphenols
Bispyribac Sodium	Bispyribac Sodium	125401925		ug/L					Organics	Pesticides	Herbicides
Bivalve CI Mean	Bivalve Condition Index Mean	0					g/mL	g/mL	Organics	Inorganics	Metals	Conventionals	Semi-VOAs	VOAs
Bivalve CI SE	Bivalve Condition Index Standard Error	0					g/mL	g/mL	Organics	Inorganics	Metals	Conventionals	Semi-VOAs	VOAs
Blue-Green Algae Phycocyanin	Blue-Green Algae Phycocyanin (BGA-PC)	0		ug/L					WaterQualityMeasurements
BOD	Biochemical Oxygen Demand (BOD) - 5 day test	0		mg/L					Inorganics	Conventionals
Bolstar	Bolstar (Sulprofos)	35400432		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Boron	Boron	7440428		ug/L	mg/Kg dw		ug/g ww	ug/g dw	Inorganics	Conventionals	Metals	Metalloids
Boscalid	Boscalid	188425856		ug/L	ug/Kg dw				Organics	Fungicides
Bottle Cap, Metal	Bottle Cap, Metal	0	pieces						Debris	Trash	Non-Plastics	Metals
Bottle Cap, Plastic	Bottle Cap, Plastic	0	pieces						Debris	Trash	Plastics	FoodService
Bottle, Beach	Bottle, Beach	0	pieces						Debris	Trash	Plastics	Toxic
Bottle, Cleaning	Bottle, Cleaning	0	pieces						Debris	Trash	Plastics	Toxic
Bottle, Glass	Bottle, Glass	0	pieces						Debris	Trash	Non-Plastics	Household
Bottle, Plastic	Bottle, Plastic Beverage	0	pieces						Debris	Trash	Plastics
Bottle, Shampoo	Bottle, Shampoo	0	pieces						Debris	Trash	Plastics	Household
Bottle, Soda	Bottle, Soda	0	pieces						Debris	Trash	Plastics	FoodService
Bottle, Sport	Bottle, Sport	0	pieces						Debris	Trash	Plastics	FoodService
Bottle, Water	Bottle, Water	0	pieces						Debris	Trash	Plastics	FoodService
Brick	Brick	0	pieces						Debris	Trash	Non-Plastics	Construction
Bridge	Bridge	0	none						Habitat	Debris
Bridge Fence	Bridge Fence	0	none						Habitat	Debris
Bridge Fence Height	Bridge Fence Height	0	m						Habitat	Debris
Bridges, Culverts	Bridges, Culverts	0	none						Habitat
Bromacil	Bromacil	314409		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Herbicides
Bromide	Bromide	24959679		ug/L					Inorganics	Conventionals	Nutrients
Bromo-2-Nitrobenzene, 1-(Surrogate)	Surrogate: 1-Bromo-2-Nitrobenzene	0		% recovery					Organics	VOCs
Bromo-3,5-dimethylphenyl-N-methylcarbamate, 4-(Surrogate)	Surrogate: 4-Bromo-3,5-dimethylphenyl-N-methylcarbamate (BDMC)	672991		% recovery					Organics	OrganochlorinePesticides
Bromoacetic Acid	Bromoacetic Acid (Monobromoacetic Acid)(MBAA)	79083		ug/L					Organics	Haloacetic acids (HAAs)
Bromobenzene	Bromobenzene (Phenyl Bromide)	108861		ug/L					Organics	VOCs
Bromochloromethane	Bromochloromethane	74975		ug/L					Organics	VOCs
Bromodichloromethane	Bromodichloromethane (Dichlorobromomethane)	75274		ug/L			ug/Kg ww	ug/Kg dw	Organics	VOCs
Bromofluorobenzene, 4-	4-Bromofluorobenzene	460004		% recovery	ug/Kg ww				Organics	VOCs
Bromofluorobenzene, 4-(Surrogate)	Surrogate: 4-Bromofluorobenzene	460004		ug/L	% recovery				Organics	VOCs
Bromoform	Bromoform (Tribromomethane)	75252		ug/L					Organics	VOCs
Bromomethane	Bromomethane (Methyl Bromide)	74839		ug/L					Organics	VOCs
Bromophenyl Phenyl Ether, 4-	4-Bromophenyl Phenyl Ether	101553		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Bromuconazole	Bromuconazole (Bromoconazole)	116255482		ng/L					Organics	Pesticides	Fungicides
Bulk Density	Bulk Density	0			g/cm3 ww				WaterQualityMeasurements	Ancillary
Bumetrizole	Bumetrizole (UV-326) (2-tert-butyl-6-(5-Chloro-2H-1,2,3-Benzotriazol-2-yl)-4-Methylphenol)	3896115		ng/L					Organics	Benzotriazoles and Benzothiazoles
Burns Extent	Burns Extent	0	none						Habitat
Burns Intensity	Burns Intensity	0	none						Habitat
Burns Proximity	Burns Proximity	0	none						Habitat
Butachlor	Butachlor	23184669		ug/L					Organics	Herbicides
Butanone, 2-	2-Butanone (Methyl Ethyl Ketone)	78933		ug/L					Organics	VOCs
Butralin	Butralin	33629479		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides
Butyl Benzyl Phthalate	Butyl Benzyl Phthalate	85687		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs	Endocrine Disruptors
Butyl Benzyl Phthalate-d4(Surrogate)	Surrogate: Butyl Benzyl Phthalate-d4	0		% recovery					Organics	SVOCs
Butylate	Butylate	2008415		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates
Butylbenzene, n-	n-Butylbenzene	104518		ug/L					Organics	VOCs
Butylbenzene, sec-	sec-Butylbenzene	135988		ug/L					Organics	VOCs
Butylbenzene, tert-	tert-Butylbenzene	98066		ug/L					Organics	VOCs
Butyl-N-ethyl-2,6-dinitro-4-(trifluoromethyl)aniline, N-	N-Butyl-N-ethyl-2,6-dinitro-4-(trifluoromethyl)aniline (Benfluralin)	0		ug/L					Organics	Pesticides	Herbicides
Butyltin as Sn	Butyltin as Sn	0			ug/Kg dw				Organics	Organotins
C. coli		0		copies/100 mL
C. jejuni		0		copies/100 mL
CA_LRM	Score for the California Logistic Regression Model (CA LRM)	0			score				Sediment Quality Objectives	Index/Metric
Cadmium	Cadmium	7440439		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Caffeine	Caffeine	58082		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Caffeine-13C(Surrogate)	Surrogate: Caffeine-13C	202282982		% recovery			% recovery	% recovery	Organics	PPCPs
Caffeine-13C3(Surrogate)	Surrogate: Caffeine-13C3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
CAFOs Extent	CAFOs Extent	0	none						Habitat
CAFOs Intensity	CAFOs Intensity	0	none						Habitat
CAFOs Proximity	CAFOs Proximity	0	none						Habitat
Calcium	Calcium	7440702		ug/L	mg/Kg dw		ug/g ww	ug/g dw	Inorganics	Conventionals	Metals
Calcium Bound Phosphorus	Calcium Bound Phosphorus	0			ug/g dw				Inorganics	Conventional	Nutrients
Camphor	Camphor	76222			ug/Kg dw				Organics
Canopy Cover	Canopy Cover	0	none						Habitat
Caprolactam	Caprolactam (Azepan-2-one)	105602		ng/L					Organics	PPCPs
Captafol	Captafol	2425061		ug/L					Organics	Pesticides	Fungicides
Captan	Captan	133062		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Carbamates	Insecticides
Carbadox	Carbadox	6804075		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Carbamazepine	Carbamazepine	298464		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Carbamazepine(Surrogate)	Surrogate: Carbamazepine	0					% recovery	% recovery	Organics
Carbaryl	Carbaryl	63252		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides	Endocrine Disruptors
Carbaryl-D7(Surrogate)	Surrogate: Carbaryl-D7	362049567		% recovery	% recovery				Organics	Pesticides	Pest-Carbamates	Insecticides
Carbazole	Carbazole	86748		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Carbazole(Surrogate)	Surrogate: Carbazole	86748		% recovery					Organics	Semi-VOAs
Carbendazim	Carbendazim	10605217		ng/L					Organics	Pesticides	Fungicides
Carbofuran	Carbofuran	1563662		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides	Nematocides
Carbon Dioxide, Daily Mean	Daily Mean Carbon Dioxide (Calculated)	124389		uatm					WaterQualityMeasurements	Conventionals
Carbon dioxide, free	Carbon dioxide, free	124389		mg/L
Carbon Dioxide, total	Carbon Dioxide, total	124389		mg/L
Carbon Disulfide	Carbon Disulfide	0		ug/L					Inorganics	Conventionals
Carbon Tetrachloride	Carbon Tetrachloride	56235		ug/L					Organics	VOCs
Carbon, Total	Total Carbon	7440440		mg/L	% dw		%	%	Inorganics	Conventionals
Carbon-13/Carbon-12 Ratio	Carbon-13/Carbon-12 Ratio	14762744		per mil					Radiochemistry
Carbon-14	Carbon-14	14762755		% modern					Radiochemistry
Carbon-14 Counting Error	Carbon-14 Counting Error	0		% modern					Inorganics
Carbonate	Carbonate	3812326		ug/L	mg/Kg dw				Inorganics	Conventionals
Carbonate Alkalinity as CaCO3	Carbonate Alkalinity as CaCO3	471341		mg/L					Inorganics	Conventionals	WaterQualityMeasurements
Carbophenothion	Carbophenothion (Trithion)	786196		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides
Carboxin	Carboxin (6-methyl-N-phenyl-2,3-dihydro-1,4-oxathiine-5-carboxamide)	0		ug/L
Carfentrazone Ethyl	Carfentrazone Ethyl	128639021		ug/L					Organics	Pesticides
Cascade/Falls	Cascade/Falls	0	%						Habitat
Catellicoccus, Gull	Gull Catellicoccus	0		copies/100 mL	copies/g dw				Microbiological	Pathogens
Catellicoccus, Gull (Gull2)	Gull Catellicoccus marimammalium, Assay name: Gull2, 5'-TGCATCGACCTAAAGTTTTGAG-3', 5'-GTCAAAGAGCGAGCAGTTACTA-3'	0		copies/100 mL					Microbiological
Cattle Grazing Intensity	Cattle Grazing Intensity	0	none						Habitat
Cattle GrazingExtent	Cattle GrazingExtent	0	none						Habitat
Cattle GrazingProximity	Cattle GrazingProximity	0	none						Habitat
CBOD5	Carbonaceous Biological Oxygen Demand (CBOD) - 5 day test	0		mg/L					WaterQualityMeasurements	Conventionals
CD/DVD	CD/DVD	0	pieces						Debris	Trash	Plastics	Household
CDOM	Colored Dissolved Organic Matter	0		ug/L					Habitat
Cefotaxime	Cefotaxime	63527526		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Celestolide	Celestolide	0					ng/g ww	ng/g dw	Organics	Pesticides
Ceramic Pot/Shard	Ceramic Pot/Shard	0	pieces						Debris	Trash	Non-Plastics	Household
Cerium	Cerium	7440451		ug/L					Inorganics
Cesium	Cesium	7440462			mg/Kg dw		ug/g ww	ug/g dw	Inorganics	Metals
Cetirizine	Cetirizine	83881510		ng/L					Organics	PPCPs
Channel Constraining Feature	Channel Constraining Feature	0	none						Habitat
Channel Constraint	Channel Constraint	0	none						Habitat
Channel Engineered	Channel has been modified/engineered	0	none						Habitat	FieldObservations
Channel Grasses	Channel Grasses	0	%						Habitat
Channel Margin in Contact	Channel Margin in Contact	0	%						Habitat
Channel NonWoody Veg	Channel NonWoody Veg	0	%						Habitat
Channel Pattern	Channel Pattern	0	none						Habitat
Channel Unit	Channel Unit	0	none						Habitat
Channel Width Reach	Channel width used to define reach	0	m						Habitat
Channel Woody Veg	Channel Woody Veg	0	%						Habitat
Channelization	Channelization	0	none						Habitat
Chemical Group A	Total of (Aldrin,Dieldrin,Endrin,Heptachlor,Heptachlor Epoxide,Chlorine,HCH, Endosulfan,Toxaphene)	0					ug/Kg ww	ug/Kg dw	Organics	Pesticides
Chemical Treatment	Chemical Treatment	0	none						Habitat
Chicken/Duck, Mitochondrial DNA (cytb)	Chicken/Duck Mitochondrial DNA, Target gene: Cytochrome b, 5′-AAATCCCACCCCCTACTAAAAATAAT-3′, 5′-CAGATGAAGAAGAATGAGGCG-3′, 5′-FAM-ACAACTCCCTAATCGACCT-NFQ-MGB-3′	0		gc/mL					Microbiological	MST
Chloramben	Chloramben	133904		ug/L					Organics	Herbicides
Chlorantraniliprole	Chlorantraniliprole	500008457		ug/L					Organics	Pesticides	Insecticides
Chlorate	Chlorate	14866683		ug/L					Inorganics	Conventionals	Nutrients
Chlorbenside	Chlorbenside	0					ug/Kg ww	ug/Kg dw	Organics	Pesticides
Chlordane	Chlordane, not otherwise specified	57749		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs
Chlordane, cis-	cis-Chlordane (alpha-Chlordane)	5103719		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Chlordanes
Chlordane, cis-(Surrogate)	Surrogate: cis-Chlordane (alpha-Chlordane)	5103719			% recovery				Organics	Pesticides
Chlordane, Technical	Chlordane, mixture of many related chemicals, of which 10 are major components	12789036		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OCHs
Chlordane, Total	Total Chlordane, sum of cis-chlordane and trans-chlordane	0		ug/L	ug/g dw
Chlordane, trans-	trans-Chlordane (gamma-Chlordane)	5103742		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Chlordanes
Chlordane, trans-(Surrogate)	Surrogate: trans-Chlordane (gamma-Chlordane)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Chlordane-13C10, trans-(IsoDilAnalogue)	Isotope Dilution Analogue: trans-Chlordane-13C10 (gamma-Chlordane)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Chlordene	Chlordene	3734483		ug/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors
Chlordene Plus	Chlordene Plus (CP)	0			ng/g dw				Organics	FlameRetardants
Chlordene, cis-	cis-Chlordene (alpha-Chlordene)	56534022		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors
Chlordene, trans-	trans-Chlordene (gamma-Chlordene)	56641384		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors
Chlorfenapyr	Chlorfenapyr	122453730		ug/L					Organics	Pesticides
Chlorfenvinphos	Chlorfenvinphos	470906		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs
Chloride	Chloride	16887006		ug/L					Inorganics	Conventionals	Nutrients
Chlorimuron Ethyl	Chlorimuron Ethyl	90982324		ug/L					Organics	SVOCs
Chlorine, Free	Free Chlorine	0		mg/L					WaterQualityMeasurements	Ancillary
Chlorine, Total Residual	Total Residual Chlorine	0		mg/L					WaterQualityMeasurements
Chlorite	Chlorite	14998277		ug/L					Inorganics	Conventionals	Nutrients
Chlormefos	Chlormefos	0		% recovery
Chloro-2-methylphenol, 4-	4-Chloro-2-methylphenol	1570645		ug/L					Organics	Pesticides
Chloro-2-methylphenoxy) Butanoic Acid, 4-(4-	4-(4-Chloro-2-methylphenoxy) Butanoic Acid (MCPB)	94815		ug/L					Organics	SVOCs
Chloro-3-methylphenol, 4-	4-Chloro-3-methylphenol	59507		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	Chlorinated Phenols	Germicides
Chloroacetic Acid	Chloroacetic Acid (Monochloracetic Acid)(MCAA)	79118		ug/L					Organics	Haloacetic acids (HAAs)
Chloroaniline, 4-	4-Chloroaniline	106478		ug/L	ug/Kg dw				Organics	SVOCs
Chlorobenzene	Chlorobenzene	108907		ug/L					Organics	VOCs
Chlorobenzene-d5(Surrogate)	Surrogate: Chlorobenzene-d5	3114554		% recovery					Organics	VOCs
Chlorobenzilate	Chlorobenzilate	510156		ug/L					Organics	Pesticides
Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid, 11-	11-Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid (11Cl-PF3OUdS)	763051929		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Chloroethane	Chlorethane (Ethyl Chloride)	75003		ug/L					Organics	VOCs
Chloroethyl Vinyl Ether, 2-	2-Chloroethyl Vinyl Ether	110758		ug/L					Organics	VOCs
Chloroform	Chloroform	67663		ug/L					Organics	VOCs	Insecticides
Chlorohexadecafluoro-3-oxanonane-1-sulfonate, 9-	9-chlorohexadecafluoro-3-oxanonane-1-sulfonate (9Cl-PF3ONS)	1621485219			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid, 9-	9-Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid (9Cl-PF3ONS)	756426581		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Chloromethane	Chloromethane (Methyl Chloride)	74873		ug/L					Organics	VOCs
Chloro-N-(2,6-diethylphenyl) acetamide, 2-	2-chloro-N-(2,6-diethylphenyl) acetamide	6967299			ug/Kg dw				Organics	Pesticides
Chloronaphthalene, 2-	2-Chloronaphthalene	91587		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Chloroneb(Surrogate)	Surrogate: Chloroneb	2675776		% recovery					Organics	Pesticides	Pest-OCHs	Fungicides
Chlorophenol, 2-	2-Chlorophenol	95578		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	Chlorinated Phenols
Chlorophenol-d4, 2- (Surrogate)	2-Chlorophenol-d4 (Surrogate)	93951736		% recovery
Chlorophenyl Phenyl Ether, 4-	4-Chlorophenyl Phenyl Ether	7005723		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Chlorophenyl)-N'-methylurea, N-(4-	N-(4-Chlorophenyl)-N'-methylurea	5352885		ug/L					Organics	Herbicides
Chlorophyll a	Chlorophyll a	479618		ug/L					Inorganics	Conventionals	Benthic	WaterQualityMeasurements
Chlorophyll a & b	Chlorophyll a & b	0		ug/L					Inorganics	Conventionals
Chlorophyll b	Chlorophyll b	0		ug/L					Inorganics	Conventionals
Chlorophyll, Total	Total Chlorophyll	0		ug/L					WaterQualityMeasurements
ChlorophyllSampleVolume	Volume of material and liquid filtered to produce the chlorophyll a sample	0		mL					Habitat
Chloropicrin	Chloropicrin	0		ug/L					Organics	Pesticides
Chlorothalonil	Chlorothalonil	1897456		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs	Algaecides	Fungicides	Nematocides
Chlorotoluene, 2-	2-Chlorotoluene	95498		ug/L					Organics	VOCs
Chlorotoluene, 4-	4-Chlorotoluene	106434		ug/L					Organics	VOCs
Chloroxuron	Chloroxuron (Chloroxyfenidim) (Norex)	1982474		ug/L					Organics	Herbicides
Chloroxuron(Surrogate)	Surrogate: Chloroxuron (Chloroxyfenidim) (Norex)	0		% recovery	% recovery				Organics	Pesticides	Herbicides
Chlorpropham	Chlorpropham	101213		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Chlorpyrifos	Chlorpyrifos	2921882		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OPs	Insecticides
Chlorpyrifos Methyl	Chlorpyrifos Methyl	5598130		ug/L	ng/g dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Chlorpyrifos Methyl(Surrogate)	Surrogate: Chlorpyrifos Methyl	5598130		% recovery					Organics	Pesticides	Pest-OPs	Insecticides
Chlorpyrifos Methyl/Fenchlorphos	Chlorpyrifos Methyl/Fenchlorphos	0			ng/g dw				Organics	Pesticides
Chlorpyrifos Oxon	Chlorpyrifos Oxon	5598152		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	OrganophosphatePest.	Insecticides
Chlortetracycline	Chlortetracycline	57625		ug/L					Organics	PPCPs
Chlorzoxazone	Chlorzoxazone	95250			ug/Kg dw
Cholesterol	Cholesterol	57885			ug/Kg dw				Organics
Chromium	Chromium	7440473		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Chromium III	Chromium III (Trivalent Chromium)	16065831		ug/L					Metals
Chromium VI	Chromium VI	18540299		ug/L	ug/Kg dw				Metals
Chrysene	Chrysene	218019		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Chrysene/Triphenylene	Chrysene/Triphenylene (CAS #EDF-359)	0			ng/g dw				Organics	PAHs
Chrysene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Chrysene-d12	1719035		% recovery					Organics	PAHs	IDA
Chrysene-d12(Surrogate)	Surrogate: Chrysene-d12	1719035		ug/L	ug/Kg dw		% recovery	% recovery	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Chrysenes, C1-	C1-Chrysenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Chrysenes, C2-	C2-Chrysenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Chrysenes, C3-	C3-Chrysenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Chrysenes, C4-	C4-Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Cigarette Box/Wrapper	Cigarette Box/Wrapper	0	pieces						Debris	Trash	Plastics	Miscellaneous
Cigarette Butt	Cigarette Butt	0	pieces						Debris	Trash	Plastics	Toxic
Cimetidine	Cimetidine	51481619		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Cimetidine-d3(Surrogate)	Surrogate: Cimetidine-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Cinerin-1	Cinerin-1	25402066		ug/L	ng/g dw				Organics	Pesticides	Pyrethroids
Cinerin-2	Cinerin-2 (Cinerin II)	121200		ug/L	ng/g dw				Organics	Pesticides	Pyrethroids
Ciodrin	Ciodrin (Crotoxyphos)	7700176		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides
Ciprofloxacin	Ciprofloxacin	85721331		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Ciprofloxacin-13C3-N15(Surrogate)	Surrogate: Ciprofloxacin-13C3-N15	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Circumference	Circumference	0	m						Habitat
Clarithromycin	Clarithromycin	81103119		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Clay	Clay	0		mg/L	% ww				Inorganics	Conventionals	GrainSize
Clinafloxacin	Clinafloxacin	105956998		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Clomazone	Clomazone (Dimethazone)	81777891		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides
Clonidine	Clonidine	4205907		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Clonidine-d4(Surrogate)	Surrogate: Clonidine-d4	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Clostridiales, Human (LACHNO3)	Human Clostridiales, Assay Name: LACHNO3	0		copies/100mL
Clothianidin	Clothianidin	210880925		ug/L	ng/g dw				Pesticides
Clothianidin-d3(Surrogate)	Surrogate: Clothianidin-d3	0		% recovery	% recovery				Organics	Pesticides
Clothing, synthetic fabric	Clothing, synthetic fabric	0	pieces						Debris	Trash	Plastics	Household
CloudCover	Cloud cover at the time of sampling	0	%						Habitat
Cloxacillin	Cloxacillin	61723		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Cobalt	Cobalt	7440484		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals
Cocaine	Cocaine	50362		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Cocaine-d3(Surrogate)	Surrogate: Cocaine-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
COD	Chemical Oxygen Demand (COD)	0		mg/L					Inorganics	Conventionals
Codeine	Codeine	76573		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Codeine-d6(Surrogate)	Surrogate: Codeine-d6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Coliform, Fecal	Fecal Coliform	0		MPN/100 mL	MPN/g dw		MPN/g ww	MPN/g dw	Microbiological	Pathogens	Conventionals
Coliform, Total	Total Coliform	0		MPN/100 mL	MPN/g dw		MPN/g ww	MPN/g dw	Microbiological	Pathogens	Conventionals
Colloid	Colloid	0			%
CollSub_PlantDead	Algae collected from dead plant (including wood) substratum	0	none						Habitat
CollSub_PlantLive	Algae collected from live plant (including wood) substratum	0	none						Habitat
CollSub_Rock	Algae collected from rock (including concrete and consolidated sediment) substratum	0	none						Habitat
CollSub_SedSoft	Algae collected from soft sediment substratum	0	none						Habitat
Color	Color	0		none	none				FieldObservations	Habitat
Color, True	Color of water from which turbidity has been removed	0		CU					Inorganics	Conventionals
Commercial	Commercial	0	none						Habitat
Composition	Composition	0			none				FieldObservations	Habitat
Computer	Computer	0	pieces						Debris	Trash	Plastics	Non-Plastics	Toxic	Large
Concrete/Asphalt	Concrete/Asphalt	0	pieces						Debris	Trash	Non-Plastics	Construction
Condom	Condom	0	pieces						Debris	Trash	Plastics
Construction	Construction	0	none						Habitat
Construction Debris	Construction debris such as brick, wood, sheetrock using Trash Protocol	0	pieces						Trash
Construction Other	Construction Other	0	pieces						Debris	Trash	Non-Plastics	Construction
Construction Wood/Pellets	Construction Wood/Pellets	0	pieces						Debris	Trash	Non-Plastics	Large
Container, Chemical	Container, Chemical	0	pieces						Debris	Trash	Plastics	Toxic
Container, Juice	Container, Juice	0	pieces						Debris	Trash	Plastics	FoodService
Container, Plastic	Container, Plastic	0	pieces						Debris	Trash	Plastics
Container, Storage	Container, Storage	0	pieces						Debris	Trash	Plastics	Household
Container, Styrofoam	Container, Styrofoam	0	pieces						Debris	Trash	Plastics	FoodService
Copper	Copper	7440508		ug/L	umol/g dw		ug/L	ug/L	Inorganics	TraceElements	Metals
Coprostanol, beta-3-	3-beta-Coprostanol	360689			ug/Kg dw				Organics
Coronene	Coronene	0		RPD	ug/Kg dw				Organics	PAHs
Cotinine	Cotinine	486566		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Cotinine-d3(Surrogate)	Surrogate: Cotinine-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Cotton fiber	When cotton is obviously the top hit and cellulose is several hits down. Then we can say it is specifically Cotton. For DYED or CLEAR anthropogenic cotton only and should just be called cotton.	0							Microdebris	Anthropogenic	Natural Based	Fiber
Coumaphos	Coumaphos	56724		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
CPOM	Coarse particulate organic matter	0	none						Habitat
Cropland	Cropland	0	none						Habitat
Crops Irrigated Extent	Crops Irrigated Extent	0	none						Habitat
Crops Irrigated Intensity	Crops Irrigated Intensity	0	none						Habitat
Crops Irrigated Proximity	Crops Irrigated Proximity	0	none						Habitat
Crops NonIrrigated Extent	Crops NonIrrigated Extent	0	none						Habitat
Crops NonIrrigated Intensity	Crops NonIrrigated Intensity	0	none						Habitat
Crops NonIrrigated Proximity	Crops NonIrrigated Proximity	0	none						Habitat
Cryptosporidium	Cryptosporidium	0		oocysts/L					Microbiological	Pathogens	Conventionals
Cryptosporidium Oocysts Fluorescence	Cryptosporidium Oocysts Fluorescence	0		oocysts/L					Microbiological	Pathogens
Cryptosporidium Oocysts/Amorphous Structure	Cryptosporidium Oocysts/Amorphous Structure	0		oocysts/L					Microbiological	Pathogens
Cryptosporidium Oocysts/DAPI & DIC Positive	Cryptosporidium Oocysts/DAPI & DIC Positive	0		oocysts/L					Microbiological	Pathogens
Cryptosporidium Oocysts/Empty	Cryptosporidium Oocysts/Empty	0		oocysts/L					Microbiological	Pathogens
Cryptosporidium Oocysts/Flourescence Antibody	Cryptosporidium Oocysts/Flourescence Antibody	0		oocysts/L					Microbiological	Pathogens
Cryptosporidium Oocysts/Internal Structure	Cryptosporidium Oocysts/Internal Structure	0		IFA+/100L					Microbiological	Pathogens
Cryptosporidium Oocysts/Internal Structure (One)	Cryptosporidium Oocysts/Internal Structure (One)	0		oocysts/L					Microbiological	Pathogens
Cryptosporidium Oocysts/Negative	Cryptosporidium Oocysts/Negative	0		oocysts/L					Microbiological	Pathogens
Cryptosporidium Oocysts/Positive	Cryptosporidium Oocysts/Positive	0		oocysts/L					Microbiological	Pathogens
Cryptosporidium Oocysts/Positive (Internal Staining)	Cryptosporidium Oocysts/Positive (Internal Staining)	0		oocysts/L					Microbiological	Pathogens
Cryptosporidium Oocysts/Positive (Stained Nuclei)	Cryptosporidium Oocysts/Positive (Stained Nuclei)	0		oocysts/L					Microbiological	Pathogens
Cryptosporidium Oocysts/Total IFA Count	Cryptosporidium Oocysts/Total IFA Count	0		IFA+/100L					Microbiological	Pathogens
Cumylphenol, 4-	4-Cumylphenol	599644			ug/Kg dw				Organics	Phenols
Cup	Cup	0	pieces						Debris	Trash	Plastics	FoodService
Cup, Styrofoam	Cup, Styrofoam	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Cup, Waxed Paper	Cup, Waxed Paper	0	pieces						Debris	Trash	Plastics	Non-Plastics	FoodService
Cup/Plate, Plastic	Cups/plates, Plastic	0	pieces						Debris	Trash	Plastics
Cup/Plate, Polystryene Foam	Cup/plate, Polystyrene Foam, e.g., Styrofoam	0	pieces						Debris	Trash	Plastics
Cup/Plate, Waxed Paper	Cup/plate, Waxed Paper	0	pieces						Debris	Trash	Non-Plastics
Cyanazine	Cyanazine	21725462		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	Pest-Triazines	Herbicides
Cyanide	Cyanide	57125		ug/L	mg/Kg dw				Inorganics	Conventionals
Cyanobacteria	Potentially toxigenic (PTOX) genera of cyanobacteria	0		none
CyanotoxinSampleVolume	Volume of material and liquid in Cyanotoxin sample	0		mL					Habitat
Cyantraniliprole	Cyantraniliprole	736994631		ng/L					Organics	Pesticides	Insecticides
Cyazofamid	Cyazofamid	120116883		ng/L					Organics	Pesticides	Fungicides
Cycloate	Cycloate	1134232		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates
Cyclohexyl-2-Benzothiazol-Amine, N-	N-Cyclohexyl-2-Benzothiazol-Amine (N-Cyclohexyl-1,3-Benzothiazol-2-Amine) (NCBA)	28291750		ng/L					Organics	Benzotriazoles and Benzothiazoles
Cyfluthrin, beta-	beta-Cyfluthrin	1820573270		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyfluthrin, gamma-	gamma-Cyfluthrin	76703623			ng/g dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyfluthrin, total	Total Cyfluthrin	68359375		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyfluthrin-1	Cyfluthrin peak 1	68359375		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyfluthrin-2	Cyfluthrin peak 2	68359375		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyfluthrin-3	Cyfluthrin peak 3	68359375		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyfluthrin-4	Cyfluthrin peak 4	68359375		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyhalofop-butyl	Cyhalofop-butyl	122008859		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides
Cyhalothrin	Cyhalothrin	68085858		ng/L	ug/Kg ww				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyhalothrin, gamma-	gamma-Cyhalothrin	76703623		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyhalothrin, lambda-1	lambda-Cyhalothrin, peak 1 or Warrior-1	91465086		ug/L	ug/Kg ww				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyhalothrin, lambda-2	lambda-Cyhalothrin, peak 2 or Warrior-2	91465086		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyhalothrin, Total	Total Cyhalothrin	68085858		ng/L	ng/g dw
Cyhalothrin, Total lambda-	Total lambda-Cyhalothrin, sum peaks 1 & 2	91465086		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyhalothrin-d6, Total lambda-(Surrogate)	Surrogate: Total lambda-Cyhalothrin-d6	0		% recovery					Organics	Pesticides
Cylindrospermopsin	Cylindrospermopsin	0		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Cymene, p-	p-Cymene	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	VOCs
Cymoxanil	Cymoxanil	57966957		ng/L					Organics	Pesticides	Fungicides
Cypermethrin, Total	Total Cypermethrin, sum peaks 1,2,3 & 4	52315078		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cypermethrin-1	Cypermethrin peak 1	67375308		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cypermethrin-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Cypermethrin-13C6	0			% recovery				Organics	Pesticides	Instecticides	Pyrethroids	IDA
Cypermethrin-13C6(Surrogate)	Surrogate: Cypermethrin-13C6	0		% recovery					Organics	Pesticides	Insecticides	Pyrethroids
Cypermethrin-2	Cypermethrin peak 2	65731842		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cypermethrin-3	Cypermethrin peak 3	67375308		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cypermethrin-4	Cypermethrin peak 4	52315078		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyproconazole	Cyproconazole	94361065		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Cyprodinil	Cyprodinil	121552612		ug/L	ug/Kg dw				Organics	Pesticides	Fungicides
d13C_VPDB	Delta 13C, relative to Vienna Pee Dee Belemnite	0					per mil	per mil	Organics	IsotopicSignature
d15N_Air-N2	Delta 15N, relative to Atmospheric Nitrogen	0					per mil	per mil	Organics	IsotopicSignature
d34S_VCDT	Delta 34S, relative to Vienna Canyon Diablo Troilite	0					per mil	per mil	Organics	IsotopicSignature
Dacthal	Dacthal	1861321		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs
Dairies Extent	Dairies Extent	0	none						Habitat
Dairies Intensity	Dairies Intensity	0	none						Habitat
Dairies Proximity	Dairies Proximity	0	none						Habitat
Dam Extent	Dam Extent	0	none						Habitat
Dam Intensity	Dam Intensity	0	none						Habitat
Dam Proximity	Dam Proximity	0	none						Habitat
Dams	Dams	0	none						Habitat
DBCE(Surrogate)	Surrogate: Dibutylchlorendate	1770805		ug/L	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs
DCBP(p,p')	p,p'-Dichlorobenzophenone (DCBP)	90982			ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs
DDD(o,p')	o,p'-DDD	53190		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDD(o,p')(Surrogate)	Surrogate: o,p'-DDD	53190		% recovery	% recovery				Organics	Pesticides	OrganochlorinePesticides	Semi-VOAs	Insecticides	DDTs
DDD(o,p')/PCB 118	o,p'-DDD/PCB 118	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides/PCBs
DDD(p,p')	p,p'-DDD	72548		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDD(p,p')(Surrogate)	Surrogate: p,p'-DDD	72548		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDD-13C(p,p')(Surrogate)	Surrogate: p,p'-DDD-C13	0		% recovery					Organics	Pesticides
DDD-13C12(o,p')(IsoDilAnalogue)	Isotope Dilution Analogue: o,p'-DDD-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
DDD-13C12(p,p')(IsoDilAnalogue)	Isotope Dilution Analogue: p,p'-DDD-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
DDD-d8(p,p')(Surrogate)	Surrogate: p,p'-DDD-d8	0					% recovery	% recovery	Organics	Pesticides
DDE(o,p')	o,p'-DDE	3424826		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDE(o,p')(Surrogate)	Surrogate: o,p'-DDE	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
DDE(p,p')	p,p'-DDE	72559		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDE(p,p')(Surrogate)	Surrogate: p,p'-DDE	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
DDE(p,p')/PCB 087	p,p'-DDE/PCB 087	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides/PCBs
DDE-13C12(o,p')(IsoDilAnalogue)	Isotope Dilution Analogue: o,p'-DDE-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
DDE-13C12(p,p')(IsoDilAnalogue)	Isotope Dilution Analogue: p,p'-DDE-13C12	201612502		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
DDMS(p,p')	p,p'-DDMS	0			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides
DDMU(p,p')	p,p'-DDMU	1022226		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDT(o,p')	o,p'-DDT	789026		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDT(o,p')(Surrogate)	Surrogate: o,p'-DDT	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
DDT(p,p')	p,p'-DDT	50293		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDT(p,p')(Surrogate)	Surrogate: p,p'-DDT	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
DDT(p,p')/PCB 187	p,p'-DDT/PCB 187	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides/PCBs
DDT-13C12(o,p')(IsoDilAnalogue)	Isotope Dilution Analogue: o,p'-DDT-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
DDT-13C12(p,p')(IsoDilAnalogue)	Isotope Dilution Analogue: p,p'-DDT-13C12	104215841		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Dead Domestic Animals	Dead Domestic Animals	0	pieces						Debris	Trash	Non-Plastics	Marine Origin
Debris Lines/Silt-Laden Vegetation Extent	Debris Lines/Silt-Laden Vegetation Extent	0	none						Habitat
Debris Lines/Silt-Laden Vegetation Intensity	Debris Lines/Silt-Laden Vegetation Intensity	0	none						Habitat
Debris Lines/Silt-Laden Vegetation Proximity	Debris Lines/Silt-Laden Vegetation Proximity	0	none						Habitat
DebrisLandUse_Commercial	DebrisLandUse_Commercial	0	none						Habitat	Debris
DebrisLandUse_Industrial	DebrisLandUse_Industrial	0	none						Habitat	Debris
DebrisLandUse_LimitedTimeParking	DebrisLandUse_LimitedTimeParking	0	none						Habitat	Debris
DebrisLandUse_OpenSpace	DebrisLandUse_OpenSpace	0	none						Habitat	Debris
DebrisLandUse_Park	DebrisLandUse_Park	0	none						Habitat	Debris
DebrisLandUse_ParkingLot	DebrisLandUse_ParkingLot	0	none						Habitat	Debris
DebrisLandUse_Residential	DebrisLandUse_Residential	0	none						Habitat	Debris
Decabromodiphenylethane	Decabromodiphenylethane (DBDPE)	84852539			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
Decabromodiphenylethane-13C14(IsoDilAnalogue)	Isotope Dilution Analogue: Decabromodiphenylethane-13C14 (DBDPE-13C14)	0					% recovery	% recovery	Organics	FlameRetardants	IDA
Decachlorobiphenyl(Surrogate)	Surrogate: Decachlorobiphenyl	2051243		ug/L	mg/Kg dw		% recovery	% recovery	Organics	PCBs
Decafluorobiphenyl(Surrogate)	Surrogate: Decafluorobiphenyl	434902		% recovery	% recovery				Organics	PAHs	SVOCs
Decalin	Decalin	91178					ng/g ww	ng/g dw	Organics	VOCs
Decalin, C1-	C1-Decalin	0					ng/g ww	ng/g dw	Organics	VOCs
Decalin, C2-	C2-Decalin	0					ng/g ww	ng/g dw	Organics	VOCs
Decalin, C3-	C3-Decalin	0					ng/g ww	ng/g dw	Organics	VOCs
Decalin, C4-	C4-Decalin	0					ng/g ww	ng/g dw	Organics	VOCs
Decamethylcyclopentasiloxane	Decamethylcyclopentasiloxane	541026			ug/Kg dw
Decane, 2-phenyl-	2-Phenyl-decane	0			ng/g dw				Organics	VOCs
Decane, 3-phenyl-	3-Phenyl-decane	0			ng/g dw				Organics	VOCs
Decane, 4-phenyl-	4-Phenyl-decane	0			ng/g dw				Organics	VOCs
Decane, 5-phenyl-	5-Phenyl-decane	0			ng/g dw				Organics	VOCs
Decane, n-	n-Decane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes
Dechlorane 601	Dechlorane 601	0			ng/g dw				Organics	FlameRetardants
Dechlorane 602	Dechlorane 602	31107445			ng/g dw				Organics	FlameRetardants
Dechlorane 603	Dechlorane 603	0			ng/g dw				Organics	FlameRetardants
Dechlorane 604	Dechlorane 604	0			ng/g dw				Organics	FlameRetardants
Dechlorane 604 Component B	Dechlorane 604 Component B	0			ng/g dw				Organics	FlameRetardants
Dechlorane Plus Mono Adduct	Dechlorane Plus Mono Adduct (DPMA)	0			ng/g dw				Organics	FlameRetardants
Dechlorane Plus, anti-	anti-Dechlorane Plus (anti-DP)	135821748			ng/g dw				Organics	FlameRetardants
Dechlorane Plus, syn-	syn-Dechlorane Plus (syn-DP)	135821033			ng/g dw				Organics	FlameRetardants
Dehydronifedipine	Dehydronifedipine	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Deisopropyl-Atrazine	Deisopropyl-Atrazine	1007289		ug/L					Organics	Triazines
Delta 13C	Delta 13C	0					ppt	ppt	Organics	Statistic
Delta 15N	Delta 15N	0					ppt	ppt	Organics	Statistic
Delta 15N - baseline corrected	Delta 15N - baseline corrected	0					ppt	ppt	Organics	Statistic
Deltamethrin	Deltamethrin	52918635		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Pyrethroids	Insecticides
Deltamethrin/Tralomethrin	Deltamethrin/Tralomethrin	0		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Pyrethroids	Insecticides
Deltamethrin-d6, Total(Surrogate)	Surrogate: Total Deltamethrin-d6	0		% recovery	% recovery
Demeton, Total	Total Demeton	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Ops
Demeton-O	Demeton-O	298033		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides
Demeton-s	Demeton-s	126750		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Density	Density of Sample	0		sigma-t					Habitat
Deposits	Deposits	0	none						Habitat
Desethyl-Atrazine	Desethyl-Atrazine	6190654		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	Pest-Triazines
Desethyl-desisopropyl-atrazine	Desethyl-desisopropyl-atrazine	3397624		ug/L					Organics	Pesticides	Pest-Triazines
Desisopropyl-Atrazine	Desisopropyl-Atrazine	1007289		ug/L					Organics	Pesticides	Pest-Triazines
Desmethyldiltiazem	Desmethyldiltiazem	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Desmethyl-LR	Desmethyl-LR	120011667		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Desmethyl-RR	Desmethyl-RR	0		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Desmetryn	Desmetryn	1014693		ug/L					Organics	Pesticides	Pest-Triazines
Desthio-prothioconazole	Desthio-prothioconazole	120983644		ng/L					Organics	Pesticides	Fungicides
Detergent	Detergent	0		mg/L					FieldObservations
Deuterium/Hydrogen Ratio	Deuterium/Hydrogen Ratio	7782390		per mil					Isotopes
Di(2-ethylhexyl) phosphate	Di(2-ethylhexyl) phosphate (DEHP)	298077			ng/g dw				Organics	FlameRetardants
Diaminochlorotriazine (DACT)	Diaminochlorotriazine (DACT)	0		ug/L					Organics	Pesticides
Diazepam	Diazepam	439145		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Diazepam-d5(Surrogate)	Surrogate: Diazepam-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Diazinon	Diazinon	333415		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OPs
Diazinon oxon	Diazinon oxon	0		ng/L					Organics	Pesticides
Diazinon(Surrogate)	Surrogate: Diazinon	0		% recovery					Organics	Pesticides	OrganophosphatePest.	OrganochlorinePesticides
Diazinon-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Diazinon-d10	100155473					% recovery	% recovery	Organics	Pest-OPs	IDA
Diazinon-d10(Surrogate)	Surrogate: Diazinon-d10	100155473		% recovery	% recovery				Organics	SVOC	Insecticide
Diazoxon	Diazoxon	962583		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	OrganophosphatePest.	OrganochlorinePesticides
Dibenz(a,h)anthracene	Dibenz(a,h)anthracene	53703		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH
Dibenz(a,h)anthracene, C1-	C1-Dibenz(a,h)anthracene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs
Dibenz(a,h)anthracene, C2-	C2-Dibenz(a,h)anthracene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs
Dibenz(a,h)anthracene, C3-	C3-Dibenz(a,h)anthracene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs
Dibenz(a,h)anthracene-d14(IsoDilAnalogue)	Isotope Dilution Analogue: Dibenz(a,h)anthracene-d14	13250981		% recovery					Organics	PAHs	IDA
Dibenz(a,h)anthracene-d14(Surrogate)	Surrogate: Dibenz(a,h)anthracene-d14	13250981		% recovery	% recovery		% recovery	% recovery	Organics	PAHs
Dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene	Dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene	0			ng/g dw
Dibenzofuran	Dibenzofuran	132649		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Insecticides
Dibenzothiophene	Dibenzothiophene	132650		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs
Dibenzothiophene-d8(IsoDilAnalogue)	Isotope Dilution Analogue: Dibenzothiophene-d8	33262292		% recovery					Organics	PAHs	IDA
Dibenzothiophene-d8(Surrogate)	Surrogate: Dibenzothiophene-d8	33262292		% recovery	% recovery		% recovery	% recovery	Organics	PAHs	SVOCs
Dibenzothiophenes, C1-	C1-Dibenzothiophenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs
Dibenzothiophenes, C2-	C2-Dibenzothiophenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs
Dibenzothiophenes, C3-	C3-Dibenzothiophenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs
Dibenzothiophenes, C4-	C4-Dibenzothiophenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Alkylated PAHs
Dibromo-2,3-dichlorophenyl-hexachloro-norbornene, 4,6-	4,6-Dibromo-2,3-dichlorophenyl-hexachloro-norbornene (Br2Cl2-DEC604)	0			ng/g dw				Organics	FlameRetardants
Dibromo-3-Chloropropane, 1,2-	1,2-Dibromo-3-Chloropropane (DBCP)	96128		ug/L					Organics	VOCs
Dibromo-4-(1,2-dibromoethyl)cyclohexane, alpha-1,2-	alpha-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (alpha-DBE-DBCH)	3322938			ng/g dw				Organics	FlameRetardants
Dibromo-4-(1,2-dibromoethyl)cyclohexane, beta-1,2-	beta-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (beta-DBE-DBCH)	3322938			ng/g dw				Organics	FlameRetardants
Dibromo-4-(1,2-dibromoethyl)cyclohexane, gamma-1,2-	gamma-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (gamma-DBE-DBCH)	3322938			ng/g dw				Organics	FlameRetardants
Dibromo-4-hydroxybenzonitrile, 3,5-	3,5-Dibromo-4-hydroxybenzonitrile (Bromoxynil)	1689845		ug/L					Organics	SVOCs
Dibromoacetic Acid	Dibromoacetic Acid (DBAA)	631641		ug/L					Organics	Haloacetic acids (HAAs)
Dibromoaldrin	Dibromoaldrin (DBALD)	0			ng/g dw				Organics	FlameRetardants
Dibromochloromethane	Dibromochloromethane	124481		ug/L					Organics	VOCs
Dibromoethane, 1,2-	1,2-Dibromoethane	106934		ug/L					Organics	VOCs	Insecticides
Dibromofluoromethane	Dibromofluoromethane	1868537		ug/L					Organics	VOCs
Dibromofluoromethane(Surrogate)	Surrogate: Dibromofluoromethane	186857		% recovery					Organics	VOCs
Dibromomethane	Dibromomethane	74953		ug/L					Organics	VOCs
Dibromooctafluorobiphenyl(Surrogate)	Surrogate: Dibromooctafluorobiphenyl	10386842			% recovery		% recovery	% recovery	Organics	Pesticides	OrganochlorinePesticides
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)	Surrogate: 4,4'-Dibromooctafluorobiphenyl (DBOFB)	10386842		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)DB-608	Surrogate: 4,4’-Dibromooctafluorobiphenyl run on column DB-608	10386842		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)HP-5	Surrogate: 4,4’-Dibromooctafluorobiphenyl run on column HP-5	10386842		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)	Surrogate: 4-4' Dibromooctafluorobiphenyl (DBOFB)	10386800		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)DB-608	Surrogate: 4,4’-dibromooctafluorobiphenyl run on column DB-608	10386800		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)HP-5	Surrogate: 4,4’-dibromooctafluorobiphenyl run on column HP-5	10386800		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs
Dibromophenyl-hexachloro-norbornene	Dibromophenyl-hexachloro-norbornene (Br2-DEC604)	0			ng/g dw				Organics	FlameRetardants
Dibromopropane, 1,2-(Surrogate)	Surrogate: 1,2-Dibromopropane	78751		% recovery					Organics
Dibutyl phosphate	Dibutyl phosphate (DBP)	107664			ng/g dw				Organics	FlameRetardants
Dibutylchlorendate	Dibutylchlorendate	0					% recovery	% recovery	Organics	Pesticides
Dibutylchlorendate(Surrogate)	Surrogate: Dibutylchlorendate (DBCE)	1770805		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-Pyrethroids
Dibutyltin as Sn	Dibutyltin as Sn (DBT)	1191486		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Organotins	Biocide
Dicamba	Dicamba (2,5-Dichloro-6-methoxybenzoic Acid)	1918009		ug/L	ug/kg				Organics	Herbicides
Dichlofenthion	Dichlofenthion	97176		ug/L	ng/g dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides
Dichlofenthion(Surrogate)	Surrogate: Dichlofenthion	97176		% recovery	% recovery				Organics	Pesticides
Dichlone	Dichlone	117806		ug/L					Organics	Pesticides	Fungicides
Dichloran	Dichloran (Botran) (Benzenamine, 2,6-dichloro-4-nitro-)	99309		ug/L	ug/Kg ww				Pyrethroid Pesticides
Dichloro-2 butene, cis 1,4-	Cis-1,4-dichloro-2 butene	0		ug/L					Organics
Dichloro-2 butene, trans 1,4-	Trans-1,4-dichloro-2 butene	110576		ug/L
Dichloroacetate(Surrogate)	Surrogate: Dichloroacetate	13425804		% recovery					Organics	Acids
Dichloroacetic Acid	Dichloroacetic Acid (DCAA)	79436		ug/L					Organics	Haloacetic acids (HAAs)
Dichloroaniline, 3,4-	3,4-Dichloroaniline	0		ug/L
Dichloroaniline, 3,5-	3,5-Dichloroaniline	626437		ng/L	ug/Kg dw				Organics	Pesticides
Dichlorobenzenamine, 3,4-	3,4-Dichlorobenzenamine (3,4-DCA)	95761		ug/L	ug/Kg dw				Pesticides
Dichlorobenzene, 1,2-	1,2-Dichlorobenzene	95501		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs	SVOCs	Herbicides
Dichlorobenzene, 1,3-	1,3-Dichlorobenzene	541731		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs	SVOCs	Insecticides
Dichlorobenzene, 1,4-	1,4-Dichlorobenzene	106467		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs	SVOCs	Insecticides
Dichlorobenzene-13C6,1,4-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,4-Dichlorobenzene-13C6	201595597			% recovery		% recovery	% recovery
Dichlorobenzene-d4, 1,2-(Surrogate)	Surrogate: 1,2-Dichlorobenzene-d4	2199691		ug/L					Organics	VOCs
Dichlorobenzene-d4, 1,4-(Surrogate)	Surrogate: 1,4-Dichlorobenzene-d4	3855821		% recovery	% recovery		% recovery	% recovery	Organics	VOCs	SVOCs	Insecticides
Dichlorobenzidine, 3,3'-	3,3'-Dichlorobenzidine	91941		ug/L	ug/Kg dw				Organics	Semi-VOAs
Dichlorobenzoic Acid, 3,5-	3,5-Dichlorobenzoic Acid	51365		ug/L					Organics	VOCs
Dichlorobenzonitrile, 2,6-	2,6-Dichlorobenzonitrile (Dichlobenil)	1194656		ug/L					Organics	Pesticides	Herbicides
Dichlorobenzophenone(p,p')	p,p'-Dichlorobenzophenone	0					ug/Kg ww	ug/Kg dw	Organics	Pesticides
Dichlorodifluoromethane	Dichlorodifluoromethane	75718		ug/L					Organics	VOCs
Dichloroethane, 1,1-	1,1-Dichloroethane	75343		ug/L					Organics	VOCs
Dichloroethane, 1,2-	1,2-Dichloroethane	107062		ug/L					Organics	VOCs		Insecticides
Dichloroethane-d4, 1,2-(Surrogate)	Surrogate: 1,2-Dichloroethane-d4	17060070		ug/L					Organics	VOCs
Dichloroethylene, 1,1-	1,1-Dichloroethylene (1,1-Dichloroethene)	75354		ug/L					Organics	VOCs
Dichloroethylene, cis 1,2-	cis-1,2-Dichloroethylene (cis-1,2-Dichloroethene)	156592		ug/L					Organics	VOCs
Dichloroethylene, Total 1,2-	Total 1,2-Dichloroethylene	0		ug/L					Organics	VOCs
Dichloroethylene, trans 1,2-	trans-1,2-Dichloroethylene (trans-1,2-Dichloroethene)	156605		ug/L					Organics	VOCs
Dichlorophenol, 2,4-	2,4-Dichlorophenol	120832		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	Chlorinated Phenols
Dichlorophenol, 2,6-	2,6-Dichlorophenol	87650		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	Chlorinated Phenols
Dichlorophenoxyacetic Acid, 2,3-(Surrogate)	Surrogate: 2,3-Dichlorophenoxyacetic Acid (2,3-D)	2976741		% recovery					Organics	VOCs
Dichlorophenoxyacetic Acid, 2,4-	2,4-Dichlorophenoxyacetic Acid (2,4-D)	94757		ug/L	ug/Kg dw				Organics	Herbicides
Dichlorophenoxyacetic Acid, 2,4-(Surrogate)	Surrogate: 2,4-Dichlorophenoxyacetic Acid (2,4-D)	94757		ug/L					Organics	VOCs
Dichlorophenoxybutyric Acid Methyl Ester, 2,4-	2,4-Dichlorophenoxybutyric Acid Methyl Ester (2,4-DB Methyl Ester)	0		ug/L					Organics	Herbicides
Dichlorophenoxybutyric Acid, 2,4-	2,4-Dichlorophenoxybutyric Acid (2,4-DB)	94826		ug/L	ug/kg				Organics	Herbicides
Dichlorophenyl Urea, 3,4-	3,4-Dichlorophenyl Urea (DCPU)	2327028		ug/L					Pesticides
Dichlorophenyl-3-methyl Urea, 3,4-	3,4-Dichlorophenyl-3-methyl Urea (DCPMU)	3567622		ug/L					Pesticides
Dichlorophenylacetic Acid, 2,4-	2,4-Dichlorophenylacetic Acid	19719289		% recovery					Organics	Herbicides
Dichlorophenylacetic Acid, 2,4- (Surrogate)	Surrogate: 2,4-Dichlorophenylacetic Acid	19719289		ug/L	% recovery				Organics	Herbicides
Dichloroprop	Dichlorprop (2-(2,4-Dichlorophenoxy)propanoic Acid)	120365		ug/L	ug/kg				Organics	Herbicides
Dichloropropane, 1,2-	1,2-Dichloropropane	78875		ug/L					Organics	VOCs	Insecticides	Nematocides
Dichloropropane, 1,3-	1,3-Dichloropropane	142289		ug/L					Organics	VOCs
Dichloropropane, 2,2-	2,2-Dichloropropane	594207		ug/L					Organics	VOCs
Dichloropropene, 1,1-	1,1-Dichloropropene	563586		ug/L					Organics	VOCs
Dichloropropene, 1,3-	1,3-Dichloropropene	0		ug/L	ng/g dw
Dichloropropene, cis 1,3-	cis-1,3-Dichloropropene	10061015		ug/L					Organics	VOCs
Dichloropropene, Total 1,3-	Total 1,3-Dichloropropene	0		ug/L					Organics	VOCs
Dichloropropene, trans 1,3-	trans-1,3-Dichloropropene	10061026		ug/L					Organics	VOCs
Dichloropropionic Acid, 2,2-	2,2-Dichloropropionic Acid (Dalapon)	75990		ug/L	ug/kg				Organics	Herbicides
Dichloro-pyridine-2-carboxylic Acid, 3,6-	3,6-Dichloro-pyridine-2-carboxylic Acid (Clopyralid)	1702176		ug/L					Organics	Herbicides
Dichlorotrifluoroethane	Dichlorotrifluoroethane (Freon 123)	306832		ug/L					Organics	VOCs
Dichlorotrifluoromethane	Dichlorotrifluoromethane	0		ug/L					Organics	VOCs
Dichlorvos	Dichlorvos	62737		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Dichrotophos	Dichrotophos	0		ug/L					Organics	Pesticides
Diclofenac	Diclofenac (2-(2-(2,6-Dichlorophenylamino)phenyl)acetic Acid)	15307865		ng/L					Organics	PPCPs
Dicofol	Dicofol	115322		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs
Dicrotophos	Dicrotophos	141662		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides
Dicyclohexylurea, 1,3-	1,3-Dicyclohexylurea (N,N'-Dicyclohexylurea)	2387237		ng/L					Organics	Tire- and Vehicle-derived Contaminants
Di-dechlorinated Dechlorane Plus	Di-dechlorinated Dechlorane Plus (C10-DP)	0			ng/g dw				Organics	FlameRetardants
Dieldrin	Dieldrin	60571		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors
Dieldrin(Surrogate)	Surrogate: Dieldrin	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Dieldrin-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Dieldrin-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Diesel Fuel	Diesel Fuel	0		ug/L					Organics
Diethatyl-Ethyl	Diethatyl-Ethyl	38727558		ug/L	ng/g dw				Organics	Pesticides	Herbicides
Diethyl Phosphate	Diethyl Phosphate (DEP)	598027			ng/g dw				Organics	FlameRetardants
Diethyl phthalate	Diethyl phthalate	84662		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Diethyl-3-methyl-benzamide, N,N-	N,N-Diethyl-3-methyl-benzamide	134623		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Diethyl-3-methyl-benzamide-d7, N,N-(Surrogate)	Surrogate: N,N-Diethyl-3-methyl-benzamide-d7	0			% recovery		% recovery	% recovery	Organics	PPCPs
Diethylstilbestrol	Diethylstilbestrol	0		ng/L			ug/Kg ww	ug/Kg dw	Organics	PPCPs
Difenoconazole	Difenoconazole	119446683		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Diflubenzuron	Diflubenzuron (Difluron)	35367385		ug/L					Organics	Pesticides
Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether, 5,6-(Surrogate)	Surrogate: 5,6-Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether	886748330		% recovery	% recovery		% recovery	% recovery	Organics	PBDEs
Difluoro-2,2’,3,3’,4,5,5’,6’-Octabromodiphenyl Ether 4’,6-(Surrogate)	Surrogate: 4’,6-Difluoro-2,2’,3,3’,4,5,5’,6’-Octabromodiphenyl Ether	0			% recovery				Organics	PBDEs
Digoxigenin	Digoxigenin	1672464		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Digoxin	Digoxin	20830755		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Diisopropyl Ether	Diisopropyl Ether	108203		ug/L					Organics	SVOCs
Dike/Levee Extent	Dike/Levee Extent	0	none						Habitat
Dike/Levee Intensity	Dike/Levee Intensity	0	none						Habitat
Dike/Levee Proximity	Dike/Levee Proximity	0	none						Habitat
Diltiazem	Diltiazem	42399417		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Dimethipin	Dimethipin	55290647		ug/L
Dimethoate	Dimethoate	60515		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides
Dimethomorph	Dimethomorph	110488705		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Dimethyl phosphate	Dimethyl Phosphate (DMP)	813785			ng/g dw				Organics	FlameRetardants
Dimethyl phthalate	Dimethyl phthalate	131113		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Dimethyl-2-nitrobenzene, 1,3-	1,3-Dimethyl-2-nitrobenzene	81209		ug/L					Organics
Dimethyl-2-nitrobenzene, 1,3-(Surrogate)	Surrogate: 1,3-Dimethyl-2-nitrobenzene (2,6-Dimethylnitrobenzene)	81209		ug/L	% recovery				Organics	VOCs
Dimethylarsinic Acid	Dimethylarsinic Acid	0					ug/g ww	ug/g dw	Organics	Herbicides
Dimethylchrysene, 5,9-	5,9-Dimethylchrysene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs
Dimethyldibenzothiophene, 2,4-	2,4-Dimethyldibenzothiophene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs
Dimethyldibenzothiophene, 4,6-	4,6-Dimethyldibenzothiophene	1207121		ng/L					Organics	PAHs
Dimethylfluorene, 1,7-	1,7-Dimethylfluorene	442660		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Semi-VOAs
Dimethylnaphthalene, 1,2-	1,2-Dimethylnaphthalene	573988		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Semi-VOAs
Dimethylnaphthalene, 2,6-	2,6-Dimethylnaphthalene	581420		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Dimethylnaphthalene, 2,6-(Surrogate)	Surrogate: 2,6-Dimethylnaphthalene	0		% recovery	% recovery		% recovery	% recovery	Organics	PAHs
Dimethylnaphthalene-d12, 2,6-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,6-Dimethylnaphthalene-d12	350820121		% recovery					Organics	PAHs	IDA
Dimethylnaphthalene-d12, 2,6-(Surrogate)	Surrogate: 2,6-Dimethylnaphthalene-d12	350820121		% recovery	% recovery		% recovery	% recovery	Organics	PAHs
Dimethylphenanthrene, 1,5/1,7-	1,5-Dimethylphenanthrene/1,7-Dimethylphenanthrene	0		ng/L					Organics	PAHs
Dimethylphenanthrene, 1,7-	1,7-Dimethylphenanthrene	483874		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs
Dimethylphenanthrene, 1,8-	1,8-Dimethylphenanthrene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	LMW_PAH
Dimethylphenanthrene, 2,6-	2,6-Dimethylphenanthrene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	LMW_PAH
Dimethylphenanthrene, 3,6-	3,6-Dimethylphenanthrene	1576676		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	LMW_PAH
Dimethylphenol, 2,4-	2,4-Dimethylphenol	105679		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	non-Chlorinated Phenols
Dimethylxanthine, 1,7-	1,7-Dimethylxanthine	611596		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Di-n-butyl Phthalate	Di-n-butyl Phthalate	84742		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs	Endocrine Disruptors
Di-n-butyl Phthalate-d4(Surrogate)	Surrogate: Di-n-butyl Phthalate-d4	0		% recovery					Organics	SVOCs
Dinitro-2-methylphenol, 4,6-	4,6-Dinitro-2-methylphenol	534521		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols
Dinitrophenol, 2,4-	2,4-Dinitrophenol	51285		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols
Dinitrotoluene, 2,4-	2,4-Dinitrotoluene	121142		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Dinitrotoluene, 2,6-	2,6-Dinitrotoluene	606202		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Di-n-octyl Phthalate	Di-n-octyl Phthalate	117840		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Dinonyl-Diphenylamine	Dinonyl-Diphenylamine (ar-Nonyl-N-(Nonylphenyl)-Benzenamine) (SDPA-C9C9)	36878203		ng/L					Organics	Substituted Diphenylamines (SDPAs)
Dinoseb	Dinoseb (2,4-Dinitro-6-sec-butylphenol)	88857		ug/L	ug/kg				Organics	Herbicides
Dinotefuran	Dinotefuran	165252700		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Dinotefuran-d3(Surrogate)	Surrogate: Dinotefuran-d3	0		% recovery					Organics	Pesticides	Insecticides	Neonicotinoids
Di-n-propylnitrosamine	Di-n-propylnitrosamine	0					ug/Kg ww	ug/Kg dw	Organics	SVOCs
Dioctyl-Diphenylamine, 4,4'-	4,4'-Dioctyl-Diphenylamine (SDPA-C8C8)	101677		ng/L					Organics	Substituted Diphenylamines (SDPAs)
Dioxa-3H-Perfluorononanoic Acid, 4,8-	4,8-Dioxa-3H-Perfluorononanoic Acid (ADONA)	919005144		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Dioxane, 1,4-	1,4-Dioxane	0		ug/L
Dioxathion	Dioxathion	78342		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Diphenamid	Diphenamid	957517		ug/L					Organics	Pesticides	Herbicides
Diphenamid(Surrogate)	Surrogate: Diphenamid	957517		% recovery					Organics	Pesticides
Diphenhydramine	Diphenhydramine	58731		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Diphenyl Ether	Diphenyl Ether	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	VOCs
Diphenyl phosphate	Diphenyl phosphate (DPP)	838857			ng/g dw				Organics	FlameRetardants
Diphenylamine	Diphenylamine	122394		ug/L			ug/Kg ww	ug/Kg dw	Organics	Pesticides
Diphenylanthracene, 9,10-	9,10-Diphenylanthracene	0			ng/g dw
Diphenylguanidine,1,3-	1,3-diphenylguanidine	102067		ng/L					Organics	Amidines
Diphenylhydrazine, 1,2-	1,2-Diphenylhydrazine	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	PPCPs
Diphenylphthalate(Surrogate)	Surrogate: Diphenylphthalate	0					% recovery	% recovery	Organics	VOCs
Dipropetryn	Dipropetryn	4147517		ug/L					Organics	Pesticides	Pest-Triazines
Diquat	Diquat	85007		ug/L	ug/Kg dw				Organics	Pesticides
Direct Septic/Sewage Discharge Extent	Direct Septic/Sewage Discharge Extent	0	none						Habitat
Direct Septic/Sewage Discharge Intensity	Direct Septic/Sewage Discharge Intensity	0	none						Habitat
Direct Septic/Sewage Discharge Proximity	Direct Septic/Sewage Discharge Proximity	0	none						Habitat
Discharge	Discharge from a calculation	0		MGD					WaterQualityMeasurements
Discharge Direct Measurement	Discharge Direct Measurement	0		cfs					WaterQualityMeasurements	Ancillary
DischargeMeasurementMethod	Method used to collect discharge (velocity) measurement	0	none						WaterQualityMeasurements
DischargeMeasurementRating	Code qualifying the stream discharge measurement quality in relation to the actual flow	0	none						WaterQualityMeasurements
Dissolved Inorganic Carbon	Dissolved Inorganic Carbon (DIC)	7440440		mg/L					Inorganics	Conventionals
Dissolved Organic Carbon	Dissolved Organic Carbon (DOC)	0		ug/L					Inorganics	Conventionals
Distance from Bank	Distance from Bank	0	m						Habitat
Distance to Bankfull	Distance from the wetted edge to the Bankfull mark	0	m						Habitat
Distance, Float	Float distance of observed object	0	m						Habitat
Distance, Sampled	Distance sampled within a given waterbody	0	m						Habitat
Disulfoton	Disulfoton	298044		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OPs	Insecticides
Disulfoton Sulfone	Disulfoton Sulfone	0		pg/L			ug/Kg ww	ug/Kg dw	Organics	Pesticides
Ditches/Canals Extent	Ditches/Canals Extent	0	none						Habitat
Ditches/Canals Intensity	Ditches/Canals Intensity	0	none						Habitat
Ditches/Canals Proximity	Ditches/Canals Proximity	0	none						Habitat
Dithiopyr	Dithiopyr	97886458		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides
Diuron	Diuron	330541		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Diuron-d6(Surrogate)	Surrogate: Diuron-d6	1007536675		% recovery					Organics	Pesticides	Pest-Carbamates	Herbicides
Docohexaenoic Acid	Docohexaenoic Acid	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid
Docosahexaenoic Acid	Docosahexaenoic Acid	6217545					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid
Docosane, n-	n-Docosane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes
Docosapentaenoic Acid	Docosapentaenoic Acid	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid
Dodecamethylcyclohexasiloxane	Dodecamethylcyclohexasiloxane	540976			ug/Kg dw
Dodecane, 2-phenyl-	2-Phenyl-dodecane	0			ng/g dw				Organics	VOCs
Dodecane, 3-phenyl-	3-Phenyl-dodecane	0			ng/g dw				Organics	VOCs
Dodecane, 4-phenyl-	4-Phenyl-dodecane	0			ng/g dw				Organics	VOCs
Dodecane, 5-phenyl-	5-Phenyl-dodecane	0			ng/g dw				Organics	VOCs
Dodecane, 6-phenyl-	6-Phenyl-dodecane	0			ng/g dw				Organics	VOCs
Dodecane, n-	n-Dodecane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes
Dodine	Dodine	0		ug/L					Organics	Pesticides	Fungicides
Dog_DG37	Dog_DG37	0		copies/100mL					Microbiological
Dominant Benthic Substrate	Dominant Benthic Substrate - Specific to EMAP BA	0	none						Habitat
Dominant Land Use	Dominant Land Use	0	none						Habitat
DominantSubstrate	DominantSubstrate	0	none						FieldObservations	Habitat
Domoic Acid	Domoic Acid	14277975		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Dotriacontane, n-	n-Dotriacontane	544854					ng/g ww	ng/g dw	Organics	Alkanes
Doxycycline	Doxycycline	564250		ug/L					Organics	PPCPs
Dredging	Dredging	0	none						Habitat
Dry	Dry	0	none						Habitat
Dry Weight	Dry Weight	0			g		g ww	g dw	Tissue	Ancillary
Dry Weight Standard Error	Dry Weight Standard Error	0					g ww	g dw	Tissue	Ancillary
Dumping	Dumping using Trash Protocol	0	score						Trash
E. coli	Escherichia coli	0		MPN/g dw	MPN/g dw		MPN/100 mL	MPN/100 mL	Microbiological	Pathogens	Conventionals
E. Coli O157:H7	Escherichia Coli O157:H7 strain	0		none	none				Microbiological	Pathogens	Conventionals
Eicosane, n-	n-Eicosane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes
Eicosapentaenoate	Eicosapentaenoate	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid
ElectricalConductivity	Electrical Conductivity	0		uS/cm					WaterQualityMeasurements	Conventionals
Elevation Difference	Elevation Difference	0	cm						Habitat
Embeddedness	Embeddedness	0	%						Habitat
Enalapril	Enalapril	75847733		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Enalapril-d5(Surrogate)	Surrogate: Enalapril-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
End Time	Time (hh:mm) when a given event ended	0	none						Habitat
Endosulfan I	Endosulfan I (alpha-Endosulfan)	959988		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endosulfans
Endosulfan I(Surrogate)	Surrogate: Endosulfan I (alpha-Endosulfan)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Endosulfan I-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Endosulfan I-13C9	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Endosulfan I-d4(Surrogate)	Surrogate: Endosulfan I-d4 (alpha-Endosuflan-d4)	0		% recovery					Organics	Pesticides
Endosulfan II	Endosulfan II (beta-Endosulfan)	33213659		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endosulfans
Endosulfan II(Surrogate)	Surrogate: Endosulfan II (beta-Endosulfan)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Endosulfan II-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Endosulfan I-13C9	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Endosulfan II-d4(Surrogate)	Surrogate: Endosulfan II-d4	0		% recovery					Organics
Endosulfan Sulfate	Endosulfan Sulfate	1031078		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endosulfans
Endosulfan Sulfate-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Endosulfan Sulfate-13C9	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Endothall	Endothall	0		ug/L					Organics	Pesticides	Herbicides
Endrin	Endrin	72208		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endrins
Endrin Aldehyde	Endrin Aldehyde	7421934		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endrins
Endrin Aldehyde(Surrogate)	Surrogate: Endrin Aldehyde	0			% recovery		% recovery	% recovery	Organics	Pesticides	OrganochlorinePesticides	Semi-VOAs	Insecticides	Endrins
Endrin Aldehyde-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Endrin Aldehyde-13C12	0			% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Endrin Ketone	Endrin Ketone	53494705		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endrins
Endrin Ketone-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Endrin Ketone-13C12	2483736076		% recovery	% recovery		% recovery	% recovery
Endrin Ketone-13C12(Surrogate)	Surrogate: Endrin Ketone-13C12	2483736076			% recovery				Organics	Pesticides
Endrin(Surrogate)	Surrogate: Endrin	72208		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Endrin-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Endrin-13C12	475274998		% recovery	% recovery		% recovery	% recovery
Endrin-13C12(Surrogate)	Surrogate: Endrin-13C12	475274998			% recovery				Organics	Pesticides
Enrofloxacin	Enrofloxacin	93106606		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Enterococcus	Enterococcus	0		TSC/100mL	MPN/g dw		MPN/g ww	MPN/g dw	Microbiological	Pathogens	Conventionals
Enterovirus		0		copies/100 mL
Epitestosterone	Epitestosterone	481301		ng/L
EPN	EPN	2104645		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides
EPN(Surrogate)	Surrogate: EPN	2104645		% recovery					Organics	Pesticides	OrganophosphatePest.	Semi-VOAs	Insecticides	Endrins
EPTC	EPTC	759944		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides
EPTC(Surrogate)	Surrogate: EPTC	759944		% recovery					Organics	Pesticides	Herbicides
Erythromycin	Erythromycin	114078		ng/L
Erythromycin-H2O	Erythromycin-H2O	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Erythromycin-H2O-13C2(Surrogate)	Surrogate: Erythromycin-H2O-13C2	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Esfenvalerate	Esfenvalerate	66230044		ug/L	ug/Kg dw				Organics	Pesticides
Esfenvalerate/Fenvalerate, Total	Total Esfenvalerate/Fenvalerate, sum peaks 1 & 2	51630581		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Pyrethroids	Insecticides
Esfenvalerate/Fenvalerate-1	Esfenvalerate/Fenvalerate peak 1	51630581		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Esfenvalerate/Fenvalerate-2	Esfenvalerate/Fenvalerate peak 2	66230404		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Esfenvalerate-d6, Total(Surrogate)	Surrogate: Total Esfenvalerate-d6, sum peaks 1 & 2	0		% recovery	% recovery				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Esfenvalerate-d6-1(Surrogate)	Surrogate: Esfenvalerate-d6 peak 1	0		% recovery	% recovery				Organics	Pesticides	Insecticides	Pyrethroids
Esfenvalerate-d6-2(Surrogate)	Surrogate: Esfenvalerate-d6 peak 2	0		% recovery	% recovery				Organics	Pesticides	Insecticides	Pyrethroids
Estradiol, 17beta-	17beta-Estradiol	50282		ug/L					Organics	PPCPs
Estradiol-d3, 17beta-(IsoDilAnalogue)	Isotope Dilution Analogue: 17beta-Estradiol-d3	79037379		% recovery					Organics
Estriol	Estriol	50271		ng/L
Estriol-d2(Surrogate)	Surrogate: Estriol-d2	53866323		% recovery
Estrone	Estrone	53167		ng/L					Organics	PPCPs
Ethaboxam	Ethaboxam	162650773		ng/L					Organics	Pesticides	Fungicides
Ethafluralin	Ethalfluralin	55283686		ug/L			ug/Kg ww	ug/Kg dw	Organics	Pesticides	Herbicides
Ethalfluralin	Ethalfluralin	55283686		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Herbicides
Ethanol	Ethanol (Ethyl Alcohol)	0		ug/L					Organics	Pesticides
Ethion	Ethion	563122		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Ethion(Surrogate)	Surrogate: Ethion	563122		% recovery					Organics	Pesticides	OrganophosphatePest.	OrganochlorinePesticides	Semi-VOAs	Insecticides
Ethiprole(Surrogate)	Ethiprole(Surrogate)	181587019		% recovery					Organics	Pesticides	Insecticides	Phenylpyrazoles
Ethofenprox	Ethofenprox	80844071		ug/L	ug/Kg dw				Organics	PPCPs
Ethoprop	Ethoprop (Prophos)	13194484		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides
Ethyl Ether	Ethyl Ether	60297		ug/L					Organics	VOCs
Ethyl Perfluorooctane Sulfonamido Acetic Acid, N-	N-Ethyl Perfluorooctane Sulfonamido Acetic Acid (Et-PFOSA-AcOH)	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS	PFC Precursor
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5 (N-EtFOSAA-d5)	1265205977		% recovery					Organics	PFAS	IDA
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(Surrogate)	Surrogate: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5	0					% recovery	% recovery	Organics	PFAS	PFC Precursor
Ethyl Perfluorooctanesulfonamide, N-	N-Ethyl Perfluorooctanesulfonamide (NEtFOSA)	4151502		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Ethyl Perfluorooctanesulfonamide-d5, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctanesulfonamide-d5 (NEtFOSA-d5)	936109409		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Ethyl Perfluorooctanesulfonamidoacetic Acid, N-	N-Ethyl Perfluorooctanesulfonamidoacetic Acid (NEtFOSAA)	2991506		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Ethyl Perfluorooctanesulfonamidoacetic Acid-d5, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctanesulfonamidoacetic Acid-d5 (NEtFOSAA-d5)	1265205977		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Ethyl Perfluorooctanesulfonamidoethanol, N-	N-Ethyl Perfluorooctanesulfonamidoethanol (NEtFOSE)	1691992		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Ethyl Perfluorooctanesulfonamidoethanol-d9, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctanesulfonamidoethanol-d9 (NEtFOSE-d9)	1265205966		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Ethyl Tert-butyl Ether	Ethyl Tert-butyl Ether (ETBE)	637923		ug/L					Organics	VOCs
Ethylbenzene	Ethylbenzene	100414		ug/L					Organics	VOCs	MTBE_BTEX
Ethylene bis(tetrabromophthalimide)	Ethylene bis(tetrabromophthalimide) (EBTEBPI)	32588764			ng/g dw				Organics	FlameRetardants
Ethylene Glycol	Ethylene Glycol	107211		mg/L
Ethyl-perfluorooctanesulfonamide, N-	N-Ethyl-perfluorooctanesulfonamide	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Ethyl-perfluorooctanesulfonamide-d5, N-(Surrogate)	Surrogate: Ethyl-perfluorooctanesulfonamide-d5, N- (N-EtFOSA)	0					% recovery	% recovery	Organics	PFAS
Ethyl-Perfluorooctanesulfonamidoacetic Acid, N-	N-Ethyl-Perfluorooctanesulfonamidoacetic Acid (NEtFOSAA)	2991506			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Ethyl-perfluorooctanesulfonamidoethanol, N-	N-Ethyl-perfluorooctanesulfonamidoethanol	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(Surrogate)	Surrogate: Ethyl-perfluorooctanesulfonamidoethanol-d9, N- (N-EtFOSE)	0					% recovery	% recovery	Organics	PFAS
Ethynylestradiol, 17alpha-	17alpha-Ethynylestradiol	57636		ng/L
Ethynylestradiol-d4, 17alpha-(IsoDilAnalogue)	Isotope Dilution Analogue: 17alpha-Ethynylestradiol-d4	350820063		% recovery					Organics
Ethynylestradiol-d4, 17alpha-(Surrogate)	Surrogate: 17alpha-Ethynylestradiol-d4	350820063		% recovery
Ev_FlowHab	Evenness of flow habitat types physical-habitat metric	0	none						Bioassessment
Evidence of Fire	Evidence of Fire	0	none						Habitat
Evidence of Fire Intensity	Evidence of Fire Intensity - Specific to EMAP BA	0	none						Habitat
Evidence of Illegal Connection	Evidence of Illegal Connection	0	none
Evidence of Illegal Dumping	Evidence of Illegal Dumping	0	none
Evidence of Recent Rainfall	Evidence of Recent Rainfall	0	none						Habitat
Evidence of Scour	Site is affected by recent scouring event	0	none						Habitat	FieldObservations
E-waste	E-waste	0	pieces						Debris	Trash	Plastics	Toxic
Excavation Extent	Excavation Extent	0	none						Habitat
Excavation Intensity	Excavation Intensity	0	none						Habitat
Excavation Proximity	Excavation Proximity	0	none						Habitat
Excess Animal Waste Extent	Excess Animal Waste Extent	0	none						Habitat
Excess Animal Waste Intensity	Excess Animal Waste Intensity	0	none						Habitat
Excess Animal Waste Proximity	Excess Animal Waste Proximity	0	none						Habitat
Excess Sediment Input Other Extent	Excess Sediment Input Other Extent	0	none						Habitat
Excess Sediment Input Other Intensity	Excess Sediment Input Other Intensity	0	none						Habitat
Excess Sediment Input Other Proximity	Excess Sediment Input Other Proximity	0	none						Habitat
Excessive Human Visitation Extent	Excessive Human Visitation Extent	0	none						Habitat
Excessive Human Visitation Intensity	Excessive Human Visitation Intensity	0	none						Habitat
Excessive Human Visitation Proximity	Excessive Human Visitation Proximity	0	none						Habitat
Fabric	Fabric	0	pieces						Debris	Trash	Non-Plastics	Biodegradable
Fallow Fields Extent	Fallow Fields Extent	0	none						Habitat
Fallow Fields Intensity	Fallow Fields Intensity	0	none						Habitat
Fallow Fields Proximity	Fallow Fields Proximity	0	none						Habitat
Famoxadone	Famoxadone	131807573		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Famphur	Famphur	52857		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides
FBDE 069	Fluorobrominated Diphenyl Ether (FBDE) 069 (4′-Fluoro-2,3′,4,6-tetrabromodiphenyl ether)	863314878			ng/Kg dw		ug/Kg ww	ug/Kg dw	Organics
FBDE 160	Fluorobrominated Diphenyl Ether (FBDE) 160 (4′-Fluoro-2,3,3′,4,5,6-hexabromodiphenyl ether)	863314889			ng/Kg dw		ug/Kg ww	ug/Kg dw	Organics
Fecal Streptococcus	Fecal Streptococcus	0		MPN/100 mL
Fenamidone	Fenamidone	161326347		ng/L					Organics	Pesticides	Fungicides
Fenamiphos	Fenamiphos (Phosphoramidic acid, Isopropyl-, 4-(methylthio)-m-tolyl Ethyl Ester)	22224926		ug/L					Organics	Pesticides	Pest-Ops	Insecticides
Fenarimol	Fenarimol	60168889		ug/L	ug/Kg dw				Organics	Pesticides	Fungicides
Fenbuconazole	Fenbuconazole	114369436		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Fenchlorphos	Fenchlorphos (Ronnel)	299843		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OPs	Insecticides
Fenhexamid	Fenhexamid	126833178		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Fenitrothion	Fenitrothion	122145		ug/L	ng/g dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Fenoxycarb	Fenoxycarb	0		ug/L					Organics	Pesticides	Insecticides
Fenpropathrin	Fenpropathrin (Danitol)	39515418		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Pyrethroids	Insecticides
Fenpropathrin-d6(Surrogate)	Surrogate: Fenpropathrin-d6	0			% recovery				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Fenpyroximate	Fenpyroximate	134098616		ng/L	ug/Kg dw				Organics	Pesticides	Insecticides
Fensulfothion	Fensulfothion	115902		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides
Fenthion	Fenthion (Mercaptophos)	55389		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Fenuron	Fenuron	101428		ug/L					Organics	Pesticides	Herbicides
Fenvalerate	Fenvalerate	51630581		ug/L	ug/Kg ww				Organics	Pesticides
Fenvalerate-d5(Surrogate)	Surrogate: Fenvalerate-d5	0		% recovery	% recovery				Organics	Pesticides	Pest-Pyrethroids
Feral Pig Disturbance Extent	Feral Pig Disturbance Extent	0	none						Habitat
Feral Pig Disturbance Intensity	Feral Pig Disturbance Intensity	0	none						Habitat
Feral Pig Disturbance Proximity	Feral Pig Disturbance Proximity	0	none						Habitat
Fertilization	Fertilization (%)	0				%			Toxicity
Filling Time	Time to fill a collection device with water	0	seconds						Habitat
FinalSampleExtVolume	Final post-processing volume	0			mL				Laboratory	Ancillary
Fine	Fine	0		mg/L	% ww				Inorganics	Conventionals	GrainSize
Fipronil	Fipronil	120068373		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Insecticides
Fipronil Amide	Fipronil Amide	0		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Fipronil Desulfinyl	Fipronil Desulfinyl	205650653		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Insecticides
Fipronil Desulfinyl Amide	Fipronil Desulfinyl Amide	1115248093		ug/L	ug/Kg dw				Organics	Pesticides	Insecticides
Fipronil Desulfinyl-13C4 15N2(Surrogate)	Surrogate: Fipronil Desulfinyl-13C4 15N2	0			% recovery				Organics	Pesticides	Fipronils
Fipronil desulfinyl-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil desulfinyl-13C4,15N2	0			% recovery				Organics	Pesticides	Insecticides	Fipronils	IDA
Fipronil DetrifluoroMethylsulfinyl	Fipronil DetrifluoroMethylsulfinyl	120068793			ug/Kg dw				Organics	Pesticides	Fipronils
Fipronil Detrifluoromethylsulfinyl-13C4 15N2(Surrogate)	Surrogate: Fipronil Detrifluoromethylsulfinyl-13C4 15N2	0			% recovery				Organics	Pesticides	Fipronils
Fipronil detrifluoromethylsulfinyl-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil detrifluoromethylsulfinyl-13C4,15N2	0			% recovery				Organics	Pesticides	Insecticides	Fipronils	IDA
Fipronil Sulfide	Fipronil Sulfide	120067836		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Insecticides
Fipronil Sulfide-13C4 15N2(Surrogate)	Surrogate: Fipronil Sulfide-13C4 15N2	0			% recovery				Organics	Pesticides	Fipronils
Fipronil sulfide-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil sulfide-13C2,15N2	0			% recovery				Organics	Pesticides	Insecticides	Fipronils	IDA
Fipronil Sulfone	Fipronil Sulfone	120068362		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Insecticides
Fipronil Sulfone-13C4 15N2(Surrogate)	Surrogate: Fipronil Sulfone-13C4 15N2	0			% recovery				Organics	Pesticides	Fipronils
Fipronil sulfone-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil sulfone-13C4,15N2	0			% recovery				Organics	Pesticides	Insecticides	Fipronils	IDA
Fipronil-13C4 15N2(Surrogate)	Surrogate: Fipronil-13C4 15N2	0		% recovery	% recovery		% recovery	% recovery	PESTICIDES	Fipronils
Fipronil-13C4(Surrogate)	Surrogate: Fipronil-13C4	0		% recovery	% recovery
Fipronil-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil-13C2,15N2	0			% recovery				Organics	Pesticides	Insecticides	Fipronils	IDA
Fipronil-C13(Surrogate)	Surrogate: Fipronil-C13	0		% recovery					Organics	Pesticides
Fire Breaks Extent	Fire Breaks Extent	0	none						Habitat
Fire Breaks Intensity	Fire Breaks Intensity	0	none						Habitat
Fire Breaks Proximity	Fire Breaks Proximity	0	none						Habitat
Fireworks	Fireworks	0	pieces						Debris	Trash	Non-Plastics	Toxic
Fish Cover Artificial Structures	Fish Cover/Instream Habitat Complexity – Other Artificial Structures	0	none						Habitat
Fish Cover Boulders	Fish Cover/Instream Habitat Complexity – Other Boulders	0	none						Habitat
Fish Cover Filamentous Algae	Fish Cover/Instream Habitat Complexity - Other Filamentous Algae	0	none						Habitat
Fish Cover Live Trees/Roots	Fish Cover/Instream Habitat Complexity – Other Live Trees or Roots	0	none						Habitat
Fish Cover Macrophytes	Fish Cover/Instream Habitat Complexity - Macrophytes	0	none						Habitat
Fish Cover Overhang.Veg	Fish Cover/Instream Habitat Complexity – Other Overhanging Vegetation =<1 m of surface	0	none						Habitat
Fish Cover Undercut Banks	Fish Cover/Instream Habitat Complexity – Other Undercut Banks	0	none						Habitat
Fish Cover Woody Debris <0.3 m	Fish Cover/Instream Habitat Complexity – Other Woody Debris <0.3 m	0	none						Habitat
Fish Cover Woody Debris >0.3 m	Fish Cover/Instream Habitat Complexity – Other Woody Debris >0.3 m	0	none						Habitat
Fish Stocking	Fish Stocking	0	none						Habitat
Fishing Line/Net	Fishing Line/Net	0	pieces						Debris	Trash	Plastics	Miscellaneous
Float Time	Float time of observed object	0	seconds						Habitat
Floatables	Floatables	0	none	none					Habitat
Flonicamid	Flonicamid	158062670		ng/L					Organics	Pesticides	Insecticides
Flow Diversions Extent	Flow Diversions Extent	0	none						Habitat
Flow Diversions Intensity	Flow Diversions Intensity	0	none						Habitat
Flow Diversions Proximity	Flow Diversions Proximity	0	none						Habitat
Fluazinam	Fluazinam	79622596		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Flucythrinate	Flucythrinate	70124775		pg/L	ug/Kg ww				Organics	Pesticides	Pyrethroids
Fludioxonil	Fludioxonil	131341861		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Flufenacet	Flufenacet	142459583		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides
Flumequine	Flumequine	42835256		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Flumetralin	Flumetralin	62924703		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides
Flumetsulam	Flumetsulam	98967409		ug/L					Organics	Herbicides
Flumioxazin	Flumioxazin	103361097		ug/L					Organics	Pesticides
Fluocinonide	Fluocinonide	356127		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Fluometuron	Fluometuron	2164172		ug/L					Organics	Pesticides	Herbicides
Fluopicolide	Fluopicolide	239110157		ng/L					Organics	Pesticides	Fungicides
Fluopyram	Fluopyram	658066354		ng/L					Organics	Pesticides	Fungicides
Fluoranthene	Fluoranthene	206440		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH
Fluoranthene/Pyrenes, C1-	C1-Fluoranthene/Pyrenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH
Fluoranthene-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Fluoranthene-d10	93951690		% recovery					Organics	PAHs	IDA
Fluoranthene-d10(Surrogate)	Surrogate: Fluoranthene-d10	93951690		% recovery	% recovery		% recovery	% recovery	Organics	PAHs
Fluoranthenes/Pyrenes, C2-	C2-Fluoranthenes/Pyrenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs
Fluoranthenes/Pyrenes, C3-	C3-Fluoranthenes/Pyrenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs
Fluoranthenes/Pyrenes, C4-	C4-Fluoranthenes/Pyrenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Alkylated PAHs
Fluorene	Fluorene	86737		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Fluorene-d10(Surrogate)	Surrogate: Fluorene-d10	0			% recovery		% recovery	% recovery	Organics	PAHs
Fluorenes, C1-	C1-Fluorenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Fluorenes, C2-	C2-Fluorenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Fluorenes, C3-	C3-Fluorenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Fluorescence	Fluorescence	0		ug/L					WaterQualityMeasurements
Fluorescence, Daily Mean	Daily Mean Fluorescence (Calculated)	0		ug/L					WaterQualityMeasurements	Conventionals
Fluoride	Fluoride	16984488		mg/L					Inorganics	Conventionals
Fluoro-2,3,3',4,5,6-Hexabromodiphenyl Ether, 4'-(Surrogate)	Surrogate: 4'-Fluoro-2,3,3',4,5,6-Hexabromodiphenyl Ether (FBDE 160)	863314889			ng/Kg dw		ug/Kg ww	ug/Kg dw	Organics
Fluoro-2,3',4,6-Tetrabromodiphenyl Ether, 4'-(Surrogate)	Surrogate: 4'-Fluoro-2,3',4,6-Tetrabromodiphenyl Ether (FBDE 069)	863314878			ng/Kg dw		ug/Kg ww	ug/Kg dw	Organics
Fluoro-2,3',6-Tribromodiphenyl Ether, 4'-(Surrogate)	Surrogate: 4'-Fluoro-2,3',6-tribromodiphenyl Ether	863314867		% recovery	% recovery		% recovery	% recovery	Organics	PBDEs
Fluorobiphenyl, 2-	2-Fluorobiphenyl	321608		ug/L			ng/g ww	ng/g dw	Organics	SVOCs
Fluorobiphenyl, 2-(Surrogate)	Surrogate: 2-Fluorobiphenyl	321608		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs
Fluorophenol, 2-	2-Fluorophenol	367124		ug/L					Organics	VOCs
Fluorophenol, 2-(Surrogate)	Surrogate: 2-Fluorophenol	367124		ug/L	% recovery		% recovery	% recovery	Organics	VOCs	Phenols	non-Chlorinated Phenols
Fluorotelomer Carboxylic Acid, 3:3-	3:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorohexanoic acid) (3:3 FTCA)	356025		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Fluorotelomer Carboxylic Acid, 5:3-	5:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorooctanoic acid) (5:3 FTCA)	914637493		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Fluorotelomer Carboxylic Acid, 7:3-	7:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorodecanoic acid) (7:3 FTCA)	812704		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Fluorotelomer Sulfonate, 10:2-	10:2-Fluorotelomer Sulfonate (10:2 FTS)	120226600			ng/g dw				Organics	PFAS
Fluorotelomer Sulfonate, 4:2-	4:2-Fluorotelomer Sulfonate (4:2 FTS)	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Fluorotelomer Sulfonate, 6:2-	6:2-Fluorotelomer Sulfonate (6:2 FTS)	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Fluorotelomer Sulfonate, 8:2-	8:2-Fluorotelomer Sulfonate (8:2 FTS)	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Fluorotelomer Sulfonate-13C, 6:2-(Surrogate)	Surrogate: 6:2-Fluorotelomer Sulfonate-13C	0					% recovery	% recovery	Organics	PFAS	PFC Precursor
Fluorotelomer Sulfonate-13C2, 4:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 4:2-Fluorotelomer Sulfonate-13C2 (4:2 FTS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Fluorotelomer Sulfonate-13C2, 4:2-(Surrogate)	Surrogate: Fluorotelomer Sulfonate-13C2, 4:2- (4:2 FTS)	0					% recovery	% recovery	Organics	PFAS
Fluorotelomer Sulfonate-13C2, 6:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 6:2-Fluorotelomer Sulfonate-13C2 (6:2 FTS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Fluorotelomer Sulfonate-13C2, 8:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 8:2-Fluorotelomer Sulfonate-13C2 (8:2 FTS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Fluorotelomer Sulfonate-13C2, 8:2-(Surrogate)	Surrogate: Fluorotelomer Sulfonate-13C2, 8:2- (8:2 FTS)	0					% recovery	% recovery	Organics	PFAS
Fluoxastrobin	Fluoxastrobin	361377299		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Fluoxetine	Fluoxetine	54910893		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Fluoxetine-d5(Surrogate)	Surrogate: Fluoxetine-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Fluridone	Fluridone	59756604		ug/L	ug/Kg dw		ug/Kg nr	ug/Kg nr	Organics	Pesticides
Fluridone(Surrogate)	Surrogate: Fluridone	59756604		% recovery	% recovery				Organics	Pesticides	Pest-Pyrethroids
Flusilazole	Flusilazole	85509199		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Fluticasone Propionate	Fluticasone Propionate	80474142		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Flutolanil	Flutolanil	66332965		ug/L	ug/Kg dw				Organics	Fungicides
Flutriafol	Flutriafol	76674210		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Fluvalinate	Fluvalinate	0		ug/L	ug/Kg dw				Organics	Pesticides
Fluxapyroxad	Fluxapyroxad	907204313		ng/L					Organics	Pesticides	Fungicides
Foam Ball	Foam Ball	0	pieces						Debris	Trash	Plastics	Miscellaneous
Foliose Algae	Foliose Algae	0	pieces						Debris	Trash	Non-Plastics	Marine Origin
Folpet	Folpet	133073		ug/L					Organics	Pesticides	Fungicides
Fonofos	Fonofos (Dyfonate)	944229		ug/L	ng/g dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Fonofos(Surrogate)	Surrogate: Fonofos	0		% recovery					Organics	Pesticides	OrganophosphatePest.	Insecticides
Fonofos-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Fonofos-13C6	0					% recovery	% recovery	Organics	Pest-OPs	IDA
Food Service	Food Service	0	L						Debris	Trash	Plastics
Food Service, Other	Food Service, Other	0	pieces						Debris	Trash	Plastics	FoodService
Forest Dominant Age Class	Forest Dominant Age Class	0	none						Habitat
Formaldehyde	Formaldehyde (Methanal)	0		ug/L					Organics	Pesticides
Formate(Surrogate)	Surrogate: Formate	0		% recovery					Organics
Furniture	Furniture	0	pieces						Debris	Trash	Plastics	Non-Plastics	Household	Large
Furosemide	Furosemide	54319		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Gadolinium	Gadolinium	7440542			mg/Kg dw				Inorganics	Metals
Gage Height	Water surface level measured against a staff gage within a given waterbody	0		ft					Habitat
Galaxolide	Galaxolide	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides
Galaxolide-d6(Surrogate)	Galaxolide-d6(Surrogate)	0		% recovery					Organics	PPCPs
Garbage Bag of Trash	Garbage Bag of Trash	0	pieces						Debris	Trash	Non-Plastics	Large
Gasoline	Gasoline	0		ug/L					Organics
Gasoline Range Hydrocarbons	Gasoline Range Hydrocarbons	0		ug/L
Gemfibrozil	Gemfibrozil	25812300		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Gemfibrozil-d6(IsoDilAnalogue)	Isotope Dilution Analogue: Gemfibrozil-d6	1184986455		% recovery					Organics
Gemfibrozil-d6(Surrogate)	Surrogate: Gemfibrozil-d6	1184986455		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Geosmin	Geosmin	19700211		ng/L					Organics	Terpenes/Terpinoids
Germination	Germination (%)	0				%			Toxicity
Giardia	Giardia	0		oocysts/L					Microbiological	Pathogens	Conventionals
Giardia Cysts Fluorescence Antibody	Giardia Cysts Fluorescence Antibody	0		cysts/L					Microbiological	Pathogens
Giardia Cysts Negative	Giardia Cysts Negative	0		cysts/L					Microbiological	Pathogens
Giardia Cysts/Amorphous Structure	Giardia Cysts/Amorphous Structure	0		IFA+/100L					Microbiological	Pathogens
Giardia Cysts/DAPI & DIC Positive	Giardia Cysts/DAPI & DIC Positive	0		cysts/L					Microbiological	Pathogens
Giardia Cysts/Empty	Giardia Cysts/Empty	0		IFA+/100L					Microbiological	Pathogens
Giardia Cysts/Flourescence Antibody	Giardia Cysts/Flourescence Antibody	0		cysts/L					Microbiological	Pathogens
Giardia Cysts/Internal Structure	Giardia Cysts/Internal Structure	0		cysts/L					Microbiological	Pathogens
Giardia Cysts/Internal Structure (>One)	Giardia Cysts/Internal Structure (>One)	0		cysts/L					Microbiological	Pathogens
Giardia Cysts/Internal Structure (One)	Giardia Cysts/Internal Structure (One)	0		IFA+/100L					Microbiological	Pathogens
Giardia Cysts/Internal Structures (>One)	Giardia Cysts/Internal Structures (>One)	0		IFA+/100L					Microbiological	Pathogens
Giardia Cysts/Negative	Giardia Cysts/Negative	0		cysts/L					Microbiological	Pathogens
Giardia Cysts/Positive	Giardia Cysts/Positive	0		cysts/L					Microbiological	Pathogens
Giardia Cysts/Positive (Internal Staining)	Giardia Cysts/Positive (Internal Staining)	0		cysts/L					Microbiological	Pathogens
Giardia Cysts/Positive (Stained Nuclei)	Giardia Cysts/Positive (Stained Nuclei)	0		cysts/L					Microbiological	Pathogens
Giardia Cysts/Total IFA Count	Giardia Cysts/Total IFA Count	0		IFA+/100L					Microbiological	Pathogens
Glass	Glass using Trash Protocol	0	pieces						Trash
Glass Servicewear	Glass Servicewear	0	pieces						Debris	Trash	Non-Plastics	Household
Glass Shard	Glass Shard	0	pieces						Debris	Trash	Non-Plastics	Household
Glide	Glide	0	%						Habitat
Glide/Pool Bank Stability	Glide/Pool Bank Stability (used for EMAP RBP 20-score habitat characterization)	0	none						Habitat
Glide/Pool Channel Alteration	Glide/Pool Channel Alteration	0	none						Habitat
Glide/Pool Channel Flow Status	Glide/Pool Channel Flow Status	0	none						Habitat
Glide/Pool Channel Sinuosity	Glide/Pool Channel Sinuosity	0	none						Habitat
Glide/Pool Epifaunal Substrate	Glide/Pool Epifaunal Substrate	0	none						Habitat
Glide/Pool Pool Substrate	Glide/Pool Pool Substrate	0	none						Habitat
Glide/Pool Pool Variability	Glide/Pool Pool Variability	0	none						Habitat
Glide/Pool Riparian Zone Width	Glide/Pool Riparian Zone Width	0	none						Habitat
Glide/Pool Sediment Deposition	Glide/Pool Sediment Deposition	0	none						Habitat
Glide/Pool Vegetative Protection	Glide/Pool Vegetative Protection	0	none						Habitat
Glipizide	Glipizide	29094619		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Glipizide-d11(Surrogate)	Surrogate: Glipizide-d11	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Glyburide	Glyburide	10238218		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Glyburide-d3(Surrogate)	Surrogate: Glyburide-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Glyphosate	Glyphosate	1071836		ug/L					Organics	Pesticides	Herbicides
Gold	Gold	0			mg/Kg dw				Inorganics	Metals
Golf Course/Parks/Sports Fields Extent	Golf Course/Parks/Sports Fields Extent	0	none						Habitat
Golf Course/Parks/Sports Fields Intensity	Golf Course/Parks/Sports Fields Intensity	0	none						Habitat
Golf Course/Parks/Sports Fields Proximity	Golf Course/Parks/Sports Fields Proximity	0	none						Habitat
Gonad Index CI Mean	Gonad Index CI Mean	0					g/mL	g/mL	Tissue	Condition
Gonad Index Standard Error	Gonad Index Standard Error	0					g/mL	g/mL	Tissue	Condition
Grading/Compaction Extent	Grading/Compaction Extent	0	none						Habitat
Grading/Compaction Intensity	Grading/Compaction Intensity	0	none						Habitat
Grading/Compaction Proximity	Grading/Compaction Proximity	0	none						Habitat
Granule	Granule	0		%	%				Inorganics	Conventionals	GrainSize
Granule + Pebble	Granule + Pebble	0		mg/L	% vol				Inorganics	Conventionals	GrainSize
Gravel	Gravel	0			% ww				Inorganics	Conventionals	GrainSize
Grazing_Recent	Evidence of grazing activiy by cattle within the past year	0	none						Habitat
Gross Alpha	Gross Alpha	12587461		pCi/L					Radiochemistry
Gross Beta	Gross Beta	12587472		pCi/L					Radiochemistry
Groundwater Extraction Extent	Groundwater Extraction Extent	0	none						Habitat
Groundwater Extraction Intensity	Groundwater Extraction Intensity	0	none						Habitat
Groundwater Extraction Proximity	Groundwater Extraction Proximity	0	none						Habitat
Growth (ash-free dry wt/surv indiv)	Growth (ash-free dry weight/surviving individual)	0				mg/ind			Toxicity	Endpoint
Growth (Chlorophyll a fluorescence)	Growth (Chlorophyll a fluorescence)	0		RFU		RFU			Toxicity
Growth (Chlorophyll a)	Growth (Chlorophyll a)	0				mg/m3			Toxicity
Growth (length)	Growth (length)	0				mm			Toxicity
Growth (weight)	Growth (weight)	0					g	g	Tissue	Condition
Growth (wt/surv indiv)	Growth (weight/surviving individual)	0				mg/ind			Toxicity
Growth Ratio	Growth Ratio (final measurement / initial measurement)	0				Num/Rep			Toxicity
Growth Standard Error	Growth Standard Error	0					g	g	Tissue	Condition
Gull_Gull2TM	Gull_Gull2TM	0		copies/100mL					Microbiological
H_AqHab	Shannon diversity of natural instream cover types physical-habitat metric	0	none						Bioassessment
H_SubNat	Shannon diversity of natural substrate types physical-habitat metric	0	none						Bioassessment
HabitatType	HabitatType	0	none						FieldObservations	Habitat
Halosulfuron Methyl	Halosulfuron Methyl	100784201		ug/L					Organics	Pesticides	Herbicides
Hard Plastic Piece, non-specific	Hard Plastic Piece, non-specific	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Hardened Features Other Extent	Hardened Features Other Extent	0	none						Habitat
Hardened Features Other Intensity	Hardened Features Other Intensity	0	none						Habitat
Hardened Features Other Proximity	Hardened Features Other Proximity	0	none						Habitat
Hardness as CaCO3	Hardness as CaCO3	0		ug/L	% recovery				Inorganics	Conventionals	WaterQualityMeasurements
Hay Extent	Hay Extent	0	none						Habitat
Hay Intensity	Hay Intensity	0	none						Habitat
Hay Proximity	Hay Proximity	0	none						Habitat
HCH, alpha-	alpha-Hexachlorocyclohexane (HCH) (alpha-BHC)	319846		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Rodenticides
HCH, alpha-(Surrogate)	Surrogate: alpha-Hexachlorocyclohexane (HCH) (alpha-BHC)	0			% recovery				Organics	Pesticides
HCH, beta-	beta-Hexachlorocyclohexane (HCH) (beta-BHC)	319857		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Rodenticides
HCH, beta-(Surrogate)	Surrogate: beta-Hexachlorocyclohexane (HCH) (beta-BHC)	319857		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
HCH, delta-	delta-Hexachlorocyclohexane (HCH) (delta-BHC)	319868		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Rodenticides
HCH, delta-(Surrogate)	Surrogate: delta-Hexachlorocyclohexane (HCH) (delta-BHC)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
HCH, gamma-	gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane)	58899		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors	Rodenticides
HCH, gamma-(Surrogate)	Surrogate: gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
HCH, gamma-/PCB 015/18	gamma-HCH/PCB 15/18	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides/PCBs
HCH, gamma-/PCB 015/20	gamma-HCH/PCB 15/20	0			ug/Kg dw				Organics	Pesticides/PCBs
HCH, gamma-/PCB 015/21	gamma-HCH/PCB 15/21	0			ug/Kg dw				Organics	Pesticides/PCBs
HCH, gamma-/PCB 015/22	gamma-HCH/PCB 15/22	0			ug/Kg dw				Organics	Pesticides/PCBs
HCH, gamma-/PCB 015/23	gamma-HCH/PCB 15/23	0			ug/Kg dw				Organics	Pesticides/PCBs
HCH, gamma-/PCB 015/24	gamma-HCH/PCB 15/24	0			ug/Kg dw				Organics	Pesticides/PCBs
HCH, gamma-/PCB 015/25	gamma-HCH/PCB 15/25	0			ug/Kg dw				Organics	Pesticides/PCBs
HCH, gamma-/PCB 015/26	gamma-HCH/PCB 15/26	0			ug/Kg dw				Organics	Pesticides/PCBs
HCH-13C6, alpha-(IsoDilAnalogue)	Isotope Dilution Analogue: alpha-Hexachlorocyclohexane-13C6 (HCH) (alpha-BHC)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
HCH-13C6, alpha-(IsoDilAnalogues)	Isotope Dilution Analogue: alpha-Hexachlorocyclohexane-13C6 (HCH) (alpha-BHC)	222966667					% recovery	% recovery	Organics	Pest-OCHs	IDA
HCH-13C6, beta-(IsoDilAnalogues)	Isotope Dilution Analogue: beta-Hexachlorocyclohexane-13C6 (HCH) (beta-BHC)	222966689		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
HCH-13C6, delta-(IsoDilAnalogue)	Isotope Dilution Analogue: delta-Hexachlorocyclohexane-13C6 (HCH) (delta-BHC)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
HCH-13C6, gamma-(IsoDilAnalogue)	Isotope Dilution Analogue: gamma-Hexachlorocyclohexane-13C6 (HCH) (gamma-BHC) (Lindane)	104215852		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
HCH-d6, gamma-(IsoDilAnalogue)	Isotope Dilution Analogue: HCH-d6, gamma-	0		% recovery
HCH-d6, gamma-(Surrogate)	Surrogate: gamma-Hexachlorocyclohexane-d6 (HCH-d6) (gamma-BHC-d6) (Lindane-d6)	0			% recovery				Organics	Pesticides
Heavy Urban Other Extent	Heavy Urban Other Extent	0	none						Habitat
Heavy Urban Other Intensity	Heavy Urban Other Intensity	0	none						Habitat
Heavy Urban Other Proximity	Heavy Urban Other Proximity	0	none						Habitat
Helicobacter, Avian (GFD)	Avian Helicobacter, Assay name: GFD, 5'-TCGGCTGAGCACTCTAGGG-3', 5'-GCGTCTCTTTGTACATCCCA-3'	0		gc/mL	none				Microbiological
Heneicosane, n-	n-Heneicosane	629947					ng/g ww	ng/g dw	Organics	Alkanes
Hentriacontane, n-	n-Hentriacontane	630046					ng/g ww	ng/g dw	Organics	Alkanes
Hepatitis A Virus	Hepatitis A Virus	0		copies/100 mL					Microbiological	Pathogens
Heptachlor	Heptachlor	76448		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors
Heptachlor Epoxide	Heptachlor Epoxide	1024573		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors
Heptachlor Epoxide(Surrogate)	Surrogate: Heptachlor Epoxide	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Heptachlor Epoxide/Oxychlordane	Heptachlor Epoxide/Oxychlordane	0		pg/L					Organics	Pesticides
Heptachlor Epoxide-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Heptachlor Epoxide-13C10	0		% recovery	% recovery		% recovery	% recovery
Heptachlor Epoxide-13C10(Surrogate)	Surrogate: Heptachlor Epoxide-13C10	0			% recovery				Organics	Pesticides
Heptachlor(Surrogate)	Surrogate: Heptachlor	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Heptachlor-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Heptachlor-13C10	0		% recovery	% recovery		% recovery	% recovery
Heptachlor-13C10(Surrogate)	Surrogate: Heptachlor-13C10	0			% recovery				Organics	Pesticides
Heptachlorobenzene	Heptachlorobenzene	0			ug/Kg dw				Organics	Pesticides
Heptacosane, n-	n-Heptacosane	593497					ng/g ww	ng/g dw	Organics	Alkanes
Heptadecane, n-	n-Heptadecane	629787					ng/g ww	ng/g dw	Organics	Alkanes
Hexa(Methoxymethyl)Melamine	Hexa(Methoxymethyl)Melamine (HMMM)	3089110		ng/L					Organics	Tire- and Vehicle-derived Contaminants
Hexabromobenzene	Hexabromobenzene (HBBZ)	87821			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
Hexabromobenzene-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Hexabromobenzene-13C6 (HBB-13C6)	2483735506					% recovery	% recovery	Organics	FlameRetardants	IDA
Hexabromocyclododecane, alpha-	alpha-Hexabromocyclododecane (alpha-HBCDD)	0			ng/g dw		ng/g ww	ng/g dw	Organics	FlameRetardants
Hexabromocyclododecane, beta-	beta-Hexabromocyclododecane (beta-HBCDD)	0			ng/g dw		ng/g ww	ng/g dw	Organics	FlameRetardants
Hexabromocyclododecane, gamma-	gamma-Hexabromocyclododecane (gamma-HBCDD)	0			ng/g dw		ng/g ww	ng/g dw	Organics	FlameRetardants
Hexabromocyclododecane-13C12(Surrogate)	Surrogate: Hexabromocyclododecane-13C12 (HBCDD)	0					% recovery	% recovery	Organics	FlameRetardants
Hexachloro(phenyl)norbornene	Hexachloro(phenyl)norbornene (HCPN)	0			ng/g dw				Organics	FlameRetardants
Hexachlorobenzene	Hexachlorobenzene	118741		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors	Fungicides
Hexachlorobenzene(Surrogate)	Surrogate: Hexachlorobenzene	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Hexachlorobenzene-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Hexachlorobenzene-13C6	0		% recovery	% recovery		% recovery	% recovery
Hexachlorobenzene-13C6(Surrogate)	Surrogate: Hexachlorobenzene-13C6	0			% recovery				Organics	Pesticides
Hexachlorobutadiene	Hexachlorobutadiene	87683		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs	SVOCs	Fungicides
Hexachlorocyclopentadiene	Hexachlorocyclopentadiene (HCCPD)	77474		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Hexachlorocyclopentadienyldibromocyclooctane	Hexachlorocyclopentadienyldibromocyclooctane (HCDBCO)	51936551			ng/g dw				Organics	FlameRetardants
Hexachloroethane	Hexachloroethane	67721		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Hexacosane, n-	n-Hexacosane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes
Hexadecane, n-	n-Hexadecane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes
Hexafluoropropylene Oxide Dimer Acid	Hexafluoropropylene Oxide Dimer Acid (HFPO-DA)	13252136		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Hexafluoropropylene Oxide Dimer Acid-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Hexafluoropropylene Oxide Dimer Acid-13C3 (HFPO-DA-13C3)	3030247970		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Hexahydro-1,3,5-trinitro-1,3,5-triazine	Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX)	121824		ug/L	ug/Kg dw				Organics
Hexanone, 2-	2-Hexanone	591786		ug/L					Organics	VOCs
Hexazinone	Hexazinone	51235042		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Triazines	Herbicides
HF183TMSIPP	HF183TMSIPP	0		copies/100mL					Microbiological
High Concentration of Salts Extent	High Concentration of Salts Extent	0	none						Habitat
High Concentration of Salts Intensity	High Concentration of Salts Intensity	0	none						Habitat
High Concentration of Salts Proximity	High Concentration of Salts Proximity	0	none						Habitat
Highway >2 lanes Extent	Highway >2 lanes Extent	0	none						Habitat
Highway >2 lanes Intensity	Highway >2 lanes Intensity	0	none						Habitat
Highway >2 lanes Proximity	Highway >2 lanes Proximity	0	none						Habitat
Hiking Trails	Hiking Trails	0	none						Habitat
Holmium	Holmium	7440600		ug/L					Inorganics
Homeless Encampment, Distance from Transect	Homeless Encampment, Distance from Transect	0	m						Habitat	Debris
Homeless Encampment, Distance from Transect Downstream	Homeless Encampment, Distance from Transect Downstream	0	m						Habitat	Debris
Homeless Encampment, Distance from Transect Upstream	Homeless Encampment, Distance from Transect Upstream	0	m						Habitat	Debris
Homeless Encampment, Within Transect	Homeless Encampment, Within Transect	0	none						Habitat	Debris
Homoanatoxin-a	Homoanatoxin-a	142926861		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Hopane, C29-	C29-Hopane	0					ng/g ww	ng/g dw	Organics	Hopanes
Hopane, C30-	C30-Hopane	0					ng/g ww	ng/g dw	Organics	Hopanes
Horses Extent	Horses Extent	0	none						Habitat
Horses Intensity	Horses Intensity	0	none						Habitat
Horses Proximity	Horses Proximity	0	none						Habitat
Hose Piece	Hose Piece	0	pieces						Debris	Trash	Non-Plastics	Household
Household	Household	0	L						Debris	Trash	Plastics
Household, Other	Household, Other	0	pieces						Debris	Trash	Plastics	Non-Plastics	Household
HpCDD, 1,2,3,4,6,7,8-	1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD)	35822469		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HPCDD, 1,2,3,4,6,7,8- (TEQ ND=0)	1,2,3,4,6,7,8-HPCDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
HPCDD, 1,2,3,4,6,7,8- (TEQ ND=1/2 DL)	1,2,3,4,6,7,8-HPCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
HpCDD, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD)	35822469		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HpCDD-13C, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin-13C (HpCDD)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
HpCDD-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin-13C12 (HpCDD-13C12)	109719837		% recovery					Organics	Dioxins/Dibenzofurans	IDA
HpCDF, 1,2,3,4,6,7,8-	1,2,3,4,6,7,8-Heptachlorodibenzofuran (HpCDF)	67562394		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HPCDF, 1,2,3,4,6,7,8- (TEQ ND=0)	1,2,3,4,6,7,8-HPCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
HPCDF, 1,2,3,4,6,7,8- (TEQ ND=1/2 DL)	1,2,3,4,6,7,8-HPCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
HpCDF, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran	0		% recovery			% recovery	% recovery	Organics	DioxinsDibenzofurans
HpCDF, 1,2,3,4,7,8,9-	1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF)	55673897		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HPCDF, 1,2,3,4,7,8,9- (TEQ ND=0)	1,2,3,4,7,8,9-HPCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
HPCDF, 1,2,3,4,7,8,9- (TEQ ND=1/2 DL)	1,2,3,4,7,8,9-HPCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
HpCDF, 1,2,3,4,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF)	67562394		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HpCDF-13C, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran-13C (HpCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
HpCDF-13C, 1,2,3,4,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran-13C (HpDDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
HpCDF-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,6,7,8-Heptachlorodibenzofuran-13C12 (HpCDF-13C12)	109719848		% recovery					Organics	Dioxins/Dibenzofurans	IDA
HpCDF-13C12, 1,2,3,4,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,7,8,9-Heptachlorodibenzofuran-13C12 (HpCDF-13C12)	109719940		% recovery					Organics	Dioxins/Dibenzofurans	IDA
Human Adenovirus		0		copies/100 mL	copies/g dw
Human Marker (HF183)	Human Marker (HF183)	0		gc/mL	copies/g dw
Human Norovirus GI		0		copies/100 mL
Human Norovirus GII		0		copies/100 mL
Human Waste/Diaper	Human Waste/Diaper	0	pieces						Debris	Trash	Non-Plastics	Toxic
Human_HF183TMCaMan	Human_HF183TMCaMan	0		copies/100mL					Microbiological
HumanHealth	HumanHealth using Trash Protocol	0	score						Trash
HxCDD, 1,2,3,4,7,8-	1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	39227286		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HXCDD, 1,2,3,4,7,8- (TEQ ND=0)	1,2,3,4,7,8-HXCDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
HXCDD, 1,2,3,4,7,8- (TEQ ND=1/2 DL)	1,2,3,4,7,8-HXCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
HxCDD, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	39227286		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HxCDD, 1,2,3,6,7,8-	1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	57653857		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HXCDD, 1,2,3,6,7,8- (TEQ ND=0)	1,2,3,6,7,8-HXCDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
HXCDD, 1,2,3,6,7,8- (TEQ ND=1/2 DL)	1,2,3,6,7,8-HXCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
HxCDD, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	57653857		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HxCDD, 1,2,3,7,8,9-	1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin (HxCDD)	19408743		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HXCDD, 1,2,3,7,8,9- (TEQ ND=0)	1,2,3,7,8,9-HXCDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
HXCDD, 1,2,3,7,8,9- (TEQ ND=1/2 DL)	1,2,3,7,8,9-HXCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
HxCDD-13C, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin-13C (HxCDD)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
HxCDD-13C, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin-13C (HxCDD)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
HxCDD-13C12, 1,2,3,4,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD-13C12)	109719804		% recovery					Organics	Dioxins/Dibenzofurans	IDA
HxCDD-13C12, 1,2,3,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD-13C12)	109719815		% recovery					Organics	Dioxins/Dibenzofurans	IDA
HxCDD-13C12, 1,2,3,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD)	109719826		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HxCDF, 1,2,3,4,7,8-	1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF)	70648269		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HXCDF, 1,2,3,4,7,8- (TEQ ND=0)	1,2,3,4,7,8-HXCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
HXCDF, 1,2,3,4,7,8- (TEQ ND=1/2 DL)	1,2,3,4,7,8-HXCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
HxCDF, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF)	70648269		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HxCDF, 1,2,3,6,7,8-	1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF)	57117449		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HXCDF, 1,2,3,6,7,8- (TEQ ND=0)	1,2,3,6,7,8-HXCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
HXCDF, 1,2,3,6,7,8- (TEQ ND=1/2 DL)	1,2,3,6,7,8-HXCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
HxCDF, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF)	57117449		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HxCDF, 1,2,3,7,8,9-	1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF)	72918219		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HXCDF, 1,2,3,7,8,9- (TEQ ND=0)	1,2,3,7,8,9-HXCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
HXCDF, 1,2,3,7,8,9- (TEQ ND=1/2 DL)	1,2,3,7,8,9-HXCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
HxCDF, 1,2,3,7,8,9-(Surrogate)	Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF)	72918219		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HxCDF, 2,3,4,6,7,8-	2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF)	60851345		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HXCDF, 2,3,4,6,7,8- (TEQ ND=0)	2,3,4,6,7,8-HXCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
HXCDF, 2,3,4,6,7,8- (TEQ ND=1/2 DL)	2,3,4,6,7,8-HXCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
HXCDF, 2,3,4,6,7,8-(Surrogate)	Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF)	60851345		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
HxCDF-13C, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran-13C (HxCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
HxCDF-13C, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran-13C (HxCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
HxCDF-13C, 1,2,3,7,8,9-(Surrogate)	Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran-13C (HxCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
HxCDF-13C, 2,3,4,6,7,8-(Surrogate)	Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran-13C (HxCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
HxCDF-13C12, 1,2,3,4,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,7,8-Hexachlorodibenzofuran-13C12 (HxCDF-13C12)	114423982		% recovery					Organics	Dioxins/Dibenzofurans	IDA
HxCDF-13C12, 1,2,3,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,6,7,8-Hexachlorodibenzofuran-13C12 (HxCDF-13C12)	116843039		% recovery					Organics	Dioxins/DibenzofuransDioxins/Dibenzofurans	IDA
HxCDF-13C12, 1,2,3,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8,9-Hexachlorodibenzofuran-13C12 (HxCDF-13C12)	116843040		% recovery					Organics	Dioxins/Dibenzofurans	IDA
HxCDF-13C12, 2,3,4,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,4,6,7,8-Hexachlorodibenzofuran-13C12 (HxCDF-13C12)	116843051		% recovery					Organics	Dioxins/Dibenzofurans	IDA
Hydramethylnon	Hydramethylnon	0		ug/L					Organics	Pesticides	Insecticides
Hydraulic Height	Height from bottom of stream to top of bankfull height or the summation of station water depth and bankfull height	0	m						Habitat
Hydrochlorothiazide	Hydrochlorothiazide	58935		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Hydrocodone	Hydrocodone	125291		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Hydrocodone-d3(Surrogate)	Surrogate: Hydrocodone-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Hydrocortisone	Hydrocortisone	50237		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Hydrocortisone-d4(Surrogate)	Surrogate: Hydrocortisone-d4	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Hydrolyzable Phosphorus + Orthophosphate as P	Hydrolyzable Phosphorus + Orthophosphate as P	0		mg/L					Inorganics	Conventionals
Hydroperiod	Hydroperiod of the waterbody	0	none						Habitat
Hydroxide	Hydroxide	14280309		ug/L	mg/Kg dw				Inorganics	Conventionals
Hydroxide Alkalinity as CaCO3	Hydroxide Alkalinity as CaCO3	471341		mg/L					Inorganics	Conventionals	WaterQualityMeasurements
Hydroxy-amitriptyline, 10-	10-Hydroxy-amitriptyline	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Hydroxyatrazine, 2-	2-Hydroxyatrazine	2163680		ug/L					Organics	Pesticides	Pest-Triazines
Hydroxycarbofuran, 3-	3-Hydroxycarbofuran	16655826		ug/L	ug/Kg dw				Organics	Pesticides	Insecticides	Carbamates
Hydroxy-ibuprofen, 2-	2-Hydroxy-ibuprofen	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Hydroxy-Imidacloprid, 5-	5-Hydroxy-Imidacloprid	380912094		ug/L					Organics	Pesticides
Hydroxypropanal, 3-	3-Hydroxypropanal	2134294		ug/L					Organics	Pesticides
Ibuprofen	Ibuprofen	15687271		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Ibuprofen-13C3(Surrogate)	Surrogate: Ibuprofen-13C3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Ibuprofen-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Ibuprofen-d3	121662144		% recovery					Organics
Imazalil	Imazalil	35554440		ug/L	ug/Kg dw				Organics	Pesticides	Fungicides
Imazamox	Imazamox	114311329		ug/L					Organics
Imazapyr	Imazapyr	0		ug/L					Organics	Pesticides	Herbicides
Imazaquin	Imazaquin	81335377		ug/L					Organics	Herbicides
Imazethapyr	Imazethapyr	81335775		ug/L					Organics	Herbicides
Imidacloprid	Imidacloprid	138261413		ug/L	ng/g dw				Organics	PPCPs
Imidacloprid guanidine	Imidacloprid guanidine	0		ug/L					Organics	Pesticides
Imidacloprid guanidine olefin	Imidacloprid guanidine olefin	0		ug/L					Organics	Pesticides
Imidacloprid olefin	Imidacloprid olefin	115086549		ug/L					Organics	Pesticides
Imidacloprid urea	Imidacloprid urea	120868668		ug/L					Organics	Pesticides
Imidacloprid-d4(Surrogate)	Surrogate: Imidacloprid-d4	0		% recovery					Organics	Pesticides	Insecticides
Incised Height	Incised Height	0	m						Habitat
Increment	Increment	0	m						Habitat
Indeno(1,2,3-c,d)pyrene	Indeno(1,2,3-c,d)pyrene	193395		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Indeno(1,2,3-c,d)pyrene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Indeno(1,2,3-c,d)pyrene-d12	203578330		% recovery					Organics	PAHs	IDA
Indeno(1,2,3-c,d)pyrene-d12(Surrogate)	Surrogate: Indeno(1,2,3-c,d)pyrene-d12	0		% recovery	% recovery		% recovery	% recovery	Organics	PAHs
Indole	Indole	120729			ug/Kg dw				Organics
Indoxacarb	Indoxacarb	173584446		ug/L	ug/Kg dw				Organics	Pesticides	Ozadiazine	Insecticides
Industrial Extent	Industrial Extent	0	none						Habitat
Industrial Intensity	Industrial Intensity	0	none						Habitat
Industrial Plants	Industrial Plants	0	none						Habitat
Industrial Proximity	Industrial Proximity	0	none						Habitat
Industrial Water Quality Other Extent	Industrial Water Quality Other Extent	0	none						Habitat
Industrial Water Quality Other Intensity	Industrial Water Quality Other Intensity	0	none						Habitat
Industrial Water Quality Other Proximity	Industrial Water Quality Other Proximity	0	none						Habitat
Instream Plant Cover	Instream Plant Cover	0	none						Habitat
IntertidalSubstrateCharacteristics_Mud	IntertidalSubstrateCharacteristics_Mud	0	none						Habitat	Debris
IntertidalSubstrateCharacteristics_Rocky	IntertidalSubstrateCharacteristics_Rocky	0	none						Habitat	Debris
IntertidalSubstrateCharacteristics_Sand	IntertidalSubstrateCharacteristics_Sand	0	none						Habitat	Debris
IntertidalSubstrateCharacteristics_Vegetated	IntertidalSubstrateCharacteristics_Vegetated	0	none						Habitat	Debris
Invasive Plants Extent	Invasive Plants Extent	0	none						Habitat
Invasive Plants Intensity	Invasive Plants Intensity	0	none						Habitat
Invasive Plants Proximity	Invasive Plants Proximity	0	none						Habitat
Iodomethane	Iodomethane	74884		ug/L
Iohexol	Iohexol	66108950		ng/L
Iopromide	Iopromide	73334073		ng/L
Iopromide-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Iopromide-d3	1189947736		% recovery					Organics
Ipconazole	Ipconazole	125225287		ng/L					Organics	Pesticides	Fungicides
IPI	Score for the Index of Physical-habitat Integrity (IPI)	0	score						Bioassessment
IPI_Ev_FlowHab_qa	Quality assurance metric for the evenness of flow habitat types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment
IPI_Ev_FlowHab_score	Scored evenness of flow habitat types physical-habitat metric	0	score						Bioassessment
IPI_H_AqHab_pred	Predicted Shannon diversity of natural instream cover types physical-habitat metric	0	none						Bioassessment
IPI_H_AqHab_qa	Quality assurance metric for the Shannon diversity of natural instream cover types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment
IPI_H_AqHab_score	Scored Shannon diversity of natural instream cover types physical-habitat metric	0	score						Bioassessment
IPI_H_SubNat_qa	Quality assurance metric for the Shannon diversity of natural substrate types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment
IPI_H_SubNat_score	Scored Shannon diversity of natural substrate types physical-habitat metric	0	score						Bioassessment
IPI_IPI_qa	Quality assurance metric for the Index of Physical-habitat Integrity score, calculated as the minimum of other quality assurance metric values	0	count						Bioassessment
IPI_PCT_SAFN_pred	Predicted percent sands and fines streambed substrate physical-habitat metric	0	%						Bioassessment
IPI_PCT_SAFN_qa	Quality assurance metric for the percent sands and fines physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment
IPI_PCT_SAFN_score	Scored percent sands and fines streambed substrate physical-habitat metric	0	score						Bioassessment
IPI_XCMG_pred	Predicted riparian cover as sum of three layers physical-habitat metric	0	%						Bioassessment
IPI_XCMG_qa	Quality assurance metric for the riparian cover metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment
IPI_XCMG_score	Scored riparian cover as sum of three layers physical-habitat metric	0	score						Bioassessment
Iprodione	Iprodione	36734197		ug/L	ug/Kg dw				Organics	Fungicides
Iron	Iron	7439896		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Conventionals	Metals
Irrigation Equipment	Irrigation Equipment	0	none						Habitat
Isoborneol	Isoborneol	124765			ug/Kg dw				Organics
Isodrin	Isodrin	0					ug/Kg ww	ug/Kg dw	Organics	Pesticides
Isodrin-13C12(Surrogate)	Surrogate: Isodrin-13C12	0			% recovery				Organics	Pesticides
Isofenphos	Isofenphos	25311711		ug/L					Organics	Pesticides
Isophorone	Isophorone	78591		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Isopropyl Alcohol	Isopropyl Alcohol (2-propanol)	67630		ug/L
Isopropylbenzene	Isopropylbenzene (Cumene)	98828		ug/L	ug/Kg dw				Organics	VOCs
Isopropyltoluene, p-	p-Isopropyltoluene	99876		ug/L					Organics	VOCs
Isoquinoline	Isoquinoline	119653			ug/Kg dw				Organics
Isoxaben	Isoxaben (Flexidor) (Gallery)	82558507		ug/L					Organics	Pesticides
Isoxaben(Surrogate)	Surrogate: Isoxaben (Flexidor) (Gallery)	82558507		% recovery					Organics	Herbicides
ITEQ	International Toxic Equivalent (ITEQ)	0					pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans
Jasmolin-1	Jasmolin-1 (Jasmolin I)	4466142		ug/L	ng/g dw				Organics	Pesticides	Pyrethroids
Jasmolin-2	Jasmolin-2 (Jasmolin II)	1172630		ug/L	ng/g dw				Organics	Pesticides	Pyrethroids
Kelp holdfast	Kelp holdfast	0	pieces						Debris	Natural	Non-Plastics	Marine Origin
Kelp Stipe/Blade	Kelp Stipe/Blade	0	pieces						Debris	Natural	Non-Plastics	Marine Origin
Kepone	Kepone (Chlordecone)	143500		ug/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs
Ketocarbofuran, 3-	3-Ketocarbofuran	16709301		ug/L					Organics	Pesticides	Pest-Carbamates
Keyboard	Keyboard	0	pieces						Debris	Trash	Plastics	Toxic
Kresoxim-methyl	Kresoxim-methyl	143390890		ug/L	ug/Kg dw				Organics	Fungicides
Lachnospiraceae, Canine (DG37)	Canine Lachnospiraceae, Assay name: DG37, 5'-TTTTCTCCCACGGTCATCTG-3', 5'-CTTGGTTATGGGCGACATTG-3'	0		copies/100 mL					Microbiological
Landfill Extent	Landfill Extent	0	none						Habitat
Landfill Intensity	Landfill Intensity	0	none						Habitat
Landfill Proximity	Landfill Proximity	0	none						Habitat
Lanthanum	Lanthanum	7439910		ug/L	ug/g dw				Inorganics
Large/Unmovable, Other	Large/Unmovable, Other	0	pieces						Debris	Trash	Non-Plastics	Large
Lead	Lead	7439921		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Length	Length	0	m						Tissue	Habitat	WaterQualityMeasurements	Conventionals
Length Downstream	Length Downstream from X location	0	m						Habitat
Length Pool	Length Pool	0	m						Habitat
Length Reach	Length Reach	0	m						Habitat
Length Riffle	Length Riffle	0	m						Habitat
Length Root	Length Root	0				mm			Toxicity
Length Shoot	Length Shoot	0				mm			Toxicity
Length Upstream	Length Upstream from X location	0	m						Habitat
Length, Segment	Segment Length	0	m						Habitat
Leptophos	Leptophos	21609905		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides
Level Of Trash	Level Of Trash using Trash Protocol	0	score						Trash
Lid	Lid	0	pieces						Debris	Trash	Plastics	FoodService
Light Urban Other Extent	Light Urban Other Extent	0	none						Habitat
Light Urban Other Intensity	Light Urban Other Intensity	0	none						Habitat
Light Urban Other Proximity	Light Urban Other Proximity	0	none						Habitat
Lighter	Lighter	0	pieces						Debris	Trash	Plastics	Toxic
Liming	Liming	0	none						Habitat
Limonene, d-	d-Limonene	0			ug/Kg dw				Organics
Lincomycin	Lincomycin	154212		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Linuron	Linuron	330552		ug/L					Organics	Pesticides	Herbicides
Linuron-d6(Surrogate)	Surrogate: Linuron-d6	1219804768		% recovery					Organics	Pesticides	Herbicides
Lipid	Lipid	0		% recovery			NR ww	NR dw	Organics	Inorganics	Conventionals
Lithium	Lithium	7439932		ug/L			ug/g ww	ug/g dw	Inorganics	Metals
Littering	Littering using Trash Protocol	0	score						Trash
Livestock Use	Livestock Use	0	none						Habitat
Logging	Logging	0	none						Habitat
Lomefloxacin	Lomefloxacin	98079517		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Loss On Ignition	Loss On Ignition (LOI)	0			% dw				Inorganics	Conventionals
LWD >0.8 DLE, Length >15m	LWD >0.8 DLE, Length >15m	0	count						Habitat
LWD >0.8m DLE, Length 1.5-5m	LWD >0.8m DLE, Length 1.5-5m	0	count						Habitat
LWD >0.8m DLE, Length 5-15m	LWD >0.8m DLE, Length 5-15m	0	count						Habitat
LWD 0.1-<0.3m DLE, Length >15m	LWD 0.1-<0.3m DLE, Length >15m	0	count						Habitat
LWD 0.1-<0.3m DLE, Length 1.5-5m	LWD 0.1-<0.3m DLE, Length 1.5-5m	0	count						Habitat
LWD 0.1-<0.3m DLE, Length 5-15m	LWD 0.1-<0.3m DLE, Length 5-15m	0	count						Habitat
LWD 0.3-<0.6m DLE, Length >15	LWD 0.3-<0.6m DLE, Length >15	0	count						Habitat
LWD 0.3-<0.6m DLE, Length 1.5-5m	LWD 0.3-<0.6m DLE, Length 1.5-5m	0	count						Habitat
LWD 0.3-<0.6m DLE, Length 5-15m	LWD 0.3-<0.6m DLE, Length 5-15m	0	count						Habitat
LWD 0.6-<0.8m DLE, Length >15m	LWD 0.6-<0.8m DLE, Length >15m	0	count						Habitat
LWD 0.6-<0.8m DLE, Length 1.5-5m	LWD 0.6-<0.8m DLE, Length 1.5-5m	0	count						Habitat
LWD 0.6-<0.8m DLE, Length 5-15	LWD 0.6-<0.8m DLE, Length 5-15	0	count						Habitat
LWD A	Large Woody Debris in the A class of corresponding Diameter and Length categories	0	count						Habitat
LWD L	Large Woody Debris in the L class of corresponding Diameter and Length categories	0	count						Habitat
LWD M	Large Woody Debris in the M class of corresponding Diameter and Length categories	0	count						Habitat
LWD S	Large Woody Debris in the S class of corresponding Diameter and Length categories	0	count						Habitat
LWD T	Large Woody Debris in the T class of corresponding Diameter and Length categories	0	count						Habitat
Lyngbyatoxin-a	Lyngbyatoxin-a	0		ug/L					Microbiological	Cyanotoxins
Macroalgae Cover, Attached	Presence/Absence of attached macroalgae at a point along a transect	0	none						Habitat
Macroalgae Cover, Unattached	Presence/Absence of unattached macroalgae at a point along a transect	0	none						Habitat
Macroinvertebrate Habitat Patch Richness Metric	Metric assesses macroinvertebrate habitat patch richness along the channel edge and bank within the assessment area.	0	score						Habitat
Macrophyte Cover	Presence/Absence of macrophytes at a point along a transect	0	none						Habitat
Magnesium	Magnesium	7439954		ug/L	mg/Kg dw		ug/g ww	ug/g dw	Inorganics	Conventionals	Metals	AlkalineEarthMetals
Maintained Lawns	Maintained Lawns	0	none						Habitat
Malachite Green	Malachite Green	569642		ug/L					Organics
Malaoxon	Malaoxon	1634782		ug/L					Organics	Pesticides
Malathion	Malathion	121755		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Endocrine Disruptors
Male-specific F+ Coliphage (E. coli Famp)	Male-specific F+ coliphages, Host Bacterium Strain: E. coli Famp	0		PFU/L
Malonate(Surrogate)	Surrogate: Malonate	141822		% recovery
Mancozeb	Mancozeb	0		ug/L					Organics	Pesticides	Fungicides
Mandipropamid	Mandipropamid	374726622		ng/L					Organics	Pesticides	Fungicides
Manganese	Manganese	7439965		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals	Conventionals
Marbon CNB 23010-1	Marbon CNB 23010 (VCH-DP isomer 1)	26595573			ng/g dw				Organics	FlameRetardants
Marbon CNB 23010-2	Marbon CNB 23010 (VCH-DP isomer 2)	26595573			ng/g dw				Organics	FlameRetardants
Marine, Other	Marine, Other	0	pieces						Debris	Natural	Non-Plastics	Marine Origin
MBAS	MBAS (Methylene Blue Active Substances)	0		ug/L	mg/Kg dw				Inorganics	Surfactants
MCPA	MCPA (2-Methyl-4-chlorophenoxy)Acetic Acid) (2,4-MCPA)	94746		ug/L	ug/kg				Organics	Herbicides
MCPA, dimethylamine salt	MCPA, dimethylamine salt	2039465		ug/L					Organics	Pesticides
MCPP	MCPP (2-(2-Methyl-4-chlorophenoxy) Propionic Acid)	93652		ug/L	ug/kg				Organics	Herbicides
Mean Growth (Ash Free Dry Weight)	Mean Growth (Ash Free Dry Weight)	0				mg			Toxicity	Endpoint
Mean Percent Normal Alive	The observed number of normal larvae divided by the mean number of live embryos inoculated at the beginning of the test	0				%			Toxicity	Endpoint
Mechanical Pencil	Mechanical Pencil	0	pieces						Debris	Trash	Plastics	Household
Median Grain Size	Median Grain Size	0			mm				Inorganics	Conventionals
Medical Device	Medical Device	0	pieces						Debris	Trash	Plastics	Toxic
Menthol	Menthol	0			ug/Kg dw				Organics
Meprobamate	Meprobamate	57534		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Mercury	Mercury	7439976		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Mercury (II)R	Reactive Mercury	0		ug/L					Inorganics	Metals
Mercury, Acid Labile	Acid Labile Mercury	0		ug/L					Inorganics	Metals
Mercury, Extract Fraction 1	Mercury selective sequential extraction, Fraction 1	0			ng/g dw				Inorganics
Mercury, Extract Fraction 2	Mercury selective sequential extraction, Fraction 2	0			ng/g dw				Inorganics
Mercury, Extract Fraction 3	Mercury selective sequential extraction, Fraction 3	0			ng/g dw				Inorganics
Mercury, Extract Fraction 4	Mercury selective sequential extraction, Fraction 4	0			ng/g dw				Inorganics
Mercury, Extract Fraction 5	Mercury selective sequential extraction, Fraction 5	0			ng/g dw				Inorganics
Mercury, Methyl	Methyl Mercury	22967926		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Merphos	Merphos (Tributylphosphorotrithioite)	150505		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs
Metabolite B	Metabolite B (metabolite of Benzobicyclon)	0		ug/L
Metal Object	Metal Object	0	pieces						Debris	Trash	Non-Plastics	Metals
Metal Pipe/Bar	Metal Pipe/Bar	0	pieces						Debris	Trash	Non-Plastics	Metals
Metal, Other	Metal, Other	0	pieces						Debris	Trash	Non-Plastics	Metals
Metalaxyl	Metalaxyl	57837191		ug/L	ug/Kg dw				Organics	Herbicides
Metconazole	Metconazole	125116236		ug/L	ug/Kg dw				Organics	Fungicides
MeterAveragingInterval	Time period (seconds) upon which the meter reading is averaged internally to attain a result	0		seconds					WaterQualityMeasurements
Metformin	Metformin	657249		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Metformin-d6(Surrogate)	Surrogate: Metformin-d6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Methadone	Methadone	76993		ng/L
Methamidophos	Methamidophos (O,S-Dimethyl thiophosphate)	10265926		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Methidathion	Methidathion	950378		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Methidathion oxon	Methidathion oxon	0		ug/L					Organics	Pesticides
Methiocarb	Methiocarb	2032657		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides
Methiocarb sulfone	Methiocarb sulfone	2179251		ug/L					Organics	Pesticides
Methiocarb sulfoxide	Methiocarb sulfoxide	2635101		ug/L					Organics	Pesticides
Methomyl	Methomyl	16752775		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OPs	Insecticides
Methoprene	Methoprene	40596698		ug/L	ug/Kg dw				Organics	Pesticides
Methoxychlor	Methoxychlor	72435		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors
Methoxychlor(Surrogate)	Surrogate: Methoxychlor	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	OrganochlorinePesticides	Semi-VOAs	Insecticides	Endocrine Disruptors
Methoxychlor-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Methoxychlor-13C12	0			% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Methoxychlor-d6(Surrogate)	Surrogate: Methoxychlor-d6	0			% recovery				Organics	Pesticides
Methoxyfenozide	Methoxyfenozide	161050584		ug/L					Organics	Pesticides	Insecticides
Methoxy-methylsulfanylphosphoryl acetamide, N-	N-Methoxy-methylsulfanylphosphoryl acetamide (Acephate)	0		ug/L					Organics	Pesticides	Insecticides
Methyl (3,4-dichlorophenyl)carbamate	Methyl (3,4-dichlorophenyl)carbamate (Swep)	1918189		ug/L					Organics	Pesticides	Pest-Carbamates
Methyl 2,4-dichlorophenylacetate	Methyl 2,4-dichlorophenylacetate (2,4-DCAA)	55954239		ug/L
Methyl 3-Amino-2,5-dichlorobenzoate	Methyl 3-Amino-2,5-dichlorobenzoate (Chloramben Methyl)	7286840		ug/L					Organics	Herbicides
Methyl paraoxon	Methyl paraoxon	950356		ug/L					Organics	Pesticides
Methyl Perfluoroocatanesulfonamidoacetic Acid, N-	N-Methyl Perfluoroocatanesulfonamidoacetic Acid (NMeFOSAA)	2355319		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Methyl Perfluorooctane Sulfonamido Acetic Acid, N-	N-Methyl Perfluorooctane Sulfonamido Acetic Acid (Me-PFOSA-AcOH)	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS	PFC Precursor
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3 (N-MeFOSAA-d3)	1400690701		% recovery					Organics	PFAS	IDA
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(Surrogate)	Surrogate: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3	0					% recovery	% recovery	Organics	PFAS	PFC Precursor
Methyl Perfluorooctanesulfonamide, N-	N-Methyl Perfluorooctanesulfonamide (NMeFOSA)	31506328		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Methyl Perfluorooctanesulfonamide-d3, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctanesulfonamide-d3 (NMeFOSA-d3)	936109374		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Methyl Perfluorooctanesulfonamidoacetic Acid, N-	N-Methyl Perfluorooctanesulfonamidoacetic Acid (NMeFOSAA)	2355319		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Methyl Perfluorooctanesulfonamidoacetic Acid-d3, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctanesulfonamidoacetic Acid-d3 (NMeFOSAA-d3)	1400690701		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Methyl Perfluorooctanesulfonamidoethanol, N-	N-Methyl Perfluorooctanesulfonamidoethanol (NMeFOSE)	24448097		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Methyl Perfluorooctanesulfonamidoethanol-d7, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctanesulfonamidoethanol-d7 (NMeFOSE-d7)	1265205955		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Methyl Tert-butyl Ether	Methyl Tert-butyl Ether (MTBE)	1634044		ug/L					Organics	VOCs	MTBE_BTEX
Methyl-1(H)-indole, 3-	3-Methyl-1(H)-indole (Skatole)	83341			ug/Kg dw				Organics
Methyl-1H-benzotriazole, 5-	5-Methyl-1H-benzotriazole	136856		ng/L					Organics
Methyl-2-pentanone, 4-	4-Methyl-2-pentanone (Methyl Isobutyl Ketone)	108101		ug/L					Organics	VOCs
Methylanthracene	Methylanthracene	0		pg/L	ug/Kg dw				Organics	PAHs
Methylanthracene, 2-	2-Methylanthracene	613127			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	Semi-VOAs
Methylbenzo(a)pyrene, 7-	7-Methylbenzo(a)pyrene	63041770		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs
Methylchlolanthrene, 3-	Methylchlolanthrene, 3-	0		ng/L					Organics	PAHs
Methylchrysene, 1-	1-Methylchrysene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs
Methylchrysene, 5/6-	5-Methylchrysene/6-Methylchrysene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs
Methyldibenzothiophene, 2-	2-Methyldibenzothiophene	0		ng/L					Organics	PAHs
Methyldibenzothiophene, 4-	4-Methyldibenzothiophene	7372885		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs
Methyldibenzothiophenes, 2/3-	2-Methyldibenzothiophene/3-Methyldibenzothiophene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs
Methylene Chloride	Methylene Chloride (Dichloromethane)	75092		ug/L					Organics	VOCs
Methylenebis(2-chloroaniline), 4,4'-	4,4'-Methylenebis(2-chloroaniline)	0					ug/Kg ww	ug/Kg dw	Organics	VOCs
Methylfluoranthene, 2-	2-Methylfluoranthene	33543316		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH
Methylfluoranthene, 3-	3-Methylfluoranthene	0		ng/L					Organics	PAHs
Methylfluoranthene, 3-/Benzo(a)fluorene	3-Methylfluoranthene/Benzo(a)fluorene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	HMW_PAH
Methylfluorene, 1-	1-Methylfluorene	1730376		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs
Methylfluorene, 2-	2-Methylfluorene	1430973		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Semi-VOAs
Methylisoborneol, 2-	2-Methylisoborneol	2371428		ng/L					Organics	Terpenes/Terpinoids
Methylnaphthalene, 1-	1-Methylnaphthalene	90120		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Methylnaphthalene, 2-	2-Methylnaphthalene	91576		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Methylnaphthalene-d10, 2-(IsoDilAnalogue)	Isotope Dilution Analogue: 2-Methylnaphthalene-d10	7297452		% recovery					Organics	PAHs	IDA
Methylnaphthalene-d10, 2-(Surrogate)	Surrogate: 2-Methylnaphthalene-d10	7297452		% recovery	% recovery		% recovery	% recovery	Organics	PAHs
Methyl-perfluorooctanesulfonamide-d3, N-(Surrogate)	Surrogate: Methyl-perfluorooctanesulfonamide-d3, N- (N-MeFOSA)	0					% recovery	% recovery	Organics	PFAS
Methyl-perfluorooctanesulfonamidoethanol, N-	N-Methyl-perfluorooctanesulfonamidoethanol	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Methyl-perfluorooctanesulfonamidoethanol-d7, N-(Surrogate)	Surrogate: N-Methyl-perfluorooctanesulfonamidoethanol-d7	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Methylphenanthrene	Methylphenanthrene	0		ng/L					Organics
Methylphenanthrene, 1-	1-Methylphenanthrene	832699		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Methylphenanthrene, 2-	2-Methylphenanthrene	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Methylphenanthrene, 3-	3-Methylphenanthrene	832713			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Methylphenanthrene, 3/4-	3/4-Methylphenanthrene	0					ug/Kg ww	ug/Kg dw	Organics	PAHs
Methylphenanthrene, 9/4-	9/4-Methylphenanthrene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	LMW_PAH
Methylphenanthrene-d10, 2-(Surrogate)	Surrogate: 2-Methylphenanthrene-d10	0		% recovery					Organics	PAHs
Methylphenol, 2-	2-Methylphenol	95487		ug/L	ug/Kg dw				Organics	SVOCs	Phenols	non-Chlorinated Phenols
Methylphenol, 3-	3-Methylphenol	0		ug/L					Organics	SVOCs
Methylphenol, 3/4-	3-Methylphenol/4-Methylphenol	106445		ug/L	ug/Kg dw				Organics	SVOCs	Phenols	non-Chlorinated Phenols
Methylphenol, 4-	4-Methylphenol	0		ug/L	ug/Kg dw				Organics	SVOCs
Methylprednisolone	Methylprednisolone	83432		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Methylprednisolone-d2(Surrogate)	Surrogate: Methylprednisolone-d2	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Methylpyridine, 2-	2-Methylpyridine	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	VOCs
Metolachlor	Metolachlor	51218452		ug/L	ug/Kg dw				Organics	Herbicides
Metolachlor ethanesulfonic acid	Metolachlor ethanesulfonic acid	171118095		ug/L					Organics	Pesticides
Metolachlor oxanilic acid	Metolachlor oxanilic acid	0		ug/L					Organics	Pesticides
Metolachlor, S-	S-Metolachlor	87392129		ug/L					Organics	Pesticides
Metoprolol	Metoprolol	51384511		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Metoprolol-d7(Surrogate)	Surrogate: Metoprolol-d7	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Metribuzin	Metribuzin	21087649		ug/L			ng/g ww	ng/g dw	Organics	Herbicides
Metsulfuron Methyl	Metsulfuron Methyl	74223646		ug/L					Organics	Herbicides
Mevinphos	Mevinphos (Phosdrin)	7786347		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Mexacarbate	Mexacarbate	315184		ug/L					Organics	Pesticides	Pest-Carbamates	Insecticides
MGK 264	MGK 264 (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide)	0		ug/L
Miconazole	Miconazole	22916478		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Microalgae Thickness	Thickness of microalgae (if present) at a point along a transect	0	none						Habitat
Microcystin-[Dha7]LR	Microcystin-[dehydroalanine7]LR	0		ug/L
Microcystin-[DLeu1]LR	Microcystin-[deleucine1]LR	0		ug/L
Microcystin-HilR	Microcystin- homoisoleucineR	0		ug/L
Microcystin-HtyR	Microcystin-homotyrosineR	0		ug/L
Microcystin-LA	Microcystin-LA (MCY-LA)	96180799		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystin-LF	Microcystin-LF (MCY-LF)	154037704		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystin-LR	Microcystin-LR (MCY-LR)	101043372		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystin-LW	Microcystin-LW (MCY-LW)	157622021		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystin-LY	Microcystin-LY (MCY-LY)	123304109		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystin-RR	Microcystin-RR (MCY-RR)	111755374		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystins, Total	Total Microcystins	0		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystin-WR	Microcystin-WR (MCY-WR)	0		ug/L			ng/g ww	ng/g dw
Microcystin-YR	Microcystin-YR (MCY-YR)	101064486		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Military Land Extent	Military Land Extent	0	none						Habitat
Military Land Intensity	Military Land Intensity	0	none						Habitat
Military Land Proximity	Military Land Proximity	0	none						Habitat
Milk Carton	Milk Carton	0	pieces						Debris	Trash	Plastics	FoodService
Mines, Quaries	Mines, Quaries	0	none						Habitat
Mining Extent	Mining Extent	0	none						Habitat
Mining Intensity	Mining Intensity	0	none						Habitat
Mining Proximity	Mining Proximity	0	none						Habitat
Mirex	Mirex	2385855		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors
Mirex(Surrogate)	Surrogate: Mirex	2385855		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Mirex-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Mirex-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Mirex-13C10(Surrogate)	Surrogate: Mirex-13C10	0			% recovery				Organics	Pesticides
Miscellaneous	Miscellaneous using Trash Protocol	0	L						Trash
Miscellaneous, Other	Miscellaneous, Other	0	pieces						Debris	Trash	Plastics	Miscellaneous
Moisture	Moisture	0		ug/L	mg/Kg dw		NR ww	NR dw	Organics	Inorganics	Conventionals
Molinate	Molinate (Ordram)	2212671		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OPs
Molybdenum	Molybdenum	7439987		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals
Molybdenum, Acid Labile	Acid Labile Molybdenum	0		mg/L					Inorganics	Metals
Monobromophenyl-hexachloro-norbornene-1	Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 1)	0			ng/g dw				Organics	FlameRetardants
Monobromophenyl-hexachloro-norbornene-2	Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 2)	0			ng/g dw				Organics	FlameRetardants
Monobromophenyl-hexachloro-norbornene-3	Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 3)	0			ng/g dw				Organics	FlameRetardants
Monobutyl Monooctyl-Diphenylamine	Monobutyl Monooctyl-Diphenylamine (SDPA-C4C8)	0		ng/L					Organics	Substituted Diphenylamines (SDPAs)
Monobutyltin as Sn	Monobutyltin as Sn (MBT)	78763549		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Organotins	Biocide
Monocrotophos	Monocrotophos	6923224		ug/L	mg/Kg ww				Organics	Pesticides	Insecticides	Organophosphorous
Mono-dechlorinated Dechlorane Plus	Mono-dechlorinated Dechlorane Plus (C11-DP)	0			ng/g dw				Organics	FlameRetardants
Monomethylarsonic Acid	Monomethylarsonic Acid	0					ug/g ww	ug/g dw	Inorganics	Metals
Monuron	Monuron	150685		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Monuron(Surrogate)	Surrogate: Monuron	150685		% recovery
Mortality/Normality	Mortality/Normality (%)	0				%			Toxicity
Motor Oil	Motor Oil	0		ug/L					Organics	PAHs
Mountain Bikes Extent	Mountain Bikes Extent	0	none						Habitat
Mountain Bikes Intensity	Mountain Bikes Intensity	0	none						Habitat
Mountain Bikes Proximity	Mountain Bikes Proximity	0	none						Habitat
Mowing/Cutting Extent	Mowing/Cutting Extent	0	none						Habitat
Mowing/Cutting Intensity	Mowing/Cutting Intensity	0	none						Habitat
Mowing/Cutting Proximity	Mowing/Cutting Proximity	0	none						Habitat
Musk Ambrette	Musk Ambrette	0					ng/g ww	ng/g dw	Organics	Musk
Musk Ketone	Musk Ketone	0					ng/g ww	ng/g dw	Organics	Musk
Musk Moskene	Musk Moskene	0					ng/g ww	ng/g dw	Organics	Musk
Musk Xylene	Musk Xylene	0					ng/g ww	ng/g dw	Organics	Musk
Myclobutanil	Myclobutanil	88671890		ug/L	ug/Kg dw				Organics	Fungicides
N,N-Diethyl-3-methyl-benzamide-d7(Surrogate)	Surrogate: N,N-Diethyl-3-methyl-benzamide-d7	0		% recovery					Organics	PPCPs
Nail/Screw/Bolt	Nail/Screw/Bolt	0	pieces						Debris	Trash	Non-Plastics	Metals
Naled	Naled (Dibrom)	300765		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Rodenticides
Naphthalene	Naphthalene	91203		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH	VOCs
Naphthalene-d8(IsoDilAnalogue)	Isotope Dilution Analogue: Naphthalene-d8	1146652		% recovery					Organics	PAHs	IDA
Naphthalene-d8(Surrogate)	Surrogate: Naphthalene-d8	1146652		% recovery	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	Insecticides
Naphthalenes, C1-	C1-Naphthalenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Naphthalenes, C2-	C2-Naphthalenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Naphthalenes, C3-	C3-Naphthalenes	0		uS/cm	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Naphthalenes, C4-	C4-Naphthalenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Naphthobenzothiophene	Naphthobenzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs
Naphthobenzothiophene, C1-	C1-Naphthobenzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs
Naphthobenzothiophene, C2-	C2-Naphthobenzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs
Naphthobenzothiophene, C3-	C3-Naphthobenzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs
Naphthylamine, 2-	2-Naphthylamine	0		ug/L
Napropamide	Napropamide	15299997		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides
Naproxen	Naproxen	22204531		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Naproxen-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Naproxen-d3	958293771		% recovery					Organics
Naproxen-d3-13C(Surrogate)	Surrogate: Naproxen-d3-13C	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Napthalene	Napthalene	0		ug/L					Organics
Natural, cotton/wool	Natural, cotton/wool	0	pieces						Debris	Trash	Non-Plastics	Biodegradable
Neburon	Neburon	555373		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Neodymium	Neodymium	7440008		ug/L					Inorganics
Nickel	Nickel	7440020		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Nicosulfuron	Nicosulfuron	111991094		ug/L					Organics	Herbicides
NID as CTAS	4-Nitro-Inden-1-One (NID) as Cobalt Thiocyanate Active Substances (CTAS)	0		mg/L
Nitrate + Nitrite as N	Nitrate + Nitrite as N	0		umol/L	ug/g dw				Inorganics	Conventionals	Nutrients
Nitrate as N	Nitrate as N	14797558		umol/L	mg/Kg ww				Inorganics	Conventionals	Nutrients	WaterQualityMeasurements
Nitrate as NO3	Nitrate as Nitrate	14797558		mg/L					Inorganics	Conventionals
Nitrate as NO3, Daily Mean	Daily Mean Nitrate as Nitrate (Calculated)	14797558		umol/L					WaterQualityMeasurements	Conventionals	Inorganics	Nutrients
Nitrite as N	Nitrite as N	14797650		umol/L	mg/Kg ww				Inorganics	Conventionals	Nutrients
Nitroaniline, 2-	2-Nitroaniline	88744		ug/L	ug/Kg dw				Organics	SVOCs
Nitroaniline, 3-	3-Nitroaniline	99092		ug/L	ug/Kg dw				Organics	SVOCs
Nitroaniline, 4-	4-Nitroaniline	100016		ug/L	ug/Kg dw				Organics	SVOCs
Nitrobenzene	Nitrobenzene	98953		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs
Nitrobenzene-d5(Surrogate)	Surrogate: Nitrobenzene-d5	4165600		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs
Nitrogen Oxide	Nitrogen Oxide	10102439		RPD					Inorganics	Conventionals
Nitrogen, Inorganic	Inorganic Nitrogen as N	0		mg/L					Inorganics
Nitrogen, Organic	Organic Nitrogen as N	7727379		ug/L	mg/Kg nr				Inorganics	Conventionals	Nutrients
Nitrogen, Total	Total Nitrogen	0		ug/L	ug/Kg dw		%	%	Inorganics	Conventionals	Nutrients	WaterQualityMeasurements
Nitrogen, Total Kjeldahl	Total Kjeldahl Nitrogen (TKN)	7727379		ug/L	ug/g dw				Inorganics	Conventionals	Nutrients
Nitrogen-15/Nitrogen-14 Ratio	Nitrogen-15/Nitrogen-14 Ratio (Delta 15N nitrate isotope)	0		per mil
Nitrophenol, 2-	2-Nitrophenol	88755		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols
Nitrophenol, 4-	4-Nitrophenol	100027		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols
Nitrosodiethylamine, N-	N-Nitrosodiethylamine	0		ng/L					Organics	VOCs
Nitrosodimethylamine, N-	N-Nitrosodimethylamine	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	SVOCs
Nitrosodimethylamine-d6, N-(Surrogate)	Surrogate: N-Nitrosodimethylamine-d6	0		% recovery					Organics	SVOCs
Nitrosodi-n-propylamine, N-	N-Nitrosodi-n-propylamine	621647		ug/L	ug/Kg dw				Organics	SVOCs
Nitrosodiphenylamine, N-	N-Nitrosodiphenylamine	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Nitrosomethylethylamine, N-	N-Nitrosomethylethylamine	0		ng/L					Organics	SVOCs
No Debris Collected	No Debris Collected	0	pieces						Debris	Trash	Survey
No Debris Present	No Debris Present	0	pieces						Debris	Trash	Survey
Nodularin	Nodularin	118399227		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
NoItems	Number of Items using Trash Protocol	0	score						Trash
Nonachlor, cis-	cis-Nonachlor	5103731		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors
Nonachlor, cis-(Surrogate)	Surrogate: cis-Nonachlor	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Nonachlor, trans-	trans-Nonachlor	39765805		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors
Nonachlor, trans-(Surrogate)	Surrogate: trans-Nonachlor	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Nonachlor-13C10, cis-(IsoDilAnalogue)	Isotope Dilution Analogue: cis-Nonachlor-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Nonachlor-13C10, trans-(IsoDilAnalogue)	Isotope Dilution Analogue: trans-Nonachlor-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Nonacosane, n-	n-Nonacosane	630035					ng/g ww	ng/g dw	Organics	Alkanes
Nonadecane, n-	n-Nonadecane	629925					ng/g ww	ng/g dw	Organics	Alkanes
Nonafluoro-3,6-Dioxaheptanoic Acid	Nonafluoro-3,6-Dioxaheptanoic Acid (NFDHA)	151772586		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Nonane(Surrogate)	Surrogate: Nonane	111842		% recovery					Organics
None	Used for non-treated samples	0	none						WaterQualityMeasurements	ToxTreatment
NonPoint Source Discharges Stormwater Extent	NonPoint Source Discharges Stormwater Extent	0	none						Habitat
NonPoint Source Discharges Stormwater Intensity	NonPoint Source Discharges Stormwater Intensity	0	none						Habitat
NonPoint Source Discharges Stormwater Proximity	NonPoint Source Discharges Stormwater Proximity	0	none						Habitat
Nonylphenol	Nonylphenol	25154523		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Surfactants	Phenols	non-Chlorinated Phenols	Endocrine Disruptors
Nonylphenol Diethoxylate, 4-	4-Nonylphenol Diethoxylate	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Nonylphenol diethoxylate, tech-	tech-Nonylphenol diethoxylate	0		ug/L
Nonylphenol Diethoxylate-13C6, 4-(Surrogate)	Surrogate: 4-Nonylphenol Diethoxylates-13C6	0		% recovery			% recovery	% recovery	Organics	PPCPs
Nonylphenol monoethoxylate	Nonylphenol monoethoxylate	0		ug/L
Nonylphenol Monoethoxylate, 4-	4-Nonylphenol Monoethoxylate	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Nonylphenol monoethoxylate, 4-n-	4-n-Nonylphenol monoethoxylate	104358		ug/L
Nonylphenol Monoethoxylate-13C6, 4-(Surrogate)	Surrogate: 4-Nonylphenol Monoethoxylate-13C6	0					% recovery	% recovery	Organics	PPCPs
Nonylphenol, 4-n-	4-n-Nonylphenol	104405		ug/L	ug/Kg dw				Organics	Surfactants
Nonylphenol, p-	p-Nonylphenol	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Surfactants	Phenols
Nonylphenol, tech-	tech-Nonylphenol (Branched p-nonylphenol)	84852153		ug/L					Organics	Surfactants
Nonylphenol-13C6, 4-n-(Surrogate)	Surrogate: 4-n-Nonylphenol-13C6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Nonylphenolethoxylate	Nonylphenolethoxylate	9016459		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Surfactants	Phenols	non-Chlorinated Phenols	Endocrine Disruptors
Norfloxacin	Norfloxacin	70458967		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Norfluoxetine	Norfluoxetine	83891036		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Norfluoxetine-d5(Surrogate)	Surrogate: Norfluoxetine-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Norflurazon	Norflurazon (3(2H)-Pyridazinone, 4-chloro-5-(methylamino)-2-[3-(trifluoromethyl)phenyl]-) (Telok)	27314132		ug/L					Organics	Pesticides	Herbicides
Norgestimate	Norgestimate	35189287		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Normal Development	Normal Development (%)	0		%	%	%			Toxicity
Norverapamil	Norverapamil	67018853		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Novaluron	Novaluron	116714466		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides
Noxious Chemical Odors Extent	Noxious Chemical Odors Extent	0	none						Habitat
Noxious Chemical Odors Intensity	Noxious Chemical Odors Intensity	0	none						Habitat
Noxious Chemical Odors Proximity	Noxious Chemical Odors Proximity	0	none						Habitat
Nutrient Related Water Other Extent	Nutrient Related Water Other Extent	0	none						Habitat
Nutrient Related Water Other Intensity	Nutrient Related Water Other Intensity	0	none						Habitat
Nutrient Related Water Other Proximity	Nutrient Related Water Other Proximity	0	none						Habitat
O,O,O-Triethyl phosphorothioate	O,O,O-Triethyl phosphorothioate	0		ug/L
ObservedChannelFlowLevel	ObservedChannelFlowLevel	0	none	cm					FieldObservations	Habitat
ObservedFlow	ObservedFlow	0	none	cfs					FieldObservations	Habitat
Obstructions (culverts, paved stream crossings) Extent	Obstructions (culverts, paved stream crossings) Extent	0	none						Habitat
Obstructions (culverts, paved stream crossings) Intensity	Obstructions (culverts, paved stream crossings) Intensity	0	none						Habitat
Obstructions (culverts, paved stream crossings) Proximity	Obstructions (culverts, paved stream crossings) Proximity	0	none						Habitat
OCDD, 1,2,3,4,6,7,8,9-	1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD)	3268879		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
OCDD, 1,2,3,4,6,7,8,9- (TEQ ND=0)	1,2,3,4,6,7,8,9-OCDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
OCDD, 1,2,3,4,6,7,8,9- (TEQ ND=1/2 DL)	1,2,3,4,6,7,8,9-OCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
OCDD, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD)	3268879		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
OCDD-13C, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin-13C (OCDD)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
OCDD-13C12, 1,2,3,4,6,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin-13C12 (OCDD-13C12)	114423971		% recovery					Organics	Dioxins/Dibenzofurans	IDA
OCDF, 1,2,3,4,6,7,8,9-	1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF)	39001020		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
OCDF, 1,2,3,4,6,7,8,9- (TEQ ND=0)	1,2,3,4,6,7,8,9-OCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
OCDF, 1,2,3,4,6,7,8,9- (TEQ ND=1/2 DL)	1,2,3,4,6,7,8,9- OCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
OCDF, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF)	39001020		% recovery					Organics	PCDDs/PCDFs	DioxinsDibenzofurans
OCDF-13C, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran-13C (OCDF)	0					% recovery	% recovery	Organics	DioxinsDibenzofurans
Octachlorostyrene	Octachlorostyrene	0		pg/L			ug/Kg ww	ug/Kg dw	Organics	VOCs
Octachlorostyrene-13C8(Surrogate)	Surrogate: Octachlorostyrene-13C8	0			% recovery				Organics	VOCs
Octacosane, n-	n-Octacosane	0		ug/L	mg/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Alkanes
Octacosane, n-(Surrogate)	Surrogate: n-Octacosane	0		% recovery	% recovery				Organics	Alkanes
Octadecane, n-	n-Octadecane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes
Octamethylcyclotetrasiloxane	Octamethylcyclotetrasiloxane	556672			ug/Kg dw
Octylphenol	Octylphenol	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Octylphenol diethoxylate, tert-4-	4-tert-Octylphenol diethoxylate (OP2EO)	2315619		ng/L	ug/Kg dw				Organics	Phenols
Octylphenol monoethoxylate, 4-	4-Octylphenol monoethoxylate	0		ug/L
Octylphenol monoethoxylate, 4-n-	4-n-Octylphenol monoethoxylate	51437899		ug/L
Octylphenol monoethoxylate, tert-4-	4-tert-Octylphenol monoethoxylate (OP1EO)	2315675		ng/L	ug/Kg dw				Organics	Phenols
Octylphenol, 4-	4-Octylphenol	1806264		ug/L
Octylphenol, 4-n-	4-n-Octylphenol	1806264		ug/L
Octylphenol, tert-4-	4-tert-Octylphenol	140669		ug/L	ug/Kg dw				Organics	Phenols
Odor	Odor	0	none	TON	none				FieldObservations	Habitat
Odor Intensity	Odor Intensity - Specific to EMAP BA (characterizes intensity of odor)	0	none						Habitat
Ofloxacin	Ofloxacin	82419361		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Oil, Gas Wells	Oil, Gas Wells	0	none						Habitat
OilandGrease	Oil & Grease	0		mg/L					Inorganics	Conventionals
OilandGrease; HEM	Oil and Grease, N-Hexane Extractable Material	0		mg/L	mg/Kg dw				Organics	PAHs
OilandGrease; SGT-HEM	Oil and Grease, Silica Gel Treated N-Hexane Extractable Material (Non-Polar Material Not Adsorbed by Silica Gel)	0		mg/L	mg/Kg dw				Organics	PAHs
Okadaic Acid	Okadaic Acid	78111178		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Open Shell Volume	Open Shell Volume (weight (in grams) of water displaced by each empty bivalve)	0					mL	mL	Organics	Inorganics	Metals	Conventionals	Semi-VOAs	VOAs
Orchards	Orchards	0	none						Habitat
Orchards Extent	Orchards Extent	0	none						Habitat
Orchards Intensity	Orchards Intensity	0	none						Habitat
Orchards Proximity	Orchards Proximity	0	none						Habitat
Ormetoprim	Ormetoprim	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
OrthoPhosphate as P	Reactive Phosphorous (PO4)	14265442		umol/L					Inorganics	Conventionals	Nutrients
Oryzalin	Oryzalin (Rycelan) (Ryzelan) (Surflan)	19044883		ug/L	ug/Kg dw				Organics	Herbicides
o-Terphenyl(Surrogate)	Surrogate: o-Terphenyl	84151		% recovery	% recovery				Organics	SVOCs
OtherPresence	OtherPresence	0	none						FieldObservations	Habitat
Outfall Accessibility	Outfall Accessibility	0	none
Outfall Structural Cond	Structural condition of the outfall	0	none
Outfall, Distance from Transect	Outfall, Distance from Transect	0	m						Habitat	Debris
Outfall, Within Transect	Outfall, Within Transect	0	none						Habitat	Debris
OverlandRunoffLast24hrs	Influence of overland runoff during last 24 hours	0	none	none					FieldObservations	Habitat
Oxacillin	Oxacillin	66795		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Oxadiazon	Oxadiazon	19666309		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs
Oxamyl	Oxamyl	23135220		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides	Nematocides
Oxidation-Reduction Potential	Oxidation-Reduction Potential (OPR)	0		mV					WaterQualityMeasurements	Conventionals
Oxolinic Acid	Oxolinic Acid	14698294		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Oxychlordane	Oxychlordane	27304138		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors
Oxychlordane(Surrogate)	Surrogate: Oxychlordane	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Oxychlordane-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Oxychlordane-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Oxychlordane-13C10(Surrogate)	Surrogate: Oxychlordane-13C10	0		% recovery	% recovery				Organics	Pesticides
Oxycodone	Oxycodone	76426		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Oxycodone-d6(Surrogate)	Surrogate: Oxycodone-d6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Oxyfluorfen	Oxyfluorfen (Goal)	42874033		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OCHs
Oxygen, Dissolved	Dissolved Oxygen (DO)	0		mg/L					WaterQualityMeasurements	Conventionals
Oxygen, Dissolved, Daily Mean	Daily Mean Dissolved Oxygen (DO) (Calculated)	0		umol/L					WaterQualityMeasurements	Conventionals
Oxygen, Saturation	Oxygen, Saturation	0		%					WaterQualityMeasurements	Conventionals
Oxygen, Saturation, Daily Mean	Daily Mean Oxygen Saturation (Calculated)	0		%					WaterQualityMeasurements	Conventionals
Oxygen-18/Oxygen-16 Ratio	Oxygen-18/Oxygen-16 Ratio (Delta 18O nitrate isotope)	14797718		per mil					Isotopes
Oxytetracycline	Oxytetracycline	79572		ug/L					Organics	PPCPs
Paclobutrazol	Paclobutrazol	76738620		ng/L					Organics	Pesticides	Fungicides
Paper/Cardboard	Paper/Cardboard	0	pieces						Debris	Trash	Non-Plastics	Biodegradable
PAR	Photosynthetically Active Radiation (PAR)	0		mE/m2/s					WaterQualityMeasurements
Paraoxon	Paraoxon	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Pesticides	Insecticides
Paraquat	Paraquat	4685147		ug/L					Organics	Pesticides	Herbicides
Paraquat Dichloride	Paraquat Dichloride	1910425		ug/L					Organics	Pesticides	Herbicides
Parathion, Ethyl	Ethyl Parathion (Parathion)	56382		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Parathion, Methyl	Methyl Parathion	298000		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Parathion, Total	Total Parathion	0		ug/L
Parking Lot/Pavement Extent	Parking Lot/Pavement Extent	0	none						Habitat
Parking Lot/Pavement Intensity	Parking Lot/Pavement Intensity	0	none						Habitat
Parking Lot/Pavement Proximity	Parking Lot/Pavement Proximity	0	none						Habitat
Parks, Campgrounds	Parks, Campgrounds	0	none						Habitat
Paroxetine	Paroxetine	61869087		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Paroxetine-d6(Surrogate)	Surrogate: Paroxetine-d6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Particulate Organic Carbon	Particulate Organic Carbon (POC)	0		ug/L					Inorganics	Conventionals
Passive Input (Construction/Erosion) Extent	Passive Input (Construction/Erosion) Extent	0	none						Habitat
Passive Input (Construction/Erosion) Intensity	Passive Input (Construction/Erosion) Intensity	0	none						Habitat
Passive Input (Construction/Erosion) Proximity	Passive Input (Construction/Erosion) Proximity	0	none						Habitat
Pasture	Pasture	0	none						Habitat
Pasture Extent	Pasture Extent	0	none						Habitat
Pasture Intensity	Pasture Intensity	0	none						Habitat
Pasture Proximity	Pasture Proximity	0	none						Habitat
Paved Roads Extent	Paved Roads Extent	0	none						Habitat
Paved Roads Intensity	Paved Roads Intensity	0	none						Habitat
Paved Roads Proximity	Paved Roads Proximity	0	none						Habitat
PBB 001	Polybrominated Biphenyl (PBB) 1	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 002	Polybrominated Biphenyl (PBB) 2	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 003	Polybrominated Biphenyl (PBB) 3	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 004	Polybrominated Biphenyl (PBB) 4	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 007	Polybrominated Biphenyl (PBB) 7	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 009	Polybrominated Biphenyl (PBB) 9	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 010	Polybrominated Biphenyl (PBB) 10	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 015	Polybrominated Biphenyl (PBB) 15	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 015(Surrogate)	Surrogate: PBB 015	92864		% recovery					Organics
PBB 018	Polybrominated Biphenyl (PBB) 18	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 026	Polybrominated Biphenyl (PBB) 26	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 030	Polybrominated Biphenyl (PBB) 30	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 031	Polybrominated Biphenyl (PBB) 31	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 049	Polybrominated Biphenyl (PBB) 49	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 052	Polybrominated Biphenyl (PBB) 52	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 053	Polybrominated Biphenyl (PBB) 53	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 077	Polybrominated Biphenyl (PBB) 77	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 080	Polybrominated Biphenyl (PBB) 80	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 103	Polybrominated Biphenyl (PBB) 103	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBB 155	Polybrominated Biphenyl (PBB) 155	0					ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 001	Polybrominated Diphenyl Ether (PBDE) 1	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 001(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 1	0		% recovery					Organics	FlameRetardants
PBDE 002	Polybrominated Diphenyl Ether (PBDE) 2	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 003	Polybrominated Diphenyl Ether (PBDE) 3	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 003(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 3	0		% recovery	% recovery				Organics	FlameRetardants
PBDE 004(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 4	0		% recovery					Organics	FlameRetardants
PBDE 007	Polybrominated Diphenyl Ether (PBDE) 7	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 008	Polybrominated Diphenyl Ether (PBDE) 8	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 008/11	Polybrominated Diphenyl Ether (PBDE) 8/11	0		pg/L			ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 010	Polybrominated Diphenyl Ether (PBDE) 10	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 011	Polybrominated Diphenyl Ether (PBDE) 11	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 012	Polybrominated Diphenyl Ether (PBDE) 12	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 012/13	Polybrominated Diphenyl Ether (PBDE) 12/13	0		pg/L			ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 013	Polybrominated Diphenyl Ether (PBDE) 13	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 015	Polybrominated Diphenyl Ether (PBDE) 15	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 015(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 15	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 015-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 15-13C12	488710174					% recovery	% recovery	Organics	FlameRetardants	PBDEs
PBDE 017	Polybrominated Diphenyl Ether (PBDE) 17	147217752		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 017/25	Polybrominated Diphenyl Ether (PBDE) 17/25	0		ug/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 019(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 19	0		% recovery					Organics	FlameRetardants
PBDE 025	Polybrominated Diphenyl Ether (PBDE) 25	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 028	Polybrominated Diphenyl Ether (PBDE) 28	41318756		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 028(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 28	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 028/33	Polybrominated Diphenyl Ether (PBDE) 28/33	0		ug/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 028-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 028-13C12	0			% recovery		% recovery	% recovery	Organics
PBDE 030	Polybrominated Diphenyl Ether (PBDE) 30	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 032	Polybrominated Diphenyl Ether (PBDE) 32	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 033	Polybrominated Diphenyl Ether (PBDE) 33	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 035	Polybrominated Diphenyl Ether (PBDE) 35	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 037	Polybrominated Diphenyl Ether (PBDE) 37	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 037(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 37	0		% recovery					Organics	FlameRetardants
PBDE 047	Polybrominated Diphenyl Ether (PBDE) 47	5436431		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 047(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 47	5436431		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 047-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 047-13C12	0			% recovery		% recovery	% recovery	Organics
PBDE 049	Polybrominated Diphenyl Ether (PBDE) 49	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 049/71	Polybrominated Diphenyl Ether (PBDE) 49/71	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs
PBDE 051	Polybrominated Diphenyl Ether (PBDE) 51	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 052(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 52	0			% recovery				Organics	FlameRetardants
PBDE 054(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 54	0		% recovery					Organics	FlameRetardants
PBDE 066	Polybrominated Diphenyl Ether (PBDE) 66	189084615		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 071	Polybrominated Diphenyl Ether (PBDE) 71	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 075	Polybrominated Diphenyl Ether (PBDE) 75	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 077	Polybrominated Diphenyl Ether (PBDE) 77	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 077(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 77	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 077-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 77-13C12	1401355552					% recovery	% recovery	Organics	FlameRetardants	PBDEs
PBDE 079	Polybrominated Diphenyl Ether (PBDE) 79	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 081(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 81	0		% recovery					Organics	FlameRetardants
PBDE 085	Polybrominated Diphenyl Ether (PBDE) 85	182346210		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 099	Polybrominated Diphenyl Ether (PBDE) 99	60348609		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 099(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 99	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 099-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 099-13C12	0			% recovery		% recovery	% recovery	Organics
PBDE 100	Polybrominated Diphenyl Ether (PBDE) 100	189084648		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 100(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 100	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 100-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 100-13C12	0			% recovery		% recovery	% recovery	Organics
PBDE 100-L(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-Labeled	0		% recovery	% recovery		% recovery	% recovery	Organics	PBDEs	FlameRetardants
PBDE 104(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 104	0		% recovery					Organics	FlameRetardants
PBDE 105	Polybrominated Diphenyl Ether (PBDE) 105	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 105(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 105	0		% recovery					Organics	FlameRetardants
PBDE 111(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 111	0		% recovery					Organics	FlameRetardants
PBDE 114(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 114	0		% recovery					Organics	FlameRetardants
PBDE 116	Polybrominated Diphenyl Ether (PBDE) 116	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 118	Polybrominated Diphenyl Ether (PBDE) 118	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 118(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 118	0		% recovery					Organics	FlameRetardants
PBDE 119	Polybrominated Diphenyl Ether (PBDE) 119	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 119/120	Polybrominated Diphenyl Ether (PBDE) 119/120	0		pg/L			ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 120	Polybrominated Diphenyl Ether (PBDE) 120	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 123(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 123	0		% recovery					Organics	FlameRetardants
PBDE 126	Polybrominated Diphenyl Ether (PBDE) 126	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 126(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 126	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 126-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 126-13C12	1401355563					% recovery	% recovery	Organics	FlameRetardants	PBDEs
PBDE 128	Polybrominated Diphenyl Ether (PBDE) 128	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 138	Polybrominated Diphenyl Ether (PBDE) 138	182677301		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 138(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 138	0		% recovery	% recovery				Organics	FlameRetardants
PBDE 138/166	Polybrominated Diphenyl Ether (PBDE) 138/166	0		pg/L			ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 139	Polybrominated Diphenyl Ether (PBDE) 139	0					ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 139(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 139	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 139-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 139-13C12	0			% recovery		% recovery	% recovery	Organics
PBDE 140	Polybrominated Diphenyl Ether (PBDE) 140	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 140(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 140	0		% recovery			% recovery	% recovery	Organics	FlameRetardants
PBDE 153	Polybrominated Diphenyl Ether (PBDE) 153	68631492		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 153(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 153	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 153-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 153-13C12	0			% recovery		% recovery	% recovery	Organics
PBDE 154	Polybrominated Diphenyl Ether (PBDE) 154	207122154		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 154(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 154	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 154-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 154-13C12	0			% recovery		% recovery	% recovery	Organics
PBDE 155	Polybrominated Diphenyl Ether (PBDE) 155	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 155(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 155	0		% recovery					Organics	FlameRetardants
PBDE 156(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 156	0		% recovery					Organics	FlameRetardants
PBDE 157(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 157	0		% recovery					Organics	FlameRetardants
PBDE 160	Polybrominated Diphenyl Ether (PBDE) 160	0			% dw				Organics	SVOCs
PBDE 166	Polybrominated Diphenyl Ether (PBDE) 166	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 167(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 167	0		% recovery					Organics	FlameRetardants
PBDE 169(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 169	0		% recovery					Organics	FlameRetardants
PBDE 170(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 170	0		% recovery					Organics	FlameRetardants
PBDE 172(Surrogate)	Surrogate: PBDE 172 Surrogate: PBDE 172	0			ng/g dw
PBDE 178(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 178	0		% recovery					Organics	FlameRetardants
PBDE 179	Polybrominated Diphenyl Ether (PBDE) 179	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 180(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 180	0		% recovery					Organics	FlameRetardants
PBDE 181	Polybrominated Diphenyl Ether (PBDE) 181	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 183	Polybrominated Diphenyl Ether (PBDE) 183	207122165		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 183(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 183	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 183-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 183-13C12	0			% recovery		% recovery	% recovery	Organics
PBDE 184	Polybrominated Diphenyl Ether (PBDE) 184	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 188	Polybrominated Diphenyl Ether (PBDE) 188	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 188(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 188	0		% recovery					Organics	FlameRetardants
PBDE 189(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 189	0		% recovery					Organics	FlameRetardants
PBDE 190	Polybrominated Diphenyl Ether (PBDE) 190	189084682		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 194	Polybrominated Diphenyl Ether (PBDE) 194	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 195	Polybrominated Diphenyl Ether (PBDE) 195	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 196	Polybrominated Diphenyl Ether (PBDE) 196	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 197	Polybrominated Diphenyl Ether (PBDE) 197	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 197(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 197	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 197-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 197-13C12	1367487317					% recovery	% recovery	Organics	FlameRetardants	PBDEs
PBDE 198	Polybrominated Diphenyl Ether (PBDE) 198	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 200	Polybrominated Diphenyl Ether (PBDE) 200	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 200/203	Polybrominated Diphenyl Ether (PBDE) 200/203	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	PBDEs	FlameRetardants
PBDE 201	Polybrominated Diphenyl Ether (PBDE) 201	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 202	Polybrominated Diphenyl Ether (PBDE) 202	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants
PBDE 202(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 202	0		% recovery					Organics	FlameRetardants
PBDE 203	Polybrominated Diphenyl Ether (PBDE) 203	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 204	Polybrominated Diphenyl Ether (PBDE) 204	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 205	Polybrominated Diphenyl Ether (PBDE) 205	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 205(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 205	0		% recovery					Organics	FlameRetardants
PBDE 206	Polybrominated Diphenyl Ether (PBDE) 206	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 206(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 206	0		% recovery					Organics	FlameRetardants
PBDE 207	Polybrominated Diphenyl Ether (PBDE) 207	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 207(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 207	0			% recovery				Organics	FlameRetardants
PBDE 208	Polybrominated Diphenyl Ether (PBDE) 208	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 208(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 208	0		% recovery					Organics	FlameRetardants
PBDE 209	Polybrominated Diphenyl Ether (PBDE) 209	1163195		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 209(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 209	1163195		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 209-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 209-13C12	0			% recovery		% recovery	% recovery	Organics
PCB 001	PCB 1 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 001(Surrogate)	Surrogate: PCB 1 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 001-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 001-13C	0		% recovery
PCB 001-13C(Surrogate)	Surrogate: PCB 001-13C Congener	0		% recovery					Organics	PCBs
PCB 001-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 001-13C12	234432850		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 002	PCB 2 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 003	PCB 3 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 003(Surrogate)	Surrogate: PCB 3 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 003-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 003-13C	0		% recovery
PCB 003-13C(Surrogate)	Surrogate: PCB 003-13C Congener	0		% recovery					Organics	PCBs
PCB 003-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 003-13C12	208263778		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 004	PCB 4 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 004(Surrogate)	Surrogate: PCB 4 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 004/10	PCB 4/10 Congener	0		ug/L			ng/g ww	ng/g dw	Organics	PCBs
PCB 004-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 004-13C	0		% recovery
PCB 004-13C(Surrogate)	Surrogate: PCB 004-13C Congener	0		% recovery					Organics	PCBs
PCB 004-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 004-13C12	234432861		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 005	PCB 5 Congener	16605917		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 005/8	PCB 5/8 Congener	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PCBs	Congeners
PCB 006	PCB 6 Congener	25569806		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 007	PCB 7 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 007/9	PCB 7/9 Congener	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PCBs
PCB 008	PCB 8 Congener	34883437		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 008(Surrogate)	Surrogate: PCB 8 Congener	34883400		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	Congeners
PCB 009	PCB 9 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 009(Surrogate)	Surrogate: PCB 9 Congener	0			% recovery				Organics	PCBs
PCB 009-13C(Surrogate)	Surrogate: PCB 009-13C Congener	0		% recovery					Organics	PCBs
PCB 009-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 9-13C12	250694894		% recovery					Organics	PCBs	IDA
PCB 010	PCB 10 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 011	PCB 11 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 011-13C(Surrogate)	Surrogate: PCB 011-13C Congener	0		% recovery					Organics	PCBs
PCB 011-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 11-13C12	0		% recovery					Organics	PCBs	IDA
PCB 012	PCB 12 Congener	2974927		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 012/13	PCB 12/13 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 013	PCB 13 Congener	2974905		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 014	PCB 14 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 015	PCB 15 Congener	2050682		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 015(Surrogate)	Surrogate: PCB 15 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 015-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 015-13C12	208263676		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 016	PCB 16 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 016/32	PCB 16/32 Congener	0		ug/L			ng/g ww	ng/g dw	Organics	PCBs
PCB 017	PCB 17 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 017/18	PCB 17/18 Congener	0					RPD	RPD	Organics	PCBs
PCB 018	PCB 18 Congener	37680652		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 018/30	PCB 18/30 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 019	PCB 19 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 019(Surrogate)	Surrogate: PCB 19 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 019-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 019-13C12	234432872		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 020	PCB 20 Congener	38444847		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 020/21/33	PCB 020/21/33 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 020/28	PCB 20/28 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 020/33	PCB 20/33 Congener	0					RPD	RPD	Organics	PCBs
PCB 020/33/53	PCB 20/33/53 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 021	PCB 21 Congener	55702460		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 021/33	PCB 21/33 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 022	PCB 22 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 022/51	PCB 22/51 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 023	PCB 23 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 024	PCB 24 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 024/27	PCB 24/27 Congener	0		ug/L			ng/g ww	ng/g dw	Organics	PCBs
PCB 025	PCB 25 Congener	55712373		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 026	PCB 26 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 026/29	PCB 26/29 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 027	PCB 27 Congener	38444767		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 028	PCB 28 Congener	7012375		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 028(Surrogate)	Surrogate: PCB 28 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 028/31	PCB 28/31 Congener	0		ug/L	ng/g dw		RPD	RPD	Organics	PCBs
PCB 028-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 028-13C	0		% recovery
PCB 028-13C(Surrogate)	Surrogate: PCB 028-13C Congener	0		% recovery					Organics	PCBs
PCB 028-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 028-13C12	208263767		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 029	PCB 29 Congener	15862074		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 030	PCB 30 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 030(Surrogate)	Surrogate: PCB 30 Congener	35693926		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 031	PCB 31 Congener	16606023		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 031(Surrogate)	Surrogate: PCB 31 Congener	0		% recovery			% recovery	% recovery	Organics	PCBs
PCB 031-13C(Surrogate)	Surrogate: PCB 31-13C Congener	0		% recovery
PCB 031-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 031-13C12	0		% recovery					Organics	PCBs	IDA
PCB 032	PCB 32 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 032-13C(Surrogate)	Surrogate: PCB 32-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 032-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 32-13C12	0		% recovery					Organics	PCBs	IDA
PCB 033	PCB 33 Congener	38444869		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 034	PCB 34 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 035	PCB 35 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 036	PCB 36 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 037	PCB 37 Congener	38444905		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 037(Surrogate)	Surrogate: PCB 37 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 037/42	PCB 37/42 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 037/42/59	PCB 37/42/59 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 037-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 037-13C	0		% recovery
PCB 037-13C(Surrogate)	Surrogate: PCB 037-13C Congener	0		% recovery					Organics	PCBs
PCB 037-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 037-13C12	208263790		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 038	PCB 38 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 039	PCB 39 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 040	PCB 40 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 040/41	PCB 40/41 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 040/41/71	PCB 40/41/71 Congener	0		pg/L	ng/g nr		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 040/71	PCB 40/71 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 041	PCB 41 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 041/64	PCB 41/64 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 041/64/71/72	PCB 041/64/71/72 Congener	0		ug/L					Organics	PCBs
PCB 041/71/40	PCB 41/71/40 Congener PCB 041/71/40	0		pg/L
PCB 042	PCB 42 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 042/59	PCB 042/59 Congener	0		ug/L					Organics	PCBs
PCB 043	PCB 43 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 043/49	PCB 43/49 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 043/73	PCB 43/73 Congener	0		pg/L					Organics	PCBs
PCB 044	PCB 44 Congener	41464395		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 044/47	PCB 44/47 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 044/47/65	PCB 44/47/65 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 044/65	PCB 44/65 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 045	PCB 45 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 045/51	PCB 45/51 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 046	PCB 46 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 047	PCB 47 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 047/48	PCB 47/48 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 047/48/75	PCB 47/48/75 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 047-13C(Surrogate)	Surrogate: PCB 47-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 047-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 47-13C12	0		% recovery					Organics	PCBs	IDA
PCB 048	PCB 48 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 048/75	PCB 048/75 Congener	0		ug/L					Organics	PCBs
PCB 049	PCB 49 Congener	41464408		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 049/69	PCB 49/69 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 050	PCB 50 Congener	62796650		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 050/53	PCB 50/53 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 051	PCB 51 Congener	68194047		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 052	PCB 52 Congener	35693993		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 052(Surrogate)	Surrogate: PCB 52 Congener	0			% recovery				Organics	PCBs
PCB 052/69	PCB 52/69 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 052-13C(Surrogate)	Surrogate: PCB 052-13C Congener	0		% recovery					Organics	PCBs
PCB 052-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 52-13C12	208263803		% recovery					Organics	PCBs	IDA
PCB 053	PCB 53 Congener	41464419		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 054	PCB 54 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 054(Surrogate)	Surrogate: PCB 54 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 054-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 054-13C	0		% recovery
PCB 054-13C(Surrogate)	Surrogate: PCB 054-13C Congener	0		% recovery					Organics	PCBs
PCB 054-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 054-13C12	234432883		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 055	PCB 55 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 056	PCB 56 Congener	41464431		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 056/60	PCB 56/60 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 057	PCB 57 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 058	PCB 58 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 059	PCB 59 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 059/62	PCB 59/62 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 059/62/75	PCB 59/62/75 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 059/75	PCB 59/75 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 060	PCB 60 Congener	33025411		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 061	PCB 61 Congener	33284536		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 061/70	PCB 61/70 Congener	0		ug/L	ug/Kg dw				Organics	PCBs	Congeners
PCB 061/70/74/76	PCB 61/70/74/76 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 061/74	PCB 61/74 Congener	0		pg/L			ng/g ww	ng/g dw	Organics	PCBs
PCB 061/76	PCB 61/76 Congener	0		pg/L					Organics	PCBs
PCB 062	PCB 62 Congener	54230227		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 063	PCB 63 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 064	PCB 64 Congener	52663588		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 065	PCB 65 Congener	33284547		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 065(Surrogate)	Surrogate: PCB 65 Congener	33284547			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 066	PCB 66 Congener	32598100		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 066/76	PCB 66/76 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 067	PCB 67 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 068	PCB 68 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 069	PCB 69 Congener	60233241		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 070	PCB 70 Congener	32598111		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 070/61/74/76	PCB 70/61/74/76 Congener	0		pg/L
PCB 070/74	PCB 070/74	0			ug/Kg dw				Organics	PCBs
PCB 070/76	PCB 070/76	0			ug/Kg dw				Organics	PCBs
PCB 070-13C(Surrogate)	Surrogate: PCB 70-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 070-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 70-13C12	208263814		% recovery					Organics	PCBs	IDA
PCB 071	PCB 71 Congener	41464464		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 072	PCB 72 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 073	PCB 73 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 074	PCB 74 Congener	32690930		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 075	PCB 75 Congener	32598122		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 076	PCB 76 Congener	70362480		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 076/66	PCB 076/66 Congener	0		ug/L					Organics	PCBs
PCB 077	PCB 77 Congener	32598133		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 077 (TEQ ND=0)	PCB 077 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 077 (TEQ ND=1/2 DL)	PCB 077 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 077 (TEQ ND=1/2 DL))	PCB 077 (TEQ ND=1/2 DL)	0		pg/sample					Organics
PCB 077 (TEQ ND=DL)	PCB 077 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 077(Surrogate)	Surrogate: PCB 77 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 077/110	PCB 77/110 Congener	0			ng/g dw		ng/g ww	ng/g dw	Organics	PCBs
PCB 077/85	PCB 77/85 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 077-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 077-13C	0		% recovery
PCB 077-13C(Surrogate)	Surrogate: PCB 77-13C Congener	0		% recovery			% recovery	% recovery	Organics	PCBs
PCB 077-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 077-13C12	105600235		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 078	PCB 78 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 079	PCB 79 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 079-13C(Surrogate)	Surrogate: PCB 79-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 079-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 79-13C12	0		% recovery					Organics	PCBs	IDA
PCB 080	PCB 80 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 080-13C(Surrogate)	Surrogate: PCB 80-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 080-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 80-13C12	0		% recovery					Organics	PCBs	IDA
PCB 081	PCB 81 Congener	70362504		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 081 (TEQ ND=0)	PCB 081 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 081 (TEQ ND=1/2 DL)	PCB 081 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 081 (TEQ ND=DL)	PCB 081 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 081(Surrogate)	Surrogate: PCB 81 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 081-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 081-13C	0		% recovery
PCB 081-13C(Surrogate)	Surrogate: PCB 081-13C Congener	0		% recovery					Organics	PCBs
PCB 081-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 081-13C12	208461249		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 082	PCB 82 Congener	52663624		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 083	PCB 83 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 083/99	PCB 83/99 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 084	PCB 84 Congener	0		RPD	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 084/92	PCB 084/92 Congener	0		ug/L					Organics	PCBs
PCB 085	PCB 85 Congener	65510454		RPD	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 085/110/115/116/117	PCB 85/110/115/116/117 Congener	0		pg/L					Organics	PCBs
PCB 085/116	PCB 85/116 Congener	0		ug/L	ug/Kg dw				Organics	PCBs
PCB 085/116/117	PCB 85/116/117 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 085/117	PCB 85/117 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 086	PCB 86 Congener	55312691		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 086/108	PCB 86/108 Congener	0		pg/L					Organics	PCBs
PCB 086/119	PCB 86/119 Congener	0		pg/L					Organics	PCBs
PCB 086/125	PCB 86/125 Congener	0		pg/L					Organics	PCBs
PCB 086/87	PCB 86/87 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 086/87/97/108/119/125	PCB 86/87/97/108/119/125 Congener	0			pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 086/87/97/109/119/125	PCB 86/87/97/109/119/125 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 086/97	PCB 86/97 Congener	0		pg/L					Organics	PCBs
PCB 087	PCB 87 Congener	38380028		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 087/108	PCB 087/108	0			ug/Kg ww				Organics	PCBs
PCB 087/115	PCB 87/115 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 087/117/125	PCB 87/117/125 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 087/119	PCB 087/119	0			ug/Kg ww				Organics	PCBs
PCB 087/125	PCB 087/125	0			ug/Kg ww				Organics	PCBs
PCB 087/97	PCB 087/97	0			ug/Kg ww				Organics	PCBs
PCB 088	PCB 88 Congener	55215173		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 088/91	PCB 88/91 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 089	PCB 89 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 090	PCB 90 Congener	68194070		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 090/101	PCB 90/101 Congener	0		ug/L	ug/Kg ww		RPD	RPD	Organics	PCBs
PCB 090/101/113	PCB 90/101/113 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 090/113	PCB 90/113 Congener	0		pg/L					Organics	PCBs
PCB 091	PCB 91 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 092	PCB 92 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 093	PCB 93 Congener	73575561		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 093/100	PCB 93/100 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 093/102	PCB 93/102 Congener	0		pg/L					Organics	PCBs
PCB 093/95	PCB 93/95 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 093/95/100	PCB 93/95/100 Congener	0		pg/L
PCB 093/95/98/100/102	PCB 93/95/98/100/102 Congener	0		pg/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 093/95/98/102	PCB 93/95/98/102 Congener	0		pg/L					Organics	PCBs
PCB 093/98	PCB 93/98 Congener	0		pg/L					Organics	PCBs
PCB 093/98/100/102	PCB 93/98/100/102 Congener	0		ng/L	ng/g nr
PCB 094	PCB 94 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 095	PCB 95 Congener	38379996		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 095(Surrogate)	Surrogate: PCB 95 Congener	0		% recovery			% recovery	% recovery	Organics	PCBs
PCB 095/100	PCB 95/100 Congener	0			ug/Kg ww				Organics	PCBs
PCB 095/102	PCB 095/102	0			ug/Kg ww				Organics	PCBs
PCB 095/98	PCB 095/98	0			ug/Kg ww				Organics	PCBs
PCB 095/98/102	PCB 95/98/102 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 095-13C(Surrogate)	Surrogate: PCB 095-13C Congener	0		% recovery					Organics	PCBs
PCB 095-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 095-13C12	0		% recovery					Organics	PCBs	IDA
PCB 096	PCB 96 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 097	PCB 97 Congener	41464511		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 097/154	PCB 97/154 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 097-13C(Surrogate)	Surrogate: PCB 97-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 097-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 97-13C12	0		% recovery					Organics	PCBs	IDA
PCB 098	PCB 98 Congener	60233252		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 098/102	PCB 98/102 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 099	PCB 99 Congener	38380017		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 100	PCB 100 Congener	39485831		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 101	PCB 101 Congener	37680732		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 101(Surrogate)	Surrogate: PCB 101 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 101/113	PCB 101/113	0			ug/Kg ww				Organics	PCBs
PCB 101-13C(Surrogate)	Surrogate: PCB 101-13C Congener	0		% recovery					Organics	PCBs
PCB 101-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 101-13C12	104130394		% recovery					Organics	PCBs	IDA
PCB 102	PCB 102 Congener	68194069		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 103	PCB 103 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 103(Surrogate)	Surrogate: PCB 103 Congener	0			% recovery		% recovery	% recovery	Organics	PCBs
PCB 104	PCB 104 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 104(Surrogate)	Surrogate: PCB 104 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 104-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 104-13C	0		% recovery
PCB 104-13C(Surrogate)	Surrogate: PCB 104-13C Congener	0		% recovery					Organics	PCBs
PCB 104-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 104-13C12	234432894		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 105	PCB 105 Congener	32598144		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 105 (TEQ ND=0)	PCB 105 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 105 (TEQ ND=1/2 DL)	PCB 105 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 105 (TEQ ND=DL)	PCB 105 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 105(Surrogate)	Surrogate: PCB 105 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 105-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 105-13C	0		% recovery
PCB 105-13C(Surrogate)	Surrogate: PCB 105-13C Congener	0		% recovery					Organics	PCBs
PCB 105-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 105-13C12	208263621		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 106	PCB 106 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 106/118	PCB 106/118 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 107	PCB 107 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 107/108/144	PCB 107/108/144 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 107/109	PCB 107/109 Congener	0		ug/L					Organics	PCBs
PCB 107/124	PCB 107/124 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 108	PCB 108 Congener	70362413		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 108/112	PCB 108/112 Congener	0		ug/L					Organics	PCBs
PCB 108/124	PCB 108/124 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 109	PCB 109 Congener	0		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 110	PCB 110 Congener	38380039		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 110/115	PCB 110/115 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 110/151	PCB 110/151 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 111	PCB 111 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 111(Surrogate)	Surrogate: PCB 111 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 111/115	PCB 111/115 Congener	0		ug/L					Organics	PCBs
PCB 111-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 111-13C12	235416292		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 112	PCB 112 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 112(Surrogate)	Surrogate: PCB 112 Congener	74472369		ug/L	ug/Kg dw		% recovery	% recovery	Organics	PCBs	Congeners
PCB 112/119	PCB 112/119 Congener	0		pg/L					Organics	PCBs
PCB 113	PCB 113 Congener	68194105		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 114	PCB 114 Congener	74472370		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 114 (TEQ ND=0)	PCB 114 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 114 (TEQ ND=1/2 DL)	PCB 114 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 114 (TEQ ND=DL)	PCB 114 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 114(Surrogate)	Surrogate: PCB 114 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 114/122/131	PCB 114/122/131 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 114/153	PCB 114/153 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 114-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 114-13C	0		% recovery
PCB 114-13C(Surrogate)	Surrogate: PCB 114-13C Congener	0		% recovery					Organics	PCBs
PCB 114-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 114-13C12	208263632		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 115	PCB 115 Congener	74472381		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 116	PCB 116 Congener	18259057		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 117	PCB 117 Congener	68194116		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 118	PCB 118 Congener	31508006		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 118 (TEQ ND=0)	PCB 118 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 118 (TEQ ND=1/2 DL)	PCB 118 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 118 (TEQ ND=DL)	PCB 118 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 118(Surrogate)	Surrogate: PCB 118 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 118-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 118-13C	0		% recovery
PCB 118-13C(Surrogate)	Surrogate: PCB 118-13C Congener	0		% recovery					Organics	PCBs
PCB 118-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 118-13C12	104130407		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 119	PCB 119 Congener	56558179		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 120	PCB 120 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 121	PCB 121 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 122	PCB 122 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 123	PCB 123 Congener	65510443		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 123 (TEQ ND=0)	PCB 123 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 123 (TEQ ND=1/2 DL)	PCB 123 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 123 (TEQ ND=DL)	PCB 123 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 123(Surrogate)	Surrogate: PCB 123 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 123/149	PCB 123/149 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 123-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 123-13C	0		% recovery
PCB 123-13C(Surrogate)	Surrogate: PCB 123-13C Congener	0		% recovery					Organics	PCBs
PCB 123-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 123-13C12	208263643		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 124	PCB 124 Congener	70424703		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 125	PCB 125 Congener	74472392		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 126	PCB 126 Congener	57465288		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 126 (TEQ ND=0)	PCB 126 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 126 (TEQ ND=1/2 DL)	PCB 126 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 126 (TEQ ND=DL)	PCB 126 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 126(Surrogate)	Surrogate: PCB 126 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 126-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 126-13C	0		% recovery
PCB 126-13C(Surrogate)	Surrogate: PCB 126-13C Congener	0		% recovery			% recovery	% recovery	Organics	PCBs
PCB 126-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 126-13C12	208263654		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 127	PCB 127 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 127-13C(Surrogate)	Surrogate: PCB 127-13C Congener	0		% recovery					Organics	PCBs
PCB 127-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 127-13C12	0		% recovery					Organics	PCBs	IDA
PCB 128	PCB 128 Congener	38380073		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 128/162	PCB 128/162 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 128/166	PCB 128/166 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 128/167	PCB 128/167 Congener	0		ng/L	ug/Kg dw				Organics	PCBs	Congeners
PCB 129	PCB 129 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 129/138	PCB 129/138 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 129/138/160/163	PCB 129/138/160/163 Congener	0			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 129/138/163	PCB 129/138/163 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 129/160	PCB 129/160 Congener	0		pg/L					Organics	PCBs
PCB 129/163	PCB 129/163 Congener	0		pg/L					Organics	PCBs
PCB 129/166	PCB 129/166 Congener	0		pg/L					Organics	PCBs
PCB 130	PCB 130 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 131	PCB 131 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 131/133	PCB 131/133 Congener	0		pg/L					Organics	PCBs
PCB 132	PCB 132 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 132/137	PCB 132/137 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 132/146	PCB 132/146 Congener	0		pg/L					Organics	PCBs
PCB 132/153	PCB 132/153 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 132/153/168	PCB 132/153/168 Congener	0			ng/g dw		ng/g ww	ng/g dw	Organics	PCBs
PCB 132/161	PCB 132/161 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 132/168	PCB 132/168 Congener	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PCBs	Congeners
PCB 133	PCB 133 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 133/142	PCB 133/142 Congener	0		ug/L					Organics	PCBs
PCB 134	PCB 134 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 134/143	PCB 134/143 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 135	PCB 135 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 135/151	PCB 135/151 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 135/151/154	PCB 135/151/154 Congener	0		pg/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 135/154	PCB 135/154 Congener	0		pg/L					Organics	PCBs
PCB 136	PCB 136 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 137	PCB 137 Congener	35694065		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 137/176	PCB 137/176 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 138	PCB 138 Congener	35065282		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 138(Surrogate)	Surrogate: PCB 138 Congener	0			% recovery				Organics	PCBs
PCB 138/158	PCB 138/158 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 138/160	PCB 138/160 Congener	0			ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs
PCB 138/163	PCB 138/163	0			ug/Kg ww				Organics	PCBs
PCB 138/163/164	PCB 138/163/164 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 138-13C(Surrogate)	Surrogate: PCB 138-13C Congener	0		% recovery					Organics	PCBs
PCB 138-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 138-13C12	208263665		% recovery					Organics	PCBs	IDA
PCB 139	PCB 139 Congener	56030569		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 139/140	PCB 139/140 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 139/149	PCB 139/149 Congener	0		ug/L	ug/Kg dw				Organics	PCBs	Congeners
PCB 140	PCB 140 Congener	59291644		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 141	PCB 141 Congener	52712046		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 141/179	PCB 141/179 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 141-13C(Surrogate)	Surrogate: PCB 141-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 141-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 141-13C12	0		% recovery					Organics	PCBs	IDA
PCB 142	PCB 142 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 143	PCB 143 Congener	68194150		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 144	PCB 144 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 145	PCB 145 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 146	PCB 146 Congener	51908168		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 146/165	PCB 146/165 Congener	0		ug/L					Organics	PCBs
PCB 147	PCB 147 Congener	68194138		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 147/149	PCB 147/149 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 148	PCB 148 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 149	PCB 149 Congener	38380040		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 150	PCB 150 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 151	PCB 151 Congener	52663635		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 151/154	PCB 151/154	0			ug/Kg ww				Organics	PCBs
PCB 152	PCB 152 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 153	PCB 153 Congener	35065271		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 153(Surrogate)	Surrogate: PCB 153 Congener	0		% recovery			% recovery	% recovery	Organics	PCBs
PCB 153/168	PCB 153/168 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 153-13C(Surrogate)	Surrogate: PCB 153-13C Congener	0		% recovery					Organics	PCBs
PCB 153-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 153-13C12	185376583		% recovery					Organics	PCBs	IDA
PCB 154	PCB 154 Congener	60145224		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 155	PCB 155 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 155(Surrogate)	Surrogate: PCB 155 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 155-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 155-13C	0		% recovery
PCB 155-13C(Surrogate)	Surrogate: PCB 155-13C Congener	0		% recovery					Organics	PCBs
PCB 155-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 155-13C12	34432907		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 156	PCB 156 Congener	38380084		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 156 (TEQ ND=0)	PCB 156 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 156 (TEQ ND=1/2 DL)	PCB 156 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 156 (TEQ ND=DL)	PCB 156 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 156(Surrogate)	Surrogate: PCB 156 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 156/157	PCB 156/157 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 156/157 (TEQ ND=0)	PCB 156/157 (TEQ ND=0)	0		pg/sample	ug/Kg dw				Organics	PCBs
PCB 156/157 (TEQ ND=1/2 DL)	PCB 156/157 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw				Organics	PCBs
PCB 156/157 (TEQ ND=DL)	PCB 156/157 (TEQ ND=DL)	0		pg/sample	ug/Kg dw				Organics	PCBs
PCB 156/157(Surrogate)	Surrogate: PCB 156/157 Congener	0		% recovery	ug/Kg dw				Organics	PCBs
PCB 156/171	PCB 156/171 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 156/171/202	PCB 156/171/202 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 156/177/200	PCB 156/177/200 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 156-13C(Surrogate)	Surrogate: PCB 156-13C Congener	0		% recovery					Organics	PCBs
PCB 156-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 156-13C12	208263687		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 156-13C12/157-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 156-13C12/157-13C12	0			% recovery		% recovery	% recovery	Organics	PCBs	IDA	Coelution
PCB 157	PCB 157 Congener	69782907		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 157 (TEQ ND=0)	PCB 157 (TEQ ND=0)	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 157 (TEQ ND=1/2 DL)	PCB 157 (TEQ ND=1/2 DL)	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 157 (TEQ ND=DL)	PCB 157 (TEQ ND=DL)	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 157(Surrogate)	Surrogate: PCB 157 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 157/173	PCB 157/173 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 157/173/201	PCB 157/173/201 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 157/180	PCB 157/180 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 157-13C(Surrogate)	Surrogate: PCB 157-13C Congener	0		% recovery					Organics	PCBs
PCB 157-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 157-13C12	235416305		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 158	PCB 158 Congener	74472427		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 158/160	PCB 158/160 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 159	PCB 159 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 159(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 159	0		% recovery
PCB 159(Surrogate)	Surrogate: PCB 159 Congener	39635353		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 159/182/187	PCB 159/182/187 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 159-13C(Surrogate)	Surrogate: PCB 159-13C Congener	0		% recovery					Organics	PCBs
PCB 159-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 159-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Toxaphene	IDA
PCB 160	PCB 160 Congener	41411625		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 161	PCB 161 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 162	PCB 162 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 163	PCB 163 Congener	74472449		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 164	PCB 164 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 165	PCB 165 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 166	PCB 166 Congener	41411636		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 166/167	PCB 166/167 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 167	PCB 167 Congener	52663726		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 167 (TEQ ND=0)	PCB 167 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 167 (TEQ ND=1/2 DL)	PCB 167 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 167 (TEQ ND=DL)	PCB 167 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 167(Surrogate)	Surrogate: PCB 167 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 167-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 167-13C	0		% recovery
PCB 167-13C(Surrogate)	Surrogate: PCB 167-13C Congener	0		% recovery					Organics	PCBs
PCB 167-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 167-13C12	208263698		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 168	PCB 168 Congener	59291655		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 168/132	PCB 168/132 Congener	0		ug/L					Organics	PCBs
PCB 169	PCB 169 Congener	32774166		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 169 (TEQ ND=0)	PCB 169 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 169 (TEQ ND=1/2 DL)	PCB 169 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 169 (TEQ ND=DL)	PCB 169 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 169(Surrogate)	Surrogate: PCB 169 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 169-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 169-13C	0		% recovery
PCB 169-13C(Surrogate)	Surrogate: PCB 169-13C Congener	0		% recovery			% recovery	% recovery	Organics	PCBs
PCB 169-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 169-13C12	208263701		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 170	PCB 170 Congener	35065306		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 170(Surrogate)	Surrogate: PCB 170 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 170/190	PCB 170/190 Congener	0			ng/g dw		RPD	RPD	Organics	PCBs
PCB 170-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 170-13C	0		% recovery
PCB 170-13C(Surrogate)	Surrogate: PCB 170-13C Congener	0		% recovery					Organics	PCBs
PCB 170-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 170-13C12	160901804		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 171	PCB 171 Congener	52663715		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 171/173	PCB 171/173 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 171/202	PCB 171/202 Congener	0					ng/g ww	ng/g dw	Organics	PCBs
PCB 172	PCB 172 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 173	PCB 173 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 174	PCB 174 Congener	38411255		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 175	PCB 175 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 176	PCB 176 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 177	PCB 177 Congener	52663704		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 178	PCB 178 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 178(Surrogate)	Surrogate: PCB 178 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 178-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 178-13C	0		% recovery
PCB 178-13C(Surrogate)	Surrogate: PCB 178-13C Congener	0		% recovery					Organics	PCBs
PCB 178-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 178-13C12	232919674		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 179	PCB 179 Congener	52663646		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 180	PCB 180 Congener	35065293		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 180(Surrogate)	Surrogate: PCB 180 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 180/193	PCB 180/193 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 180-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 180-13C	0		% recovery
PCB 180-13C(Surrogate)	Surrogate: PCB 180-13C Congener	0		% recovery					Organics	PCBs
PCB 180-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 180-13C12	160901826		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 181	PCB 181 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 182	PCB 182 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 182/187	PCB 182/187 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 183	PCB 183 Congener	52663691		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 183/185	PCB 183/185 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 184	PCB 184 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 185	PCB 185 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 186	PCB 186 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 187	PCB 187 Congener	52663680		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 188	PCB 188 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 188(Surrogate)	Surrogate: PCB 188 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 188-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 188-13C	0		% recovery
PCB 188-13C(Surrogate)	Surrogate: PCB 188-13C Congener	0		% recovery					Organics	PCBs
PCB 188-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 188-13C12	234432918		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 189	PCB 189 Congener	39635319		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 189 (TEQ ND=0)	PCB 189 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 189 (TEQ ND=1/2 DL)	PCB 189 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 189 (TEQ ND=DL)	PCB 189 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB 189(Surrogate)	Surrogate: PCB 189 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 189-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 189-13C	0		% recovery
PCB 189-13C(Surrogate)	Surrogate: PCB 189-13C Congener	0		% recovery					Organics	PCBs
PCB 189-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 189-13C12	208263734		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 190	PCB 190 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 191	PCB 191 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 191(Surrogate)	Surrogate: PCB 191 Congener	0			ug/Kg dw				Organics	PCBs	Congeners
PCB 19-13C(Surrogate)	Surrogate: PCB 19-13C Congener	0		% recovery					Organics	PCBs
PCB 192	PCB 192 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 193	PCB 193 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 194	PCB 194 Congener	35694087		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 194(Surrogate)	Surrogate: PCB 194 Congener	0			% recovery				Organics	PCBs
PCB 194-13C(Surrogate)	Surrogate: PCB 194-13C Congener	0		% recovery					Organics	PCBs
PCB 194-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 194-13C12	208263745		% recovery					Organics	PCBs	IDA
PCB 195	PCB 195 Congener	52663782		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 195/208	PCB 195/208 Congener	0			ng/g dw		ng/g ww	ng/g dw	Organics	PCBs	Congeners
PCB 196	PCB 196 Congener	0		RPD	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 196/203	PCB 196/203 Congener	0		ug/L			RPD	RPD	Organics	PCBs
PCB 197	PCB 197 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 197/200	PCB 197/200 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 198	PCB 198 Congener	68194172		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 198(Surrogate)	Surrogate: PCB 198 Congener	68194172		ug/L	ug/Kg dw		% recovery	% recovery	Organics	PCBs	Congeners
PCB 198/199	PCB 198/199 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 199	PCB 199 Congener	52663759		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 199/200	PCB 199/200 Congener	0		ug/L	ug/g dw				Organics	PCBs
PCB 200	PCB 200 Congener	52663737		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 201	PCB 201 Congener	40186718		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 202	PCB 202 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 202(Surrogate)	Surrogate: PCB 202 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 202-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 202-13C	0		% recovery
PCB 202-13C(Surrogate)	Surrogate: PCB 202-13C Congener	0		% recovery					Organics	PCBs
PCB 202-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 202-13C12	105600268		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 203	PCB 203 Congener	52663760		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 204	PCB 204 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 205	PCB 205 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 205(Surrogate)	Surrogate: PCB 205 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 205-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 205-13C12	234446641		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 206	PCB 206 Congener	40186729		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 206(Surrogate)	Surrogate: PCB 206 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 206-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 206-13C	0		% recovery
PCB 206-13C(Surrogate)	Surrogate: PCB 206-13C Congener	0		% recovery					Organics	PCBs
PCB 206-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 206-13C12	208263756		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 207	PCB 207 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 207(Surrogate)	Surrogate: PCB 207 Congener	52663793		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	Congeners
PCB 208	PCB 208 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 208(Surrogate)	Surrogate: PCB 208 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs
PCB 208-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 208-13C	0		% recovery
PCB 208-13C(Surrogate)	Surrogate: PCB 208-13C Congener	0		% recovery					Organics	PCBs
PCB 208-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 208-13C12	234432929		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 209	PCB 209 Congener (Decachlorobiphenyl) (DCB)	2051243		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 209(Surrogate)	Surrogate: PCB 209 Congener (Decachlorobiphenyl) (DCB)	2051243		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 209(Surrogate)DB-608	Surrogate: PCB 209 run on DB-608 (Decachlorobiphenyl) (DCB)	2051243		% recovery	% recovery				Organics	PCBs
PCB 209(Surrogate)HP-5	Surrogate: PCB 209 run on HP-5 (Decachlorobiphenyl) (DCB)	2051243		% recovery	% recovery				Organics	PCBs
PCB 209-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 209-13C	0		% recovery
PCB 209-13C(Surrogate)	Surrogate: PCB 209-13C Congener	0		% recovery					Organics	PCBs
PCB 209-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 209-13C12	105600279		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 209-L(Surrogate)	Surrogate: PCB 209 Congener (Decachlorobiphenyl) (DCB)-Labeled not defined	2051243		ug/L			% recovery	% recovery	Organics	PCBs
PCB AROCLOR 1016	PCB Aroclor 1016	12674112		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Aroclors
PCB AROCLOR 1221	PCB Aroclor 1221	11104282		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Aroclors
PCB AROCLOR 1232	PCB Aroclor 1232	11141165		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Aroclors
PCB AROCLOR 1242	PCB Aroclor 1242	53469219		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Aroclors
PCB AROCLOR 1248	PCB Aroclor 1248	12672296		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors
PCB AROCLOR 1254	PCB Aroclor 1254	11097691		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors
PCB AROCLOR 1260	PCB Aroclor 1260	11096825		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors
PCB AROCLOR 1262	PCB Aroclor 1262	37324235		ug/L	ug/Kg dw				Organics	PCBs	Aroclors
PCB AROCLOR 1268	PCB AROCLOR 1268	11100144		ug/L	ug/Kg dw				Organics	PCBs	Aroclors
PCB TEQ (3 PCBs)	PCB TEQ (3 PCBs)	0					ng/g ww	ng/g dw	Organics	DioxinsDibenzofurans
PCB TEQ (5 PCBs)	PCB TEQ (5 PCBs)	0					NR ww	NR dw	Organics	DioxinsDibenzofurans
PCB TOTAL (TEQ ND=0)	PCB TOTAL (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB TOTAL (TEQ ND=1/2 DL)	PCB TOTAL (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCB TOTAL (TEQ ND=DL)	PCB TOTAL (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics
PCNB	PCNB (Pentachloronitrobenzene)	82688		ug/L					Organics	Pesticides	Pest-OCHs	Algaecides	Fungicides	Nematocides
PCT AROCLOR 5432	Polychlorinated Terphenyl AROCLOR 5432	0			ug/Kg dw
PCT AROCLOR 5442	Polychlorinated Terphenyl AROCLOR 5442	0			ug/Kg dw
PCT AROCLOR 5460	Polychlorinated Terphenyl AROCLOR 5460	0			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCT_DR	Percent dry channel	0	%						Bioassessment
PCT_FAST	Percent fast-water habitat of reach	0	%						Bioassessment
PCT_POOL	Percent pool habitat of reach	0	%						Bioassessment
PCT_RC	Percent concrete or asphalt streambed substrate physical-habitat metric	0	%						Bioassessment
PCT_SAFN	Percent sands and fines streambed substrate physical-habitat metric	0	%						Bioassessment
PCT_SLOW	Percent slow-water habitat of reach	0	%						Bioassessment
Pebble	Pebble	0			%				Inorganics	Conventionals	GrainSize
Pebulate	Pebulate (PEBC)	1114712		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates
PeCDD, 1,2,3,7,8-	1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD)	40321764		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
PECDD, 1,2,3,7,8- (TEQ ND=0)	1,2,3,7,8-PECDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
PECDD, 1,2,3,7,8- (TEQ ND=1/2 DL)	1,2,3,7,8-PECDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
PeCDD, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD)	40321764		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
PeCDD-13C, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin-13C (PeCDD)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
PeCDD-13C12, 1,2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin-13C12 (PeCDD-13C12)	109719791		% recovery					Organics	Dioxins/Dibenzofurans	IDA
PeCDF, 1,2,3,7,8-	1,2,3,7,8-Pentachlorodibenzofuran (PeCDF)	57117416		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
PECDF, 1,2,3,7,8- (TEQ ND=0)	1,2,3,7,8-PECDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
PECDF, 1,2,3,7,8- (TEQ ND=1/2 DL)	1,2,3,7,8-PECDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
PeCDF, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzofuran (PeCDF)	57117416		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
PeCDF, 2,3,4,7,8-	2,3,4,7,8-Pentachlorodibenzofuran (PeCDF)	57117314		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
PECDF, 2,3,4,7,8- (TEQ ND=0)	2,3,4,7,8-PECDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
PECDF, 2,3,4,7,8- (TEQ ND=1/2 DL)	2,3,4,7,8-PECDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
PeCDF, 2,3,4,7,8-(Surrogate)	Surrogate: 2,3,4,7,8-Pentachlorodibenzofuran (PeCDF)	57117314		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
PeCDF-13C, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzofuran-13C (PeCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
PeCDF-13C, 2,3,4,7,8-(Surrogate)	Surrogate: 2,3,4,7,8-Pentachlorodibenzofuran-13C (PeCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
PeCDF-13C12, 1,2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8-Pentachlorodibenzofuran-13C12 (PeCDF-13C12)	109719779		% recovery					Organics	Dioxins/Dibenzofurans	IDA
PeCDF-13C12, 2,3,4,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,4,7,8-Pentachlorodibenzofuran-13C12 (PeCDF-13C12)	116843028		% recovery					Organics	Dioxins/Dibenzofurans	IDA
Pen/Marker	Pen/Marker	0	pieces						Debris	Trash	Plastics	Toxic
Pendimethalin	Pendimethalin (Prowl)	40487421		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Herbicides
Penicillin G	Penicillin G	61336		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Penicillin V	Penicillin V	87081		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Penoxsulam	Penoxsulam	219714962		ug/L					Organics	Pesticides	Herbicides
Pentabromobenzene	Pentabromobenzene (PBBZ)	608902			ng/g dw				Organics	FlameRetardants
Pentabromobenzyl acrylate	Pentabromobenzyl acrylate (PBBA)	59447551			ng/g dw				Organics	FlameRetardants
Pentabromobenzyl Bromide-1/Pentabromotoluene	Pentabromobenzyl Bromide (isomer 1)/Pentabromotoluene (PBBB-1/PBT coeluants)	0			ng/g dw				Organics	FlameRetardants
Pentabromobenzyl Bromide-2/Polybrominated Biphenyl 101	Pentabromobenzyl bromide (isomer 2)/Polybrominated Biphenyl 101 (PBBB-2/BB-101 coeluants)	0			ng/g dw				Organics	FlameRetardants
Pentabromoethylbenzene	Pentabromoethylbenzene (PBEB)	85223			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
Pentachloroanisole	Pentachloroanisole	1825214		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs
Pentachlorobenzene	Pentachlorobenzene	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs
Pentachlorobenzene(Surrogate)	Surrogate: Pentachlorobenzene	0					% recovery	% recovery	Organics	VOCs
Pentachlorobenzene-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Pentachlorobenzene-13C6	2483735540			% recovery		% recovery	% recovery
Pentachloroethane	Pentachloroethane	76017		ug/L					Organics
Pentachloronitrobenzene	Pentachloronitrobenzene (PCNB)	82688		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Algaecides	Fungicides	Nematocides
Pentachlorophenol	Pentachlorophenol	87865		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	Chlorinated Phenols	Insecticides	Fungicides
Pentacosane, n-	n-Pentacosane	629992					ng/g ww	ng/g dw	Organics	Alkanes
Pentadecane, n-	n-Pentadecane	629629					ng/g ww	ng/g dw	Organics	Alkanes
Perchlorate	Perchlorate	14797730		ug/L	ug/Kg dw				Inorganics	Conventionals
Perfluoro(2-ethoxyethane)sulfonic Acid	Perfluoro(2-ethoxyethane)sulfonic acid (PFEESA)	113507827		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluoro-2-propoxypropanoate	Perfluoro-2-propoxypropanoate (Hexafluoropropylene oxide dimer acid; HFPO-DA)	122499176			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluoro-2-propoxypropanoate-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoro-2-propoxypropanoate-13C3 (HFPO-DA)	0			% recovery		% recovery	% recovery	Organics	PFAS
Perfluoro-2-Propoxypropanoic Acid	Perfluoro-2-Propoxypropanoic Acid	13252136		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluoro-2-Propoxypropanoic Acid-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoro-2-Propoxypropanoic Acid-13C3 (HFPO-DA-13C3)	3030247970		% recovery					Organics	PFAS	IDA
Perfluoro-2-Propoxypropanoic Acid-13C3(Surrogate)	Surrogate: Perfluoro-2-Propoxypropanoic Acid-13C3 (HFPO-DA)	0					% recovery	% recovery	Organics	PFAS
Perfluoro-3,6-dioxaheptanoate	Perfluoro-3,6-dioxaheptanoate (Nonafluoro-3,6-dioxaheptanoic acid) (NFDHA)	151772586		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluoro-3-methoxypropanoate	Perfluoro-3-methoxypropanoate (Perfluoro-3-methoxypropanoic acid) (PFMPA)	377731		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluoro-3-methoxypropanoic Acid	Perfluoro-3-methoxypropanoic Acid (PFMPA)	377731		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluoro-4-methoxybutanoate	Perfluoro-4-methoxybutanoate (Perfluoro-4-methoxybutanoic acid) (PFMBA)	863090895		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluoro-4-methoxybutanoic Acid	Perfluoro-4-methoxybutanoic Acid (PFMBA)	863090895		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorobutanesulfonate	Perfluorobutanesulfonate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorobutanesulfonate-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorobutanesulfonate-13C3 (PFBS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorobutanesulfonate-13C3(Surrogate)	Surrogate: Perfluorobutanesulfonate-13C3 (PFBS)	0					% recovery	% recovery	Organics	PFAS
Perfluorobutanesulfonic Acid	Perfluorobutanesulfonic Acid (PFBS)	375735		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorobutanesulfonic Acid-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorobutanesulfonic Acid-13C3 (PFBS-13C3)	2708218840		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluorobutanoate	Perfluorobutanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorobutanoate(Surrogate)	Surrogate: Perfluorobutanoic Acid (PFBTA), (PFBA)	375224		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Perfluorobutanoate-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorobutanoate-13C4 (PFBTA) (PFBA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorobutanoate-13C4(Surrogate)	Surrogate: Perfluorobutanoate-13C4	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorobutanoic Acid	Perfluorobutanoic Acid (PFBA)	375224		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorobutanoic Acid-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorobutanoic Acid-13C4 (PFBA-13C4)	1017281296		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluorodecane Sulfonic acid, 1H,1H,2H,2H-	1H,1H,2H,2H-Perfluorodecane Sulfonic Acid (8:2FTS)	39108344		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorodecane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue)	Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorodecane Sulfonic Acid-13C2 (8:2FTS-13C2)	2708218908		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluorodecanesulfonate	Perfluorodecanesulfonate	126105348		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorodecanesulfonic Acid	Perfluorodecanesulfonic Acid (PFDS)	335773		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorodecanoate	Perfluorodecanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorodecanoate(Surrogate)	Surrogate: Perfluorodecanoic Acid (PFDA)	335762		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Perfluorodecanoate-13C2(Surrogate)	Surrogate: Perfluorodecanoate-13C2	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorodecanoate-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorodecanoate-13C6 (PFDA)	0		ng/L	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorodecanoic Acid	Perfluorodecanoic Acid (PFDA)	335762		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorodecanoic Acid-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorodecanoic Acid-13C6 (PFDA-13C6)	2328024560		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluorodecylphosphate, 1H,1H,2H,2H-	1H,1H,2H,2H-perfluorodecylphosphate (8:2 monoPAP)	0			ng/g dw				Organics	PFAS	PFC Precursor
Perfluorodecylphosphate-13C2, 1H,1H,2H,2H-(Surrogate)	Surrogate: 1H,1H,2H,2H-perfluorodecylphosphate-13C2	0			% recovery				Organics	PFAS
Perfluorodecylphosphonate	Perfluorodecylphosphonate (PFDPA)	0			ng/g dw				Organics	PFAS
Perfluorododecanesulfonate	Perfluorododecanesulfonate	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorododecanesulfonic Acid	Perfluorododecanesulfonic Acid (PFDoS)	79780395		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorododecanoate	Perfluorododecanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorododecanoate(Surrogate)	Surrogate: Perfluorododecanoic Acid (PFDoA)	307551		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Perfluorododecanoate-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorododecanoate-13C2 (PFDoA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorododecanoate-13C2(Surrogate)	Surrogate: Perfluorododecanoate-13C2	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorododecanoic Acid	Perfluorododecanoic Acid (PFDoA)	307551		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorododecanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorododecanoic Acid-13C2 (PFDoA-13C2)	960315520		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluoroheptanesulfonate	Perfluoroheptanesulfonate	375928		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluoroheptanesulfonic Acid	Perfluoroheptanesulfonic Acid (PFHpS)	375928		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluoroheptanoate	Perfluoroheptanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluoroheptanoate-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroheptanoate-13C4 (PFHpA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluoroheptanoate-13C4(Surrogate)	Surrogate: Perfluoroheptanoate-13C4 (PFHpA)	0					% recovery	% recovery	Organics	PFAS
Perfluoroheptanoic Acid	Perfluoroheptanoic Acid (PFHpA)	375859		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluoroheptanoic acid-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroheptanoic Acid-13C4 (PFHpA-13C4)	2328024559		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluoroheptyl Propanoic Acid, 3-	3-Perfluoroheptyl Propanoic Acid (7:3FTCA)	812704		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorohexadecanoic Acid	Perfluorohexadecanoic acid (PFHxDA)	67905195			ng/g dw				Organics	PFAS
Perfluorohexane Sulfonic Acid, 1H,1H,2H,2H-	1H,1H,2H,2H-Perfluorohexane Sulfonic Acid (4:2FTS)	757124724		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorohexane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue)	Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorohexane Sulfonic Acid-13C2 (4:2FTS-13C2)	2708218884		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluorohexanesulfonate	Perfluorohexanesulfonate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorohexanesulfonate-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanesulfonate-13C3 (PFHxS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorohexanesulfonate-13C3(Surrogate)	Surrogate: Perfluorohexanesulfonate-13C3 (PFHxS)	0					% recovery	% recovery	Organics	PFAS
Perfluorohexanesulfonate-18O2(Surrogate)	Surrogate: Perfluorohexanesulfonate-18O2	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorohexanesulfonic Acid	Perfluorohexanesulfonic Acid (PFHxS)	355464		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorohexanesulfonic Acid-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanesulfonic Acid-13C3 (PFHxS-13C3)	2708218862		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluorohexanoate	Perfluorohexanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorohexanoate(Surrogate)	Surrogate: Perfluorohexanoic Acid (PFHxA)	307244		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Perfluorohexanoate-13C2(Surrogate)	Surrogate: Perfluorohexanoate-13C2	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorohexanoate-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanoate-13C5 (PFHxA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorohexanoic Acid	Perfluorohexanoic Acid (PFHxA)	307244		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorohexanoic Acid-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanoic Acid-13C5 (PFHxA-13C5)	2328024548		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluorohexylperfluorooctylphosphinate	Perfluorohexylperfluorooctylphosphinate (6:8 PFPi)	0			ng/g dw				Organics	PFAS	PFC Precursor
Perfluorohexylphosphonate	Perfluorohexylphosphonate (PFHxPA)	0			ng/g dw				Organics	PFAS	PFC Precursor
Perfluorohexylphosphonate-Cl(Surrogate)	Surrogate: Perfluorohexylphosphonate-Cl	0			% recovery				Organics	PFAS	PFC Precursor
Perfluorononanesulfonate	Perfluorononanesulfonate	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorononanesulfonic Acid	Perfluorononanesulfonic Acid (PFNS)	68259121		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorononanoate	Perfluorononanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorononanoate(Surrogate)	Surrogate: Perfluorononanoic Acid (PFNA)	375951		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Perfluorononanoate-13C5(Surrogate)	Surrogate: Perfluorononanoate-13C5	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorononanoate-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorononanoate-13C9 (PFNA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorononanoic Acid	Perfluorononanoic Acid (PFNA)	375951		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorononanoic Acid-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorononanoic Acid-13C9 (PFNA-13C9)	2283397806		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluorooctadecanoic Acid	Perfluorooctadecanoic Acid (PFODA) (PFOcDA)	16517116			ng/g dw				Organics	PFAS
Perfluorooctane Sulfonamido Acetic Acid	Perfluorooctane Sulfonamido Acetic Acid (FOSAA)	0			ng/g dw				Organics	PFAS	PFC Precursor
Perfluorooctane Sulfonic Acid, 1H,1H,2H,2H-	1H,1H,2H,2H-Perfluorooctane Sulfonic Acid (6:2FTS)	27619972		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorooctane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue)	Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorooctane Sulfonic Acid-13C2 (6:2FTS-13C2)	2708218895		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluorooctanesulfonamide	Perfluorooctanesulfonamide (PFOSA)	754916		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorooctanesulfonamide-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanesulfonamide-13C8 (PFOSA-13C8)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluorooctanesulfonamide-13C8(Surrogate)	Surrogate: Perfluorooctanesulfonamide-13C8	0			% recovery		% recovery	% recovery	Organics	PFAS	PFOA
Perfluorooctanesulfonate	Perfluorooctanesulfonate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorooctanesulfonate 080(Surrogate)	Surrogate: Perfluorooctanesulfonate 080 (PFOS)	45298906		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Perfluorooctanesulfonate-13C4(Surrogate)	Surrogate: Perfluorooctanesulfonate-13C4	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorooctanesulfonate-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanesulfonate-13C8 (PFOS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorooctanesulfonic Acid	Perfluorooctanesulfonic Acid (PFOS)	1763231		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorooctanesulfonic acid (PFOS)	Perfluorooctanesulfonic acid (PFOS)	0		ng/L	ng/g dw		ng/g ww	ng/g dw	PFOS
Perfluorooctanesulfonic Acid-13C4(Surrogate)	Surrogate: Perfluorooctanesulfonic Acid-13C4 (PFOS-13C4)	960315531		% recovery					Organics	PFAS
Perfluorooctanesulfonic Acid-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanesulfonic Acid-13C8 (PFOS-13C8)	2522762167		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluorooctanesulfonic Acid-13C8(Surrogate)	Surrogate: Perfluorooctanesulfonic Acid-13C8 (PFOS-13C8)	2522762167		% recovery					Organics	PFAS
Perfluorooctanoate	Perfluorooctanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorooctanoate(Surrogate)	Surrogate: Perfluorooctanoic Acid (PFOA)	335671		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Perfluorooctanoate-13C2(Surrogate)	Surrogate: Perfluorooctanoate-13C2	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorooctanoate-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanoate-13C8 (PFOA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorooctanoate-13C8(Surrogate)	Surrogate: Perfluorooctanoate-13C8	0					% recovery	% recovery	Organics	PFAS
Perfluorooctanoic Acid	Perfluorooctanoic Acid (PFOA)	335671		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorooctanoic acid (PFOA)	Perfluorooctanoic acid (PFOA)	0		ng/L	ng/g dw		ng/g ww	ng/g dw	PFOA
Perfluorooctanoic Acid, 2H,2H,3H,3H-	2H,2H,3H,3H-Perfluorooctanoic Acid (5:3FTCA)	914637493		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorooctanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanoic Acid-13C2 (PFOA-13C2)	864071089		% recovery					Organics	PFAS	IDA
Perfluorooctanoic Acid-13C2(Surrogate)	Surrogate: Perfluorooctanoic Acid-13C2 (PFOA-13C2)	864071089		% recovery					Organics	PFAS
Perfluorooctanoic Acid-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanoic Acid-13C8 (PFOA-13C8)	1350614844		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluorooctylphosphate, 1H,1H,2H,2H-	1H,1H,2H,2H-perfluorooctylphosphate (6:2 monoPAP)	0			ng/g dw				Organics	PFAS	PFC Precursor
Perfluorooctylphosphate-13C2, 1H,1H,2H,2H-(Surrogate)	Surrogate: 1H,1H,2H,2H-perfluorooctylphosphate-13C2	0			% recovery				Organics	PFAS
Perfluorooctylphosphonate	Perfluorooctylphosphonate (PFOPA)	0			ng/g dw				Organics	PFAS	PFC Precursor
Perfluoropentanesulfonate	Perfluoropentanesulfonate	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluoropentanesulfonic Acid	Perfluoropentanesulfonic Acid (PFPeS)	2706914		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluoropentanoate	Perfluoropentanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluoropentanoate-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoropentanoate-13C5 (PFPA) (PFPeA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluoropentanoate-13C5(Surrogate)	Surrogate: Perfluoropentanoate-13C5 (PFPA) (PFPeA)	0					% recovery	% recovery	Organics	PFAS
Perfluoropentanoic Acid	Perfluoropentanoic Acid (PFPeA)	2706903		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluoropentanoic Acid-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoropentanoic Acid-13C5 (PFPeA-13C5)	2283397793		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Perfluoropropyl Propanoic Acid, 3-	3-Perfluoropropyl Propanoic Acid (3:3FTCA)	356025		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorotetradecanoate	Perfluorotetradecanoate	376067		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorotetradecanoate-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorotetradecanoate-13C2 (PFTeDA) (PFTA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluorotetradecanoate-13C2(Surrogate)	Surrogate: Perfluorotetradecanoate-13C2 (PFTeDA) (PFTA)	0					% recovery	% recovery	Organics	PFAS
Perfluorotetradecanoic Acid	Perfluorotetradecanoic Acid (PFTeDA)	376067		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorotetradecanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorotetradecanoic Acid-13C2 (PFTeDA-13C2)	2708218828		% recovery			% recovery	% recovery	Organics	PFAS	IDA
Perfluorotridecanoate	Perfluorotridecanoate	72629948		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluorotridecanoic Acid	Perfluorotridecanoic Acid (PFTrDA)	72629948		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorotridecanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorotridecanoic Acid-13C2 (PFTrDA-13C2)	0			% recovery		% recovery	% recovery	Organics	PFAS
Perfluoroundecanoate	Perfluoroundecanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS
Perfluoroundecanoate-13C7(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroundecanoate-13C7 (PFUnDA) (PFUdA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS
Perfluoroundecanoate-13C7(Surrogate)	Surrogate: Perfluoroundecanoate-13C7 (PFUnDA) (PFUdA)	0					% recovery	% recovery	Organics	PFAS
Perfluoroundecanoic Acid	Perfluoroundecanoic Acid (PFUnA)	2058948		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluoroundecanoic Acid-13C7(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroundecanoic Acid-13C7 (PFUnA-13C7)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA
Permethrin, cis-	cis-Permethrin, formerly peak 1	61949766		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-Pyrethroids	Insecticides
Permethrin, cis-(Surrogate)	Surrogate: cis-Permethrin	0		% recovery	% recovery				Organics	Pesticides	Pyrethroids	Insecticides
Permethrin, Total	Total Permethrin, sum peaks cis and trans (formerly 1 & 2)	52645531		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Pyrethroids	Insecticides
Permethrin, trans-	trans-Permethrin formerly peak 2	61949777		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-Pyrethroids	Insecticides
Permethrin, trans-(Surrogate)	Surrogate: trans-Permethrin	0		% recovery					Organics	Pesticides	Pyrethroids	Insecticides
Permethrin-13C6, cis-(IsoDilAnalogue)	Isotope Dilution Analogue: cis-Permethrin-13C6	0					% recovery	% recovery	Organics	Pest-Pyrethroids	IDA
Permethrin-13C6, cis-(Surrogate)	Surrogate: cis-Permethrin-13C6	0		ng/L	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-Pyrethroids	Insecticides
Permethrin-13C6, trans-(IsoDilAnalogue)	Isotope Dilution Analogue: trans-Permethrin-13C6	0					% recovery	% recovery	Organics	Pest-Pyrethroids	IDA
Personal hygiene	Hygiene products	0	pieces						Debris	Trash	Plastics
Perthane	Perthane	72560		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	OrganochlorinePesticides	Insecticides
Perylene	Perylene	198550		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH
Perylene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Perylene-d12	1520963		% recovery					Organics	PAHs	IDA
Perylene-d12(Surrogate)	Surrogate: Perylene-d12	1520963		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH
pH	pH	0		none	none	none			WaterQualityMeasurements	ToxTreatment
pH, Daily Maximum	Daily Maximum pH	0		none					WaterQualityMeasurements	Conventionals
pH, Daily Minimum	Daily Minimum pH	0		none					WaterQualityMeasurements	Conventionals
Phenanthrene	Phenanthrene	85018		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors
Phenanthrene/Anthracene, C1-	C1-Phenanthrene/Anthracene	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Phenanthrene/Anthracene, C2-	C2-Phenanthrene/Anthracene	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Phenanthrene/Anthracene, C3-	C3-Phenanthrene/Anthracene	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Phenanthrene/Anthracene, C4-	C4-Phenanthrene/Anthracene	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Phenanthrene-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Phenanthrene-d10	1517222		% recovery					Organics	PAHs	IDA
Phenanthrene-d10(Surrogate)	Surrogate: Phenanthrene-d10	1517222		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors
Phenol	Phenol	108952		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	non-Chlorinated Phenols
Phenol, 2-(2H-Benzotriazol-2-yl)-4,6-bis(1-Methyl-1-Phenylethyl)-	2-(2H-Benzotriazol-2-yl)-4,6-bis(1-methyl-1-phenylethyl)phenol (UV-234)	70321867		ng/L					Organics	Benzotriazoles and Benzothiazoles
Phenol-d5(Surrogate)	Surrogate: Phenol-d5	4165622		ug/L					Organics	SVOCs
Phenol-d6(Surrogate)	Surrogate: Phenol-d6	13127883		ug/L					Organics	VOCs	Phenols	non-Chlorinated Phenols
Phenolics, Total	Total Phenolics, classification of phenols	0		ug/L					Organics	PPCPs
Phenothrin	Phenothrin	26002802		ug/L	ug/Kg ww				Organics	Pesticides	Insecticides	Pyrethroids
Phenyl-p-phenylenediamine-quinone, N-Isopropyl-N'-	N-Isopropyl-N'-phenyl-p-phenylenediamine-quinone (IPPD-quinone)	68054739		ng/L					Organics	para-Phenylenediamine (PPD) Derivatives
Phenylpyrazole, 1-(Surrogate)	Surrogate: 1-Phenylpyrazole	1126007		% recovery					Organics	Pesticides	Insecticides	Phenylpyrazoles
Phenytoin	Phenytoin	57410		ng/L
Pheophytin a	Pheophytin a	603178		ug/L					Inorganics	Conventionals	Benthic
PhiX174	phi X 174 bacteriophage	0		copies/100 mL					Microbiological
Phone	Phone	0	pieces						Debris	Trash	Plastics	Toxic
Phorate	Phorate	298022		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides
Phosalone	Phosalone	2310170		ug/L					Organics	Pesticides	Pest-OPs	Insecticides
Phosalone Oxon	Phosalone Oxon	0		ug/L					Organics	Pesticides
Phosmet	Phosmet	732116		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Phosmet-Oxon	Phosmet-Oxon	3735339		ug/L					Organics	Pesticides
Phosphamidon	Phosphamidon	13171216		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Phosphate as P	Phosphate as P	14265442		umol/L	mg/Kg dw				Inorganics	Conventionals	Nutrients	WaterQualityMeasurements
Phosphorus as P	Phosphorus as P	7723140		ug/L	ug/g ww		ug/g ww	ug/g dw	Inorganics	Conventionals	Nutrients
Phosphorus, Inorganic	Inorganic Phosohorus	0		mg/L					Inorganics	Conventionals
Phosphorus, Iron Bound	Phosphorus, Iron Bound	0			ug/g dw				Inorganics	Conventional	Nutrients
Phosphorus, loosely bound	Phosphorus, loosely bound	0			ug/g dw				Inorganics	Conventional	Nutrients
Phytane	Phytane	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Alkanes
Picloram	Picloram	1918021		ug/L					Organics	Herbicides
Picoxystrobin	Picoxystrobin	117428225		ng/L					Organics	Pesticides	Fungicides
PictureCode	Picture code idenifier	0	none						FieldObservations	Habitat
Pipe, PVC	Pipe, PVC	0	pieces						Debris	Trash	Plastics	Household
Piperonyl Butoxide	Piperonyl Butoxide	51036		ug/L	ug/Kg ww				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Pipes, Drains	Pipes, Drains	0	none						Habitat
Pirimiphos Methyl	Pirimiphos Methyl	29232937		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	Insecticides
Plastic	Plastic using Trash Protocol	0	pieces						Trash
Plastic MicroDebris, > 4.75 mm	Plastic MicroDebris, > 4.75 mm	0	pieces						Debris	Plastics
Plastic MicroDebris, 0.355 mm	Plastic MicroDebris, 0.355 mm	0	pieces						Debris	Plastics
Plastic MicroDebris, 0.500 mm	Plastic MicroDebris, 0.500 mm	0	pieces						Debris	Plastics
Plastic MicroDebris, 1.0 mm	Plastic MicroDebris, 1.0 mm	0	pieces						Debris	Plastics
Plastic MicroDebris, 2.0 mm	Plastic MicroDebris, 2.0 mm	0	pieces						Debris	Plastics
Plastic MicroDebris, 4.75 mm	Plastic MicroDebris, 4.75 mm	0	pieces						Debris	Plastics
Plastic MicroDebris, Black	Plastic MicroDebris, Black	0	pieces						Debris	Plastics
Plastic MicroDebris, Blue	Plastic MicroDebris, Blue	0	pieces						Debris	Plastics
Plastic MicroDebris, Clear	Plastic MicroDebris, Clear	0	pieces						Debris	Plastics
Plastic MicroDebris, Green	Plastic MicroDebris, Green	0	pieces						Debris	Plastics
Plastic MicroDebris, Grey	Plastic MicroDebris, Grey	0	pieces						Debris	Plastics
Plastic MicroDebris, Orange	Plastic MicroDebris, Orange	0	pieces						Debris	Plastics
Plastic MicroDebris, Peach	Plastic MicroDebris, Peach	0	pieces						Debris	Plastics
Plastic MicroDebris, Pink	Plastic MicroDebris, Pink	0	pieces						Debris	Plastics
Plastic MicroDebris, Red	Plastic MicroDebris, Red	0	pieces						Debris	Plastics
Plastic MicroDebris, Tan	Plastic MicroDebris, Tan	0	pieces						Debris	Plastics
Plastic MicroDebris, White	Plastic MicroDebris, White	0	pieces						Debris	Plastics
Plastic MicroDebris, Yellow	Plastic MicroDebris, Yellow	0	pieces						Debris	Plastics
Plastic, Other	Plastic, Other	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Plate, Waxed Paper	Plate, Waxed Paper	0	pieces						Debris	Trash	Plastics	FoodService
PMMoV	Pepper mild mottle virus	0		copies/100 mL					Microbiological
Point Source Discharges Extent	Point Source Discharges Extent	0	none						Habitat
Point Source Discharges Intensity	Point Source Discharges Intensity	0	none						Habitat
Point Source Discharges Proximity	Point Source Discharges Proximity	0	none						Habitat
Ponded	Ponded water that either evaporates and/or infiltrates and does not flow to a surface receiving water	0	none						Habitat
Pool	Pool	0	%						Habitat
Pool Form	Pool Form	0	none						Habitat
Porosity	Porosity	0			mL/cm3				WaterQualityMeasurements	Ancillary
Position	Position along transect where sample collected	0	none						Habitat
Potassium	Potassium	7440097		ug/L	mg/Kg nr		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals	Conventionals
Potential Non-Stormwater Source	Potential Non-Stormwater Source	0	none
Poultry	Poultry	0	none						Habitat
Power Plants	Power Plants	0	none						Habitat
Prallethrin	Prallethrin	23031369		ug/L	ug/Kg ww				Organics	Pesticides	Insecticides	Pyrethroids
Precipitation	Precipitation	0	none						FieldObservations	Habitat
PrecipitationLast24hrs	PrecipitationLast24hrs	0	none						FieldObservations	Habitat
Precipitationlast72hrs	Precipitation within the last 72 hours	0	none
Prednisolone	Prednisolone	50248		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Prednisone	Prednisone	53032		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Primidone	Primidone	125337		ng/L
Primitive Parks, Camping	Primitive Parks, Camping	0	none						Habitat
Pristane	Pristane	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Alkanes
Procymidone	Procymidone	32809168		ug/L					Organics	Pesticides
Prodiamine	Prodiamine	29091212		ug/L	ug/Kg dw				Organics	Herbicides
Profenofos	Profenofos	41198087		ug/L					Organics	Pesticides
Profluralin	Profluralin	26399360		ug/L					Organics	Pesticides	Herbicides
Progesterone	Progesterone	57830		ng/L
Progesterone-d9(IsoDilAnalogue)	Isotope Dilution Analogue: Progesterone-d9	15775743		% recovery					Organics
Promethazine	Promethazine	60877		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Promethazine-d4(Surrogate)	Surrogate: Promethazine-d4	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Prometon	Prometon	1610180		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Triazines	Herbicides
Prometryn	Prometryn	7287196		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Triazines	Herbicides
Pronamide	Pronamide (Propyzamide)	23950585		ug/L					Organics	Herbicides
Propachlor	Propachlor	1918167		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Propanil	Propanil	709988		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides
Propargite	Propargite	2312358		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OPs	Acaricides
Propazine	Propazine	139402		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Propham	Propham	122429		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Propiconazole	Propiconazole	60207901		ug/L	ug/Kg dw				Organics	Herbicides
Proportion	Proportion	0	%						Habitat
Propoxur	Propoxur	114261		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides
Propoxyphene	Propoxyphene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Propoxyphene-d5(Surrogate)	Surrogate: Propoxyphene-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Propranolol	Propranolol	525666		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Propranolol-d7(Surrogate)	Surrogate: Propranolol-d7	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Propylbenzene, n-	n-Propylbenzene	103651		ug/L					Organics	VOCs
Propyzamide	Propyzamide	23950585		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides
Pseudo-nitzschia	Pseudo-nitzschia	0		cells/ml					Microbiological	Pathogens
p-Terphenyl-d14(Surrogate)	Surrogate: p-Terphenyl-d14	0		% recovery	% recovery		ng/g ww	ng/g dw	Organics	SVOCs
Public Access	Public Access	0	none						Habitat	Debris
Pymetrozin	Pymetrozin	123312890		ug/L					Organics	Pesticides
Pyraclostrobin	Pyraclostrobin	175013180		ug/L	ug/Kg dw				Organics	Fungicides
Pyrene	Pyrene	129000		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH
Pyrene-d10(Surrogate)	Surrogate: Pyrene-d10	1718521		ug/L	% recovery		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH
Pyrethrin-1	Pyrethrin-1	121211		ug/L	ng/g dw				Organics	Pesticides	Pyrethroids
Pyrethrin-2	Pyrethrin-2 (Pyrethrin II)	121299		ug/L	ng/g dw				Organics	Pesticides	Pyrethroids
Pyridaben	Pyridaben	96489713		ug/L	ug/Kg dw				Organics	Pesticides	Insecticides
Pyridine	Pyridine	110861		ug/L					Organics	SVOCs
Pyrimethanil	Pyrimethanil	53112280		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Pyriproxyfen	Pyriproxyfen	95737681		ug/L					Organics	Pesticides
Quinoxyfen	Quinoxyfen	124495187		ug/L					Organics	Pesticides	Fungicides
Radium-226	Radium-226	13982633		pCi/L					Radiochemistry
Radium-228	Radium-228	0		pCi/L					Radiochemistry	NULL
Railroad Extent	Railroad Extent	0	none						Habitat
Railroad Intensity	Railroad Intensity	0	none						Habitat
Railroad Proximity	Railroad Proximity	0	none						Habitat
Rangeland Extent	Rangeland Extent	0	none						Habitat
Rangeland Intensity	Rangeland Intensity	0	none						Habitat
Rangeland Proximity	Rangeland Proximity	0	none						Habitat
Ranitidine	Ranitidine	66357355		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Rapid	Rapid	0	%						Habitat
Ratio of SEM/AVS	Ratio of SEM/AVS	0		ug/L	umol/g				Inorganics	Metals
Rebar	Rebar	0	pieces						Debris	Trash	Non-Plastics	Metals
Reproduction	Reproduction	0				Num/Rep			Toxicity
Residences	Residences	0	none						Habitat
Residential Dumping	Residential Dumping	0	none						Habitat
Residual Phosphorus	Residual Phosphorus	0			ug/g dw				Inorganics	Conventional	Nutrients
Resmethrin	Resmethrin	10453868		ug/L	ug/Kg ww				Organics	Pesticides	Insecticides	Pyrethroids
Retene	Retene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs
Ribbon, Non-plastic	Ribbon, Non-plastic	0	pieces						Debris	Trash	Non-Plastics	Household
Ribbon, Packaging	Ribbon, Packaging	0	pieces						Debris	Trash	Plastics	Miscellaneous
Riffle	Riffle	0	%						Habitat
Riffle/Run Bank Stability	Riffle/Run Bank Stability (used for EMAP RBP 20-score habitat characterization)	0	none						Habitat
Riffle/Run Channel Alteration	Riffle/Run Channel Alteration	0	none						Habitat
Riffle/Run Channel Flow Status	Riffle/Run Channel Flow Status	0	none						Habitat
Riffle/Run Embeddedness	Riffle/Run Embeddedness	0	none						Habitat
Riffle/Run Epifaunal Substrate	Riffle/Run Epifaunal Substrate	0	none						Habitat
Riffle/Run Frequency	Riffle/Run Frequency	0	none						Habitat
Riffle/Run Riparian Zone Width	Riffle/Run Riparian Zone Width	0	none						Habitat
Riffle/Run Sediment Deposition	Riffle/Run Sediment Deposition	0	none						Habitat
Riffle/Run Vegetative Protection	Riffle/Run Vegetative Protection	0	none						Habitat
Riffle/Run Velocity/Depth Regime	Riffle/Run Velocity/Depth Regime scale data	0	none						Habitat
Rimsulfuron	Rimsulfuron	0		ug/L					Organics	Pesticides	Herbicides
Riparian Bridges/Abutments	Riparian Bridges/Abutments	0	none						Habitat
Riparian Buildings	Riparian Buildings	0	none						Habitat
Riparian Canopy Big Trees	EMAP BA Specific - Riparian Canopy Big Trees (Trunk > 0.3m DBH)	0	none						Habitat
Riparian Canopy Small Trees	EMAP BA Specific - Riparian Canopy Small Trees (Trunk < 0.3 m DBH)	0	none						Habitat
Riparian Canopy Veg Type	Riparian Canopy Vegetation Type	0	none						Habitat
Riparian Corridor Shading	Percent of stream's water surface upstream of sample location estimated to be shaded if the sun was directly over the stream	0	%						FieldObservations	Habitat
Riparian Cover Metric	Metric assesses total vegetation cover in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte.	0	score						Habitat
Riparian Grasses	Riparian Grasses	0	%						Habitat
Riparian GroundCover Barren	Riparian Ground Cover Barren, Bare Dirt or Duff	0	none						Habitat
Riparian GroundCover NonWoody Plants	Riparian Ground Cover Non-woody Herbs, Grasses & Forbes	0	none						Habitat
Riparian GroundCover Woody Shrubs	Riparian Ground Cover Woody Shrubs & Saplings	0	none						Habitat
Riparian Landfill/Trash	Riparian Landfill/Trash	0	none						Habitat
Riparian Logging	Riparian Logging Operations	0	none						Habitat
Riparian Lower Canopy All Vegetation	Riparian Lower Canopy All Vegetation (merge of Riparian Understory Non-Woody Plants and Riparian Understory Woody Shrubs in EMAP BA)	0	none						Habitat
Riparian Mining	Riparian Mining Activity	0	none						Habitat
Riparian NonWoody Veg	Riparian NonWoody Veg	0	%						Habitat
Riparian Orchards/Vineyards	Riparian Orchards/Vineyards	0	none						Habitat
Riparian Park/Lawn	Riparian Park/Lawn	0	none						Habitat
Riparian Pasture/Range	Riparian Pasture/Range/Hay field	0	none						Habitat
Riparian Pavement	Riparian Pavement/Cleared Lot	0	none						Habitat
Riparian Pipes	Riparian Piles (Inlet/Outlet)	0	none						Habitat
Riparian Powerline	Human disturbance measure for powerlines	0	none						Habitat
Riparian Road	Riparian Road/Railroad	0	none						Habitat
Riparian Row Crops	Riparian Row Crops	0	none						Habitat
Riparian Sub Condition/Vert Connectivity Metric	Metric assesses riparian substratum condition influencing natural infiltration capacity and vertical connectivity affecting alluvial permeability, subsurface flows and groundwater connectivity.	0	score						Habitat
Riparian Trail	Human disturbance measure for trails	0	none						Habitat
Riparian Understory NonWoody Plants	EMAP BA specific - Riparian Understory Non-woody Herbs, Grasses & Forbes	0	none						Habitat
Riparian Understory Veg Type	Riparian Understory Vegetation Type	0	none						Habitat
Riparian Understory Woody Shrubs	EMAP BA Specific - Riparian Understory Woody Shrubs & Saplings	0	none						Habitat
Riparian Upper Canopy All Trees	Riparian Upper Canopy All Trees (merge of Riparian Canopy Big Trees and Small Trees in EMAP BA)	0	none						Habitat
Riparian Upper Canopy Deciduous	Riparian Upper Canopy Deciduous	0	none						Habitat
Riparian Upper Canopy Evergreen	Riparian Upper Canopy Evergreen	0	none						Habitat
Riparian Vegetation Management	Riparian Vegetation Management	0	none						Habitat
Riparian Vegetation Width Metric	Metric assesses the average width of the defined riparian zone along the assessment area.	0	score						Habitat
Riparian Wall/Dike	Riparian Wall/Dike/Revetment/Riprap/Dam	0	none						Habitat
Riparian Woody Veg	Riparian Woody Veg	0	%						Habitat
RipRAM Index	Riparian Rapid Assessment Method (RAM) for California index score based on the average score of eight component metrics.	0	score						Habitat
RipRap/Armored Channel bed/bank Extent	RipRap/Armored Channel bed/bank Extent	0	none						Habitat
RipRap/Armored Channel bed/bank Intensity	RipRap/Armored Channel bed/bank Intensity	0	none						Habitat
RipRap/Armored Channel bed/bank Proximity	RipRap/Armored Channel bed/bank Proximity	0	none						Habitat
RisingGroundwater	Rising groundwater (i.e., a spring) that is the source of water in a receiving water and may contribute (or even define) the receiving water quality	0	none						Habitat
Roads	Roads	0	none						Habitat
Rope, Polypropylene	Rope, Polypropylene	0	pieces						Debris	Trash	Plastics	Miscellaneous
Rope/Tie	Rope/Tie	0	pieces						Debris	Trash	Plastics	Miscellaneous
Roxithromycin	Roxithromycin	80214831		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Rubber Materials (Non-Specific)	Rubber Materials (Non-Specific)	0	pieces						Debris	Trash	Non-Plastics	Construction
Rubber Piece	Rubber Piece	0	pieces						Debris	Trash	Plastics	Miscellaneous
Ruminant_Rum2Bac	Ruminant_Rum2Bac	0		copies/100 mL					Microbiological	Pathogens	Conventionals
Run	Run	0	%						Habitat
Rural Residential Extent	Rural Residential Extent	0	none						Habitat
Rural Residential Intensity	Rural Residential Intensity	0	none						Habitat
Rural Residential Proximity	Rural Residential Proximity	0	none						Habitat
Sachets, Beverage	Beverage, Sachets/packets, e.g., Caprisuns	0	pieces						Debris	Trash	Non-Plastic
Safrotin	Safrotin	77491306		ug/L					Organics	Pesticides	Insecticides
Salicylic Acid	Salicylic Acid	69727		ng/L
Salicylic Acid-d4(IsoDilAnalogue)	Isotope Dilution Analogue: Salicylic Acid-d4	78646170		% recovery					Organics
Salinity	Salinity	0		psu	ppt				WaterQualityMeasurements	Conventionals	Inorganics
Salinity, Daily Mean	Daily Mean Salinity (Calculated)	0		psu					WaterQualityMeasurements	Conventionals	Inorganics
Salmonella	Salmonella	0		none					Microbiological	Pathogens	Conventionals
Salmonella-invA	Salmonella-invA	0		copies/100 mL					Microbiological	Pathogens	Conventionals
Salmonella-ttr	Salmonella-ttr	0		copies/100 mL					Microbiological	Pathogens	Conventionals
Sand	Sand	0		mg/L	% ww				Inorganics	Conventionals	GrainSize
Sarafloxacin	Sarafloxacin	98105998		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Saxitoxins	Saxitoxins	0		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Scandium	Scandium	7440202		ug/L					Inorganics
Seagrass	Seagrass	0	pieces						Debris	Natural	Non-Plastics	Marine Origin
Sealed Shell Volume	Sealed Shell Volume (weight (in grams) of water displaced by each bivalve)	0					mL	mL	Organics	Inorganics	Metals	Conventionals	Semi-VOAs	VOAs
SeaState	SeaState	0	none						FieldObservations	Habitat
Secbumeton	Secbumeton	26259450		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Secchi Depth	Measurement of clarity based on the depth at which the Secchi disk can be differentiated	0		m					WaterQualityMeasurements
Sedaxane	Sedaxane	874967676		ng/L					Organics	Pesticides	Fungicides
Sediment Disturbance Other Extent	Sediment Disturbance Other Extent	0	none						Habitat
Sediment Disturbance Other Intensity	Sediment Disturbance Other Intensity	0	none						Habitat
Sediment Disturbance Other Proximity	Sediment Disturbance Other Proximity	0	none						Habitat
Selenate as Se	Selenate as Se (Se VI)	0		ug/L	mg/Kg dw				Inorganics	Conventionals
Selenite as Se	Selenite as Se (Se IV)	0		ug/L	mg/Kg dw				Inorganics	Conventionals
Selenium	Selenium	7782492		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Selenomethionine	Selenomethionine	1464422		ug/L					Organics	AminoAcid
Sertraline	Sertraline	79617962		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Sethoxydim	Sethoxydim	0		ug/L					Organics	Pesticides	Herbicides
Settleable Solids	Settleable Solids	0		mL/L/hr					Inorganics	Conventionals
Sewage Treatment	Sewage Treatment	0	none						Habitat
Shade	Amount of shade within the algae sampling area (1 m2)	0	%						Habitat
Shoe	Shoe	0	pieces						Debris	Trash	Non-Plastics	Household
Shopping Cart	Shopping Cart	0	pieces						Debris	Trash	Non-Plastics	Large
Side Channel	Side Channel present	0	none						Habitat
Siduron	Siduron	1982496		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Silica as SiO2	Silica as SiO2	14808607		ug/L					Inorganics	Conventionals	Habitat
Silicate as Si	Silicate as Si (Si(OH)4)	0		umol/L					Inorganics	Conventionals
Silicon	Silicon	7440213		mg/L			ug/g ww	ug/g dw	Inorganics	Metals
Silt	Silt	0		mg/L	% ww				Inorganics	Conventionals	GrainSize
Silt + Clay	Silt + Clay	0			%				Inorganics
Silver	Silver	7440224		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Simazine	Simazine	122349		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Triazines	Herbicides	Algaecides	Endocrine Disruptors
Simazine(Surrogate)	Surrogate: Simazine	122349		% recovery					Organics	Pesticides	Pest-Triazines
Simazine-D10(Surrogate)	Surrogate: Simazine-D10	0		% recovery					Organics	Pesticides	Pest-Triazines	220621-39-6
Simetryn	Simetryn	1014706		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Simvastatin	Simvastatin	79902639		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Sinuosity	Ratio of the curvilinear length along a stream and the Euclidean (straight line) distance between two points along the stream	0	none						Habitat
Site Length	Site Length	0	m						Habitat	Debris
Site Width	Site Width	0	m						Habitat	Debris
Sitosterol, beta-	beta-Sitosterol	83465			ug/Kg dw				Organics
SkyCode	SkyCode	0	none						FieldObservations	Habitat
Slope	Slope	0	%						Habitat
SOD	Sediment Oxygen Demand (SOD)	0			mg/Kg dw				Inorganics	Conventionals
Sodium	Sodium	7440235		ug/L	mg/Kg dw		ug/g ww	ug/g dw	Inorganics	Conventionals	Metals
Soft Plastic Piece, non-specific	Soft Plastic Piece, non-specific	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Soft Sediment	Soft Sediment; indicates presence/absence of soft/small sediment at the point where depth is measured	0	none						Habitat
Somatic Coliphage (E. coli CN-13)	Somatic Coliphage Plaques, Host Bacterium Strain: E. coli CN-13	0		PFU/L
Soot	Soot/Black Carbon	0			%
SpecificConductivity	Specific Conductivity	0		uS/cm					WaterQualityMeasurements	Conventionals	Inorganics
Sports Ball	Sports Ball	0	pieces						Debris	Trash	Plastics	Household
Spray Paint Can	Spray Paint Can	0	pieces						Debris	Trash	Non-Plastics	Toxic
Spring Boxes Extent	Spring Boxes Extent	0	none						Habitat
Spring Boxes Intensity	Spring Boxes Intensity	0	none						Habitat
Spring Boxes Proximity	Spring Boxes Proximity	0	none						Habitat
SQO_CSI	Sediment Quality Objectives (SQO) Chemical Score Index (CSI)	0			score				Sediment Quality Objectives	Index/Metric
SQO_LOE_Cat_Chemistry	Sediment Quality Objectives Line of Evidence (SQO LOE) Chemistry Category Score. The score represents the concentration of chemicals in sediments and potential risks the benthic organisms have from the pollutants in sediment at a station in a bay/estuary.	0			score				Sediment Quality Objectives	Index/Metric
SQO_LOE_Cat_Toxicity	Sediment Quality Objectives Line of Evidence (SQO LOE) Toxicity Category Score. The score represents the response of invertebrates to bay/estuary sediment samples collected at a station but exposed in a controlled laboratory.	0			score				Sediment Quality Objectives	Index/Metric
SQO_SA_Cat	Sediment Quality Objectives (SQO) Station Assessment Category. Overall SQO score for the station. The score represents the impact of pollutants in sediment to the aquatic life living in the sediment in bays/estuaries.	0	none						Sediment Quality Objectives	Index/Metric
StationWaterDepth	Depth of waterbody where sample was collected	0	m	m	m				Habitat
StationWaterDepth_Avg	Estimated average depth of the waterbody at the time of sampling	0	cm						Habitat
StationWaterDepth_Max	Estimated maximum depth of the waterbody at the time of sampling	0	cm						Habitat
Stick/Branch/Driftwood	Stick/Branch/Driftwood	0	pieces						Debris	Natural	Non-Plastics	Marine Origin
Stigmastanol, beta	beta-Stigmastanol	19466478			ug/Kg dw				Organics
Strapping bands, Plastic	Plastic bands used to strap things in place or together	0	pieces						Debris	Trash	Plastics
Straw	Straw	0	pieces						Debris	Trash	Plastics	FoodService
Stream Confinement	Confinement based upon the valley width in relation to average bankfull width which the riverine system can migrate without encountering a hillside, terrace or other feature	0	none						Habitat
StreamBankCharacteristics_Concrete	StreamBankCharacteristics_Concrete	0	none						Habitat	Debris
StreamBankCharacteristics_Earthen	StreamBankCharacteristics_Earthen	0	none						Habitat	Debris
StreamBankCharacteristics_RipRap	StreamBankCharacteristics_RipRap	0	none						Habitat	Debris
StreamBankCharacteristics_Sloped	StreamBankCharacteristics_Sloped	0	none						Habitat	Debris
StreamBankCharacteristics_Vegetated	StreamBankCharacteristics_Vegetated	0	none						Habitat	Debris
StreamBankCharacteristics_Vertical	StreamBankCharacteristics_Vertical	0	none						Habitat	Debris
StreamBedCharacteristics_Concrete	StreamBedCharacteristics_Concrete	0	none						Habitat	Debris
StreamBedCharacteristics_Earthen	StreamBedCharacteristics_Earthen	0	none						Habitat	Debris
StreamBedCharacteristics_Rock	StreamBedCharacteristics_Rock	0	none						Habitat	Debris
StreamBedCharacteristics_SubPlants	StreamBedCharacteristics_SubPlants	0	none						Habitat	Debris
StreamMixing	Classification of stream mixing by stratification, well-mixed or poorly mixed	0	none						FieldObservations	Habitat
StreamWidth	StreamWidth	0	m						FieldObservations	Habitat
Streptococcus, Fecal	Fecal Streptococcus	0		MPN/100 mL					Microbiological	Pathogens	Conventional
Strontium	Strontium	7440246		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals
Strontium-87/Strontium-86 Ratio	Strontium-87/Strontium-86 Ratio	0		per mil					Isotopes
Strontium-90	Strontium-90	0		pCi/L
Styrene	Styrene	100425		ug/L			ug/Kg ww	ug/Kg dw	Organics	VOCs
Styrofoam Pellet	Styrofoam Pellet	0	pieces						Debris	Trash	Plastics	Bags/Packaging
SubreachesFished	Subreaches fished within a given waterbody	0	none						Habitat
Substrate Modifier	Substrate Modifier	0	none						Habitat
Substrate Size Class	Substrate Size Class	0	none						Habitat
Suburban Residential Extent	Suburban Residential Extent	0	none						Habitat
Suburban Residential Intensity	Suburban Residential Intensity	0	none						Habitat
Suburban Residential Proximity	Suburban Residential Proximity	0	none						Habitat
Sucralose	Sucralose	56038132		ug/L
Sulfachloropyridazine	Sulfachloropyridazine	80320		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Sulfadiazine	Sulfadiazine	68359		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Sulfadimethoxine	Sulfadimethoxine	122112		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Sulfallate	Sulfallate (CDEC)	95067		ug/L					Organics	Pesticides	Herbicides
Sulfamerazine	Sulfamerazine	127797		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Sulfamethazine	Sulfamethazine	57681		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Sulfamethazine-13C6(Surrogate)	Surrogate: Sulfamethazine-13C6	77643915		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Sulfamethizole	Sulfamethizole	144821		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Sulfamethoxazole	Sulfamethoxazole	723466		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Sulfamethoxazole-13C6(Surrogate)	Surrogate: Sulfamethoxazole-13C6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Sulfanilamide	Sulfanilamide	63741		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Sulfate	Sulfate	14808798		ug/L	mg/Kg nr				Inorganics	Conventionals	Nutrients
Sulfathiazole	Sulfathiazole	72140		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Sulfide, Dissolved	Dissolved Sulfide	0		mg/L	mg/Kg dw
Sulfide, Total	Total Sulfide	0		ug/L	umol/g				WaterQualityMeasurements
Sulfite as SO3	Sulfite as SO3	0		mg/L					Inorganics
Sulfometuron Methyl	Sulfometuron Methyl	7422972		ug/L					Organics	Herbicides
Sulfotep	Sulfotepp	3689245		ug/L	ng/g dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Sulfur	Sulfur	7704349					ug	ug	Inorganics
Sum of 208 PCBs (SFEI)	Sum of 208 PCBs (SFEI)	0					ng/g ww	ng/g dw	Organics	PCBs
Sum of 209 PCBs (SFEI)	Sum of 209 PCBs (SFEI)	0					ng/g ww	ng/g dw	Organics	PCBs
Sum of 40 PCBs (SFEI)	Sum of 40 PCBs (SFEI)	0					ng/g ww	ng/g dw	Organics	PCBs
Sum of DDTs (RWQCB3)	Sum of DDTs (RWQCB3)	0			ug/Kg dw				Organics
Sum of HPAHs (Integral)	Sum of HPAHs (Integral)	0			ug/Kg dw
Sum of LPAHs (Integral)	Sum of LPAHs (Integral)	0			ug/Kg dw
Surface Films	Surface Films	0	none						Habitat
SurfaceAreaOfMax	Estimate of the current surface area size as a fraction of the total surface area the waterbody would have at high water stage	0	%						Habitat
SurfacewaterConnect	Discharge from an outfall that does or does not flow to and have hydrologic continuity with a surface receiving water and has or does not have the potential to contribute to the quality of the surface receiving water quality	0	none						Habitat
Survival	Survival (%)	0				%	%	%	Toxicity
Suspended Sediment Concentration	Suspended Sediment Concentration (SSC)	0		mL/L					Inorganics	Conventionals
Suspended Sediment Discharge	Suspended Sediment Discharge	0		tons/day					Inorganics
Swim Normally	Swim Normally (Num/Rep)	0				Num/Rep			Toxicity
Syringe/Pipette	Syringe/Pipette	0	pieces						Debris	Trash	Plastics	Toxic
Tampon/Applicator	Tampon/Applicator	0	pieces						Debris	Trash	Plastics
Tape	Tape	0	pieces						Debris	Trash	Plastics	Household
Tarp	Tarp	0	pieces						Debris	Trash	Plastics	Household
TCDD, 2,3,7,8-	2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)	1746016		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
TCDD, 2,3,7,8- (TEQ ND=0)	2,3,7,8-TCDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
TCDD, 2,3,7,8- (TEQ ND=1/2 DL)	2,3,7,8-TCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
TCDD, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)	1746016		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
TCDD-13C, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-13C (TCDD)	0		pg/L	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
TCDD-13C12, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-13C12 (TCDD-13C12)	76523405		% recovery	% recovery				Organics	Dioxins/Dibenzofurans	IDA
TCDD-13C6, 1,2,3,4-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4-TCDD-13C6	116865588		% recovery					Organics	Dioxins/Dibenzofurans	IDA
TCDD-13C6, 1,2,3,4-(Surrogate)	Surrogate: 1,2,3,4-Tetrachlorodibenzo-p-dioxin-13C6 (TCDD)	0		% recovery			% recovery	% recovery	Organics	DioxinsDibenzofurans
TCDD-37Cl, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-37Cl (TCDD)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
TCDD-37Cl14, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-37Cl14 (TCDD-37Cl14)	85508505		% recovery	% recovery				Organics	Dioxins/Dibenzofurans	IDA
TCDD-37Cl4, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-37Cl4 (TCDD-37Cl4)	85508505		% recovery	% recovery				Organics	Dioxins/Dibenzofurans	IDA
TCDF, 2,3,7,8-	2,3,7,8-Tetrachlorodibenzofuran (TCDF)	51207319		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
TCDF, 2,3,7,8- (TEQ ND=0)	2,3,7,8-TCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
TCDF, 2,3,7,8- (TEQ ND=1/2 DL)	2,3,7,8-TCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
TCDF, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzofuran (TCDF)	51207319		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans
TCDF-13C, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzofuran-13C (TCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans
TCDF-13C12, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzofuran-13C12 (TCDF-13C12)	89059461		% recovery					Organics	Dioxins/Dibenzofurans	IDA
TCDF-2C, 2,3,7,8-	2,3,7,8-TCDF-2C	0		pg/L					Organics
Tebuconazole	Tebuconazole (Folicur)	107534963		ug/L	ug/Kg dw				Organics	Fungicides
Tebufenozide	Tebufenozide	112410238		ug/L					Organics	Pesticides	Insecticides
Tebupirimfos	Tebupirimfos	96182535		ng/L	ug/Kg dw				Organics	Pesticides	Insecticides
Tebupirimfos oxon	Tebupirimfos oxon	1035330369		ng/L	ug/Kg dw				Organics	Pesticides
Tebuthiuron	Tebuthiuron	34014181		ug/L					Organics	Pesticides	Pest-OPs
Tebuthiuron(Surrogate)	Surrogate: Tebuthiuron	0		% recovery	% recovery				Organics	Pesticides	Herbicides	Herbicides
Tecnazene	Tecnazene	117180		pg/L			ng/g ww	ng/g dw	Organics	Pesticides	Fungicides
Tedion	Tedion (Tetradifon)	116290		ug/L	ng/g dw		NR ww	NR dw	Organics	Pesticides	Pest-OCHs
Tefluthrin	Tefluthrin	79538322		ug/L	ug/Kg ww				Pyrethroid Pesticides
Television	Television	0	pieces						Debris	Trash	Non-Plastics	Large
Temephos	Temephos	3383968		ug/L					Organics	PPCPs
Temperature	Temperature	0		Deg C	Deg C				WaterQualityMeasurements	Conventionals
Temperature, Daily Mean	Daily Mean Temperature (Calculated)	0		Deg C					WaterQualityMeasurements	Conventionals
Terbacil	Terbacil	5902512		ug/L					Organics	Herbicides
Terbium	Terbium	7440279		% recovery					Inorganics	Metals
Terbium(Surrogate)	Surrogate: Terbium	7440279		% recovery					Inorganics	Metals
Terbufos	Terbufos	13071799		ug/L	mg/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides	Nematocides
Terbufos Sulfone	Terbufos Sulfone	0					ug/Kg ww	ug/Kg dw	Organics	Pesticides
Terbuthylazine	Terbuthylazine	5915413		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Terbutryn	Terbutryn	886500		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Terphenyl-d14	Terphenyl-d14	0		ug/L
Terphenyl-d14(Surrogate)	Surrogate: Terphenyl-d14	1718510		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs
Terpineol, alpha-	alpha-Terpineol	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	PPCPs
Tert-amyl Methyl Ether	Tert-amyl Methyl Ether	994058		ug/L					Organics	VOCs
Tert-butyl Alcohol	Tert-butyl Alcohol	75650		ug/L					Organics	VOCs
Testosterone	Testosterone	58220		ng/L
Testosterone-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Testosterone-d3	77546395		% recovery					Organics
Testosterone-d3(Surrogate)	Surrogate: Testosterone-d3	77546395		% recovery
Tetrabromobisphenyl A	Tetrabromobisphenyl A	0					ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
Tetrabromo-o-chlorotoluene	Tetrabromo-o-chlorotoluene (TBCT)	39569216			ng/g dw				Organics	FlameRetardants
Tetrabromo-p-xylene	Tetrabromo-p-xylene (pTBX)	23488382			ng/g dw				Organics	FlameRetardants
Tetrabutyltin as Sn	Tetrabutyltin as Sn	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Organotins
Tetrachlorobenzene, 1,2,3,4-	1,2,3,4-Tetrachlorobenzene	634662			ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs
Tetrachlorobenzene, 1,2,3,4-(Surrogate)	Surrogate: 1,2,3,4-Tetrachlorobenzene	0		% recovery	% recovery		% recovery	% recovery	Organics	SVOCs
Tetrachlorobenzene, 1,2,3,5/1,2,4,5-	1,2,3,5-Tetrachlorobenzene/1,2,4,5-Tetrachlorobenzene	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs
Tetrachlorobenzene, 1,2,4,5-	1,2,4,5-Tetrachlorobenzene	95943					ug/Kg ww	ug/Kg dw	Organics	SVOCs
Tetrachlorobenzene-13C6,1,2,3,4-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4-Tetrachlorobenzene-13C6	2483735528			% recovery		% recovery	% recovery
Tetrachloroethane, 1,1,1,2-	1,1,1,2-Tetrachloroethane	630206		ug/L					Organics	VOCs
Tetrachloroethane, 1,1,2,2-	1,1,2,2-Tetrachloroethane	76345		ug/L					Organics	VOCs
Tetrachloroethylene	Tetrachloroethylene, Tetrachloroethene	127184		ug/L					Organics	VOCs	Insecticides
Tetrachloro-m-xylene	Tetrachlorometaxylene (TCMX)	877098		ug/L	ug/Kg dw				Organics	Pesticides
Tetrachloro-m-xylene(Surrogate)	Surrogate: Tetrachloro-m-xylene (TCMX)	877098		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs
Tetrachlorophenol	Tetrachlorophenol	0					ug/Kg ww	ug/Kg dw	Organics	SVOCs
Tetrachlorophenol, 2,3,4,5-	2,3,4,5-Tetrachlorophenol	4901513		ug/L					Organics	SVOCs	Phenols	Chlorinated Phenols
Tetrachlorophenol, 2,3,4,6-	2,3,4,6-Tetrachlorophenol	58902		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	Chlorinated Phenols
Tetrachlorophenol, 2,3,5,6-	2,3,5,6-Tetrachlorophenol	935955		ug/L					Organics	SVOCs	Phenols	Chlorinated Phenols
Tetrachlorophenyl-hexachloro-norbornene	Tetrachlorophenyl-hexachloro-norbornene (Cl4-DEC604)	34571158			ng/g dw				Organics	FlameRetardants
Tetrachloroterephthalic acid	Tetrachloroterephthalic acid	2136790		ug/L
Tetrachlorvinphos	Tetrachlorvinphos (Stirofos)	22248799		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Tetraconazole	Tetraconazole (1-[2-(2,4-Dichlorophenyl)-3-(1,1,2,2-tetrafluoroethoxy)propyl]- 1H-1,2,4-triazole)	112281773		ug/L	ug/Kg dw				Organics	Fungicides
Tetracosane, n-	n-Tetracosane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes
Tetracosane, n-(Surrogate)	Surrogate: n-Tetracosane	0		% recovery					Organics	SVOCs
Tetracycline	Tetracycline	60548		ug/L					Organics	PPCPs
Tetradecane, 2-phenyl-	2-Phenyl-tetradecane	0			ng/g dw				Organics	SVOCs
Tetradecane, 3-phenyl-	3-Phenyl-tetradecane	0			ng/g dw				Organics	SVOCs
Tetradecane, 4-phenyl-	4-Phenyl-tetradecane	0			ng/g dw				Organics	SVOCs
Tetradecane, 5-phenyl-	5-Phenyl-tetradecane	0			ng/g dw				Organics	SVOCs
Tetradecane, 6-phenyl-	6-Phenyl-tetradecane	0			ng/g dw				Organics	SVOCs
Tetradecane, 7-phenyl-	7-Phenyl-tetradecane	0			ng/g dw				Organics	SVOCs
Tetradecane, n-	n-Tetradecane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes
Tetradifon	Tetradifon	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides
Tetraethyl Pyrophosphate	Tetraethyl Pyrophosphate (TEPP)	107493		ug/L	mg/Kg dw				Organics	Pesticides	OrganophosphatePest.
Tetraethyl pyrophosphate, TEPP	Tetraethyl pyrophosphate, TEPP	107493		ug/L	mg/Kg ww
Tetramethrin	Tetramethrin	7696120		ug/L	ug/Kg ww				Organics	Pesticides	Insecticides	Pyrethroids
Tetramethylnaphthalene, 1,4,6,7-	1,4,6,7-Tetramethylnaphthalene	13764186		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Semi-VOAs
Tetratriacontane, n-	n-Tetratriacontane	14167590					ng/g ww	ng/g dw	Organics	Alkanes
Tetryl	Tetryl	479458		ug/L	ug/Kg dw				Organics
T-Fluvalinate	T-Fluvalinate	102851069		ug/L	ug/Kg ww				Organics	Pesticides	Insecticides	Pyrethroids
Thallium	Thallium	7440280		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals
Theophylline	Theophylline	58559		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Theophylline-13C1-15N2(Surrogate)	Surrogate: Theophylline-13C1-15N2	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Thiabendazole	Thiabendazole	148798		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Thiabendazole-d6(Surrogate)	Surrogate: Thiabendazole-d6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Thiacloprid	Thiacloprid	111988499		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Thiamethoxam	Thiamethoxam	153719234		ug/L	ng/g dw				Pesticides	Insecticides
Thiamethoxam-d3(Surrogate)	Surrogate: Thiamethoxam-d3	1294048820		% recovery	% recovery
Thiazopyr	Thiazopyr	117718602		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides
Thiobencarb	Thiobencarb (Benthiocarb) (Bolero)	28249776		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OPs
Thiobencarb(Surrogate)	Surrogate: Thiobencarb (Benthiocarb) (Bolero)	28249776		% recovery					Organics	Herbicides
Thionazin	Thionazin (Thionzin)	297972		ug/L	ng/g dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs
Thiram	Thiram	0		ug/L					Organics	Pesticides	Fungicides
Thorium	Thorium	7440291					ug/g ww	ug/g dw	Inorganics	Metals
Tidal Height	Tidal Height	0	none						Habitat	NULL
Tidal State	Tidal State	0	none						FieldObservations	Habitat
TidalDirection	TidalDirection	0	none						Habitat
Timber Harvest Extent	Timber Harvest Extent	0	none						Habitat
Timber Harvest Intensity	Timber Harvest Intensity	0	none						Habitat
Timber Harvest Proximity	Timber Harvest Proximity	0	none						Habitat
Time, Fishing	Time spent fishing within a given waterbody	0	mins						Habitat
Time, Shock	Time spent electroshocking within a given waterbody	0	seconds						Habitat
TimeToSpinTest	Time the velocity meter spins during QA/QC calibration checks	0							WaterQualityMeasurements
Tin	Tin	7440315		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals
Tire	Tire	0	pieces						Debris	Trash	Non-Plastics	Construction
Titanium	Titanium	7440326		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals
Tokuthion	Tokuthion (Prothiofos)	34643464		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Tolfenpyrad	Tolfenpyrad	129558765		ng/L					Organics	Pesticides	Insecticides
Toluene	Toluene	108883		ug/L					Organics	VOCs	MTBE_BTEX
Toluene-d8(Surrogate)	Surrogate: Toluene-d8	2037265		ug/L					Organics	VOCs	MTBE_BTEX
Tonalide	Tonalide	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	Musk
Toothbrush	Toothbrush	0	pieces						Debris	Trash	Plastics	Household
Torrent 01	Torrent 01 - Recently devegetated corridor two or more times the width of the low flow channel	0	none						Habitat
Torrent 02	Torrent 02 - Substrate cobbles or large gravel particles are not imbricated	0	none						Habitat
Torrent 03	Torrent 03 - Channel has little evidence of pool-riffle structure	0	none						Habitat
Torrent 04	Torrent 04 - Stream channel is scoured down to bedrock	0	none						Habitat
Torrent 05	Torrent 05 - Gravel and cobble berms above bankfull level	0	none						Habitat
Torrent 06	Torrent 06 - Massive deposits downstream of reach	0	none						Habitat
Torrent 07	Torrent 07 - Riparian trees have fresh bark scars	0	none						Habitat
Torrent 08	Torrent 08 - Riparian trees have fallen into channel as a result of scouring near their roots	0	none						Habitat
Torrent 09	Torrent 09 - Massive deposits of sediment, logs and debris within reach	0	none						Habitat
Torrent 10	Torrent 10 - Newly erroded deposites show evidence that the deposites are matrix supported	0	none						Habitat
Torrent 11	Torrent 11 - No evidence of torrent scouring or torrent deposits	0	none						Habitat
Total Alkanes	Total Alkanes	0					ng/g ww	ng/g dw	Organics	PAHs
Total Anions	Total Anions	0		mg/L					Inorganics
Total Cations	Total Cations	0		mg/L					Inorganics
Total Cell Count	Total Cell Count	0				cells/ml			Toxicity
Total Chlordanes	Total Chlordanes	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides
Total DDDs	Total DDDs	0			ug/Kg dw				Organics	Pesticides
Total DDEs	Total DDEs	0			ug/Kg dw				Organics	Pesticides
Total DDTs	Total DDTs	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides
Total DDTs - Lipid Basis	Total DDTs - Lipid Basis	0					ug/Kg lw	ug/Kg lw	Organics	Pesticides
Total Debris, >2.5 cm	Total Debris >2.5 cm	0	L						Debris	Debris	Trash	Plastics
Total Debris, 2.5 cm - 5 mm	Total Debris 2.5 cm - 5 mm	0	L						Debris	Debris	Trash	Plastics
Total Dichlorobiphenyls	Total Dichlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Dioxins-Furans (TEQ ND=0)	Total Dioxins-Furans (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans
Total Dioxins-Furans (TEQ ND=1/2 DL)	Total Dioxins-Furans (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans
Total Di-PCB	Total Di-PCB	0		pg/L					Organics	PCBs
Total Dissolved Solids	Total Dissolved Solids	0		ug/L					Inorganics	Conventionals
Total Endosulfans	Total Endosulfans	0					ug/Kg ww	ug/Kg dw	Organics	Pesticides
Total Endosulfans - Lipid Basis	Total Endosulfans - Lipid Basis	0					ug/Kg lw	ug/Kg lw	Organics	Pesticides
Total HCHs	Total HCHs	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides
Total Heptachlorobiphenyls	Total Heptachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Hepta-Dioxins	Total Hepta-Dioxins	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans
Total Hepta-Furans	Total Hepta-Furans	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans
Total Hepta-PCB	Total Hepta-PCB	0		pg/L					Organics	PCBs
Total Hexachlorobiphenyls	Total Hexachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Hexa-Dioxins	Total Hexa-Dioxins	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans
Total Hexa-Furans	Total Hexa-Furans	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans
Total Hexa-PCB	Total Hexa-PCB	0		pg/L					Organics	PCBs
Total Hydrogen	Total Hydrogen	0			% dw				Inorganics	Conventionals
Total Inorganic Carbon	Total Inorganic Carbon (TIC)	0			%				Inorganics	Conventionals
Total MirexHCBChlorpy (SFEI)	Total MirexHCBChlorpy (SFEI)	0			ug/Kg dw				Organics	Pesticides
Total Monochlorobiphenyls	Total Monochlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Mono-PCB	Total Mono-PCB	0		pg/L					Organics	PCBs
Total Nonachlorobiphenyls	Total Nonachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Nona-PCB	Total Nona-PCB	0		pg/L					Organics	PCBs
Total Normal	Total Normal	0			mg/Kg dw				Toxicity
Total Octachlorobiphenyls	Total Octachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Octa-PCB	Total Octa-PCB	0		pg/L					Organics	PCBs
Total Organic Carbon	Total Organic Carbon (TOC)	0		ug/L	ug/g dw				Inorganics	Conventionals
Total Organic Matter	Includes all the elements (hydrogen, oxygen, nitrogen, etc) that are components of organic compounds, not just carbon.	0			% dw
Total PAHs	Total PAHs	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Total PAHs - Lipid Basis	Total PAHs - Lipid Basis	0					ug/Kg lw	ug/Kg lw	Organics	PAHs
Total PBDEs	Total PBDEs	0					pg/g ww	pg/g dw	Organics	FlameRetardants
Total PCBs	Total PCBs	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total PCBs (Aroclors)	Total PCBs (Aroclors)	0					ug/Kg ww	ug/Kg dw	Organics	PCBs
Total PCBs (Aroclors) - Lipid Basis	Total PCBs (Aroclors) - Lipid Basis	0					ug/Kg lw	ug/Kg lw	Organics	PCBs
Total Pentachlorobiphenyls	Total Pentachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Penta-Dioxins	Total Penta-Dioxins	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans
Total Penta-Furans	Total Penta-Furans	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans
Total Penta-PBDE	Total Penta-PBDE	0					ng/g lw	ng/g lw	Organics	FlameRetardants
Total Penta-PCB	Total Penta-PCB	0		pg/L					Organics	PCBs
Total Pyrethrins	Total Pyrethrins	0		ug/L					Organics	Pesticides
Total Solids	Total Solids	0		mg/L	RPD		RPD	RPD	Inorganics	Conventionals
Total Suspended Solids	Total Suspended Solids	0		ug/L	ug/L				Inorganics	Conventionals
Total TEQ (WHO 2005; ND=0)	Total TEQ (WHO 2005; ND=0)	0		pg/L			ng/g ww	ng/g dw	Organics	DioxinsDibenzofurans
Total TEQ (WHO 2005; ND=1/2DL)	Total TEQ (WHO 2005; ND=1/2DL)	0		pg/L			ng/g ww	ng/g dw	Organics	DioxinsDibenzofurans
Total Terphenyls	Total Terphenyls	0					ng/g ww	ng/g dw	Organics	PCBs
Total Tetrachlorobiphenyls	Total Tetrachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Tetra-Dioxins	Total Tetra-Dioxins	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans
Total Tetra-Furans	Total Tetra-Furans	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans
Total Tetra-PBDE	Total Tetra-PBDE	0					ng/g lw	ng/g lw	Organics	FlameRetardants
Total Tetra-PCB	Total Tetra-PCB	0		pg/L					Organics	PCBs
Total Trichlorobiphenyls	Total Trichlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Tri-PBDE	Total Tri-PBDE	0					ng/g lw	ng/g lw	Organics	FlameRetardants
Total Tri-PCB	Total Tri-PCB	0		pg/L					Organics	PCBs
TotalPieces	Total Pieces of Trash using Trash Protocol	0	pieces						Trash
Tox_Amphipod	Sediment Quality Objectives Line of Evidence (SQO LOE) short-term amphipod survival toxicity test result. The result represents the response of amphipods to bay/estuary sediment samples collected at a station but exposed in a controlled laboratory.	0			score				Sediment Quality Objectives	Index/Metric
Tox_Mussel	Sediment Quality Objectives Line of Evidence (SQO LOE) sublethal mussel toxicity test result. The result represents the response of mussel embryos to bay/estuary sediment samples collected at a station but exposed in a controlled laboratory.	0			score				Sediment Quality Objectives	Index/Metric
Tox_Polychaete	Sediment Quality Objectives Line of Evidence (SQO LOE) polychaete growth in sediment toxicity test result. The result represents the response of worms exposed to bay/estuary sediment samples collected at a station under controlled laboratory conditions.	0			score				Sediment Quality Objectives	Index/Metric
Toxaphene	Toxaphene	8001352		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides
Toxic	Toxic using Trash Protocol	0	L						Trash
Toxic, Other	Toxic, Other	0	pieces						Debris	Trash	Plastics	Toxic
Toy	Toy	0	pieces						Debris	Trash	Plastics	Household
TPH as Diesel C10-C22	TPH as Diesel C10-C22	0		ug/L					Organics	SVOCs
TPH as Diesel C10-C23	TPH as Diesel C10-C23	0		ug/L
TPH as Diesel C10-C24	TPH as Diesel C10-C24	0		ug/L					Organics
TPH as Diesel C10-C25	TPH as Diesel C10-C25	0		mg/L					Organics	PAHs
TPH as Diesel C10-C28	TPH as Diesel C10-C28	0		ug/L	ug/Kg ww				Organics	SVOCs
TPH as Diesel C11-C12	TPH as Diesel C11-C12	0		ug/L					Organics	SVOCs
TPH as Diesel C12-C24	TPH as Diesel C12-C24	0		ug/L					Organics	SVOCs
TPH as Diesel C12-C25	TPH as Diesel C12-C25	0		ug/L	mg/Kg dw				Organics	PAHs
TPH as Diesel C13-C14	TPH as Diesel C13-C14	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Diesel C13-C22	TPH as Diesel C13-C22	0		ug/L	ug/Kg ww				Organics	SVOCs
TPH as Diesel C13-C28	TPH as Diesel C13-C28	0		ug/L					Organics	SVOCs
TPH as Diesel C15-C16	TPH as Diesel C15-C16	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Diesel C17-C18	TPH as Diesel C17-C18	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Diesel C19-C20	TPH as Diesel C19-C20	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Diesel C21-C22	TPH as Diesel C21-C22	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Diesel C23-C24	TPH as Diesel C23-C24	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Diesel C23-C40	TPH as Diesel C23-C40	0		ug/L					Organics	SVOCs
TPH as Diesel C25-C28	TPH as Diesel C25-C28	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Diesel C29-C40	TPH as Diesel C29-C40	0		ug/L
TPH as Diesel C8-C21	TPH as Diesel C8-C21	0		ug/L					Organics	SVOCs
TPH as Gasoline C11-C12	TPH as Gasoline C11-C12	0			mg/Kg dw
TPH as Gasoline C3-C13	TPH as Gasoline C3-C13	0		mg/L					Organics	SVOCs
TPH as Gasoline C4-C12	TPH as Gasoline C4-C12	0		ug/L	ug/Kg ww				Organics	SVOCs
TPH as Gasoline C4-C13	TPH as Gasoline C4-C13	0		ug/L
TPH as Gasoline C4-C5	TPH as Gasoline C4-C5	0			mg/Kg dw
TPH as Gasoline C5-C12	TPH as Gasoline C5-C12	0		mg/L					Organics	SVOCs
TPH as Gasoline C6	TPH as Gasoline C6	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Gasoline C6-C10	TPH as Gasoline C6-C10	0		ug/L					Organics	SVOCs
TPH as Gasoline C6-C12	TPH as Gasoline C6-C12	0		ug/L	ug/Kg ww				Organics	SVOCs
TPH as Gasoline C7	TPH as Gasoline C7	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Gasoline C8	TPH as Gasoline C8	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Gasoline C9-C10	TPH as Gasoline C9-C10	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Heavy Fuel Oils C22-C36	TPH as Heavy Fuel Oils C22-C36	0		mg/L					Organics	SVOCs
TPH as JP8 C7-C18	TPH as JP8 C7-C18 (Jet Fuel 8)	0		mg/L					Organics	PAHs
TPH as Motor Oil / Diesel C13-C44	TPH as Motor Oil / Diesel C13-C44	0			mg/Kg dw
TPH as Motor Oil C14-C44	TPH as Motor Oil C14-C44	0			mg/Kg dw				Organics	PAHs
TPH as Motor Oil C17-C44	TPH as Motor Oil C17-C44	0		ug/L
TPH as Motor Oil C18-C36	TPH as Motor Oil C18-C36	0		ug/L					Organics	SVOCs
TPH as Motor Oil C18-C40	TPH as Motor Oil C18-C40	0		ug/L					Organics
TPH as Motor Oil C21-C32	TPH as Motor Oil C21-C32	0		ug/L					Organics	SVOCs
TPH as Motor Oil C23-C36	TPH as Motor Oil C23-C36	0		ug/L					Organics
TPH as Motor Oil C23-C40	TPH as Motor Oil C23-C40	0			ug/Kg ww				Organics	SVOCs
TPH as Motor Oil C23-C44	TPH as Motor Oil C23-C44	0			mg/Kg dw
TPH as Motor Oil C24-C36	TPH as Motor Oil C24-C36	0		ug/L					Organics	SVOCs
TPH as Motor Oil C24-C40	TPH as Motor Oil C24-C40	0		ug/L					Organics
TPH as Motor Oil C25-C36	TPH as Motor Oil C25-C36	0		ug/L	mg/Kg dw				Organics	PAHs
TPH as Motor Oil C28-C44	TPH as Motor Oil C28-C44	0		mg/L
TPH as Motor Oil C29-C40	TPH as Motor Oil C29-C40	0		ug/L					Organics	SVOCs
TPH as Oil C29-C44	TPH as Oil C29-C44	0		mg/L					Organics	SVOCs
TPH as Residual C29-C32	TPH as Residual C29-C32	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Residual C33-C36	TPH as Residual C33-C36	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Residual C37-C40	TPH as Residual C37-C40	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Residual C41-C44	TPH as Residual C41-C44	0		ug/L	mg/Kg dw				Organics	SVOCs
TPH as Residual C6-C44	TPH as Residual C6-C44	0		ug/L
Tralomethrin	Tralomethrin	66841256		ug/L					Organics	Pesticides	Insecticides
TransectsSampled	Number of transects sampled to attain sample material	0	count						Habitat
Transfluthrin	Transfluthrin	0			ug/Kg ww				Organics	Pesticides	Pest-Pyrethroids
Transmittance	Transmittance	0		%					Inorganics	Conventionals	WaterQualityMeasurements
Transparency	Transparency	0		cm					FieldObservations
Transportation Other Extent	Transportation Other Extent	0	none						Habitat
Transportation Other Intensity	Transportation Other Intensity	0	none						Habitat
Transportation Other Proximity	Transportation Other Proximity	0	none						Habitat
Trash at >96" Drain	Trash at >96" Drain	0	none						Debris
Trash at 12" Drain	Trash at 12" Drain	0	none						Debris
Trash at 18" Drain	Trash at 18" Drain	0	none						Debris
Trash at 24" Drain	Trash at 24" Drain	0	none						Debris
Trash at 30" Drain	Trash at 30" Drain	0	none						Debris
Trash at 36" Drain	Trash at 36" Drain	0	none						Debris
Trash at 48" Drain	Trash at 48" Drain	0	none						Debris
Trash at 60" Drain	Trash at 60" Drain	0	none						Debris
Trash, Litter	Trash, Litter	0	none						Habitat
Trash/Dumping Extent	Trash/Dumping Extent	0	none						Habitat
Trash/Dumping Intensity	Trash/Dumping Intensity	0	none						Habitat
Trash/Dumping Proximity	Trash/Dumping Proximity	0	none						Habitat
Tree_Diameter	Diameter at breast height of the largest potential legacy tree visible from the location	0	m						Habitat
Tree_Distance	Distance from the wetted edge to the largest potential legacy tree visible from the location	0	m						Habitat
Tree_Height	Height of the largest potential legacy tree visible from the location	0	m						Habitat
Tree_TaxonomicCategoryCode	Taxonomic Category Code of the largest potential legacy tree visible from the location	0	none						Habitat
Trenbolone	Trenbolone	10161338		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Trenbolone Acetate	Trenbolone Acetate	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Triacontane, n-	n-Triacontane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes
Triacontane, n-(Surrogate)	Surrogate: n-Triacontane	0		% recovery					Organics	VOCs
Triadimefon	Triadimefon	43121433		ug/L	ug/Kg dw				Organics	Pesticides	Fungicides
Triadimenol	Triadimenol	55219653		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Triallate	Triallate	2303175		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides
Triamterene	Triamterene	396010		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Tribromobenzene, 1,3,5-	1,3,5-Tribromobenzene (TBBZ)	626391			ng/g dw				Organics	FlameRetardants
Tribromophenol, 2,4,6-	2,4,6-Tribromophenol	118796		ug/L					Organics	SVOCs
Tribromophenol, 2,4,6-(Surrogate)	Surrogate: 2,4,6-Tribromophenol	118796		ug/L					Organics	VOCs	Phenols	non-Chlorinated Phenols	Brominated Phenols
Tributyl Phosphorotrithioate, S,S,S-	S,S,S-Tributyl Phosphorotrithioate (Def) (Butifos) (Merphos)	78488		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OPs
Tributylphosphate	Tributylphosphate (TBP)	126738		ug/L	ug/Kg dw				Organics	FlameRetardants
Tributylphosphate(Surrogate)	Surrogate: Tributylphosphate (Butyl Phosphate)	126738		% recovery	% recovery				Organics	Pesticides	Pest-OPs
Tributyltin as Sn	Tributyltin as Sn (TBT)	688733		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Organotins	Biocide
Tributyltin as Sn-d27(Surrogate)	Surrogate: Tributyltin as Sn-d27	0		% recovery	% recovery				Organics	Organotins	Biocide
Trichlorfon	Trichlorfon	52686		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides
Trichloro-1,2,2-trifluoroethane, 1,1,2-	1,1,2-Trichloro-1,2,2-trifluoroethane	79131		ug/L					Organics	VOCs
Trichloro-2-pyridinyl)oxy)acetic Acid, ((3,5,6-	((3,5,6-Trichloro-2-pyridinyl)oxy)acetic Acid (Triclopyr)	55335063		ug/L					Organics	Herbicides
Trichloroacetic Acid	Trichloroacetic Acid (TCAA)	76039		ug/L					Organics	Haloacetic acids (HAAs)
Trichlorobenzene, 1,2,3-	1,2,3-Trichlorobenzene	87616		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs
Trichlorobenzene, 1,2,3-(Surrogate)	Surrogate: 1,2,3-Trichlorobenzene	0		% recovery	% recovery		% recovery	% recovery	Organics	SVOCs
Trichlorobenzene, 1,2,4-	1,2,4-Trichlorobenzene	120821		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Trichlorobenzene, 1,3,5-	1,3,5-Trichlorobenzene	108703			ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs
Trichlorobenzene-13C6, 1,2,3-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3-Trichlorobenzene-13C6	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Trichloroethane, 1,1,1-	1,1,1-Trichloroethane	71556		ug/L					Organics	VOCs
Trichloroethane, 1,1,2-	1,1,2-Trichloroethane	79005		ug/L					Organics	VOCs
Trichloroethylene	Trichloroethylene (Trichloroethene)	79016		ug/L					Organics	VOCs
Trichlorofluoromethane	Trichlorofluoromethane	75694		ug/L					Organics	VOCs
Trichloronate	Trichloronate	327980		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Trichlorophenol, 2,3,6-	2,3,6-Trichlorophenol	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	SVOCs
Trichlorophenol, 2,4,5-	2,4,5-Trichlorophenol	95954		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	Chlorinated Phenols
Trichlorophenol, 2,4,6-	2,4,6-Trichlorophenol	88062		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	Chlorinated Phenols
Trichlorophenoxy)propionic Acid, 2-(2,4,5-	2-(2,4,5-Trichlorophenoxy)propionic Acid (2,4,5-TP) (Silvex) (Fenoprop)	93721		ug/L	ug/kg				Organics	Herbicides
Trichlorophenoxyacetic Acid, 2,4,5-	2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T)	93765		ug/L	ug/kg				Organics	Herbicides
Trichlorophenoxyacetic Acid, 2,4,5-(Surrogate)	Surrogate: 2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T)	93765		% recovery	% recovery				Organics	Herbicides
Trichloropropane, 1,2,3-	1,2,3-Tricloropropane	96184		ug/L					Organics	VOCs
Triclocarban	Triclocarban	101202		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Triclocarban-13C6(Surrogate)	Surrogate: Triclocarban-13C6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Triclopyr	Triclopyr	55335063		ug/L					Organics	Pesticides
Triclosan	Triclosan	3380345		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Triclosan-13C12(Surrogate)	Surrogate: Triclosan-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Triclosan-13C6(Surrogate)	Surrogate: Triclosan-13C6	0		% recovery					Organics	PPCPs
Triclosan-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Triclosan-d3	1020719985		% recovery					Organics
Tricosane, n-	n-Tricosane	638675					ng/g ww	ng/g dw	Organics	Alkanes
Tricresyl Phosphate	Tricresyl Phosphate (TCrP)	1330785			ng/g dw				Organics	FlameRetardants
Tricyclazole	Tricyclazole (5-methyl-1,2,4-triazolo[3,4-b]benzothiazole)	0		ug/L
Tridecane, 2-phenyl-	2-Phenyl-tridecane	0			ng/g dw				Organics	VOCs
Tridecane, 3-phenyl-	3-Phenyl-tridecane	0			ng/g dw				Organics	VOCs
Tridecane, 4-phenyl-	4-Phenyl-tridecane	0			ng/g dw				Organics	VOCs
Tridecane, 5-phenyl-	5-Phenyl-tridecane	0			ng/g dw				Organics	VOCs
Tridecane, 6/7-phenyl-	6-Phenyltridecane/7-Phenyltridecane	0			ng/g dw				Organics	VOCs
Tridecane, n-	n-Tetratriacontane	629505					ng/g ww	ng/g dw	Organics	Alkanes
Tridimephon	Triadimefon	43121433		ug/L					Organics	Pesticides	Fungicides
Triethyl Phosphate	Triethyl Phosphate (TEP)	78400			ng/g dw				Organics	FlameRetardants
Trifloxystrobin	Trifloxystrobin	141517217		ug/L	ug/Kg dw				Organics	Fungicides
Triflumizole	Triflumizole	68694111		ug/L	ug/Kg dw				Organics	Fungicides
Trifluorotolunene, a,a,a-(Surrogate)	Surrogate: a,a,a-Trifluorotoluene	0		% recovery					Organics	VOCs
Trifluralin	Trifluralin	1582098		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Herbicides
Trifluralin-d14(Surrogate)	Surrogate: Trifluralin-d14	0		% recovery					Organics	Pesticides
Trihalomethanes, Total	Total Trihalomethanes	0		ug/L					Organics	VOCs
Triisobutyl Phosphate	Triisobutyl Phosphate (TIBP)	126716			ng/g dw				Organics	FlameRetardants
Trimethoprim	Trimethoprim	738705		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Trimethoprim-13C3(Surrogate)	Surrogate: Trimethoprim-13C3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Trimethylbenzene, 1,2,4-	1,2,4-Trimethylbenzene	95636		ug/L					Organics	VOCs	Herbicides
Trimethylbenzene, 1,3,5-	1,3,5-Trimethylbenzene	108678		ug/L					Organics	VOCs
Trimethylnaphthalene, 1,6,7-	1,6,7-Trimethylnaphthalene	0			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Trimethylnaphthalene, 2,3,5-	2,3,5-Trimethylnaphthalene	2245387		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Trimethylnaphthalene, 2,3,6-	2,3,6-Trimethylnaphthalene	829265		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Semi-VOAs
Trimethylphenanthrene, 1,2,6-	1,2,6-Trimethylphenanthrene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs
Trimethylphenol, 2,4,6-(Surrogate)	Surrogate: 2,4,6-Trimethylphenol	527606		% recovery					Organics	PAHs	SVOCs	Phenols	Surfactants
Trinitrophenylnitramine, Methyl-2,4,6-	Methyl-2,4,6-trinitrophenylnitramine (Tetryl)	479458		ug/L	ug/Kg dw				Organics
Trinitrotoluene, 2,4,6-	2,4,6-Trinitrotoluene (TNT)	118967		ug/L	ug/Kg dw				Organics
Tripentyltin(Surrogate)	Surrogate: Tripentyltin	0		% recovery	ug/Kg dw				Inorganics	Metals
Triphenyl Phosphate	Triphenyl Phosphate	0		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	FlameRetardants
Triphenyl Phosphate(Surrogate)	Surrogate: Triphenyl Phosphate	115866		ug/L	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OPs
Triphenylene	Triphenylene	0			ug/Kg dw				Organics	PAHs
Tripropyl Phosphate	Tripropyl Phosphate (TPrP)	513086			ng/g dw				Organics	FlameRetardants
Tripropyltin(Surrogate)	Surrogate: Tripropyltin	0			% recovery		% recovery	% recovery	Organics	Organotins
Tris(1,1-dimethylethyl)phenol, 2,4,6-	2,4,6-Tris(1,1-dimethylethyl)phenol	0					ug/Kg ww	ug/Kg dw	Organics	Phenols
Tris(1,3-dichloroisopropyl)phosphate	Tris(1,3-dichloroisopropyl)phosphate (TDCPP)	13674878		ng/L	ug/Kg dw				Organics	FlameRetardants
Tris(1-chloro-2-propyl)phosphate	Tris(1-chloro-2-propyl)phosphate (TCPP, multiple isomers)	13674845		ng/L	ng/g dw				Organics	FlameRetardants
Tris(2,3-dibromopropyl) phosphate	Tris(2,3-dibromopropyl) phosphate (TDBPP)	126727			ng/g dw				Organics	FlameRetardants
Tris(2-butoxyethyl)phosphate	Tris(2-butoxyethyl)phosphate (TBEP)	78513			ug/Kg dw				Organics	FlameRetardants
Tris(2-chloroethyl)phosphate	Tris(2-chloroethyl)phosphate (TCEP)	115968		ng/L	ug/Kg dw				Organics	FlameRetardants
Tris(2-ethylhexyl) phosphate	Tris(2-ethylhexyl) phosphate (TEHP)	78422			ng/g dw				Organics	FlameRetardants
Tris(2-isopropylphenyl)phosphate	Tris(2-isopropylphenyl)phosphate (TiPPP)	64532952			ng/g dw				Organics	FlameRetardants
Tris(3,5-dimethylphenyl)phosphate	Tris(3,5-dimethylphenyl)phosphate (T35DMPP)	25653161			ng/g dw				Organics	FlameRetardants
Tris(4-Chlorophenyl)Methane	Tris(4-Chlorophenyl)Methane (TCPM, T4CPM)	27575786					ng/g ww	ng/g dw	Organics
Tris-Methane	Tris-Methane	0		RPD					Organics	VOCs
Tris-Methanol	Tris-Methanol	0		RPD					Organics	VOCs
Trithion, Methyl	Methyl Trithion	953173		ug/L					Organics	Pesticides	Insecticides
Triticonazole	Triticonazole	131983727		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides
Tritium	Tritium	15086109		pCi/L					Inorganics
Tritium 2scu	Tritium 2-sigma Combined Uncertainty	0		pCi/L					Inorganics
Tritriacontane, n-	n-Tritriacontane	630057					ng/g ww	ng/g dw	Organics	Alkanes
TrophicStatus	General classification of trophic status based on observed algae and herbaceous plant levels	0	none						Habitat
TRPH	Total Recoverable Petroleum Hydrocarbons (TRPH)	0		mg/L	mg/Kg dw				Organics	PAHs
Turbidity	Turbidity	0		NTU					Inorganics	Conventionals	WaterQualityMeasurements	Habitat
Tylosin	Tylosin	1401690		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Ultraviolet Absorption (254nm)	Ultraviolet Absorption (254nm)	0		ABS/cm					Inorganics
Undecane, 2-phenyl-	2-Phenyl-undecane	0			ng/g dw				Organics	VOCs
Undecane, 3-phenyl-	3-Phenyl-undecane	0			ng/g dw				Organics	VOCs
Undecane, 4-phenyl-	4-Phenyl-undecane	0			ng/g dw				Organics	VOCs
Undecane, 5-phenyl-	5-Phenyl-undecane	0			ng/g dw				Organics	VOCs
Undecane, 6-phenyl-	6-Phenyl-undecane	0			ng/g dw				Organics	VOCs
Undecane, n-	n-Undecane	1120214					ng/g ww	ng/g dw	Organics	Alkanes
Undercut Distance	Undercut Distance	0	m						Habitat
Unknown Macro Foam	Foam of unknown origin, not analyzed in a lab	0	pieces						Debris	Trash
Unnatural Inflows Extent	Unnatural Inflows Extent	0	none						Habitat
Unnatural Inflows Intensity	Unnatural Inflows Intensity	0	none						Habitat
Unnatural Inflows Proximity	Unnatural Inflows Proximity	0	none						Habitat
Unpaved Roads Extent	Unpaved Roads Extent	0	none						Habitat
Unpaved Roads Intensity	Unpaved Roads Intensity	0	none						Habitat
Unpaved Roads Proximity	Unpaved Roads Proximity	0	none						Habitat
UplandSlope	Slope of bank or upland area	0	%						Habitat
Uranium	Uranium	0		ug/L	mg/Kg dw		ug/g ww	ug/g dw	Inorganics	Metals
Urban Commercial Extent	Urban Commercial Extent	0	none						Habitat
Urban Commercial Intensity	Urban Commercial Intensity	0	none						Habitat
Urban Commercial Proximity	Urban Commercial Proximity	0	none						Habitat
Urban Residential Extent	Urban Residential Extent	0	none						Habitat
Urban Residential Intensity	Urban Residential Intensity	0	none						Habitat
Urban Residential Proximity	Urban Residential Proximity	0	none						Habitat
Urban Water Quality Other Extent	Urban Water Quality Other Extent	0	none						Habitat
Urban Water Quality Other Intensity	Urban Water Quality Other Intensity	0	none						Habitat
Urban Water Quality Other Proximity	Urban Water Quality Other Proximity	0	none						Habitat
Urea	Urea	0		ug/L					Organics	Carbamide
Utensil	Utensil	0	pieces						Debris	Trash	Plastics	FoodService
Valley Width	Valley Width	0	m						Habitat
Valsartan	Valsartan	137862534		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Vanadium	Vanadium	7440622		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals
Vector Control Extent	Vector Control Extent	0	none						Habitat
Vector Control Intensity	Vector Control Intensity	0	none						Habitat
Vector Control Proximity	Vector Control Proximity	0	none						Habitat
VectorControl_Bs	Vector Control through Bs (Bacillus sphaericus) within waterbody	0	none						Habitat
VectorControl_Bti	Vector Control through Bti (Bacillus Thuringensis Israelensis) within waterbody	0	none						Habitat
VectorControl_Methoprene	Vector Control through Methoprene within waterbody	0	none						Habitat
VectorControl_Mosquitofish	Vector Control through Mosquitofish within waterbody	0	none						Habitat
VectorControl_Oil	Vector Control through Oil within waterbody	0	none						Habitat
Veg_Emergent	Percent cover of emergent vegetation within a given area	0	%						Habitat
Veg_Open	Percent cover of open space within a given area	0	%						Habitat
Veg_SubmergedAlgae	Percent cover of submerged algae within a given area	0	%						Habitat
Veg_SubmergedOther	Percent cover of submerged other (non-algae) within a given area	0	%						Habitat
Veg_SurfaceAlgae	Percent cover of surface algae within a given area	0	%						Habitat
Veg_SurfaceOther	Percent cover of surface other (non-algae) within a given area	0	%						Habitat
Vegetation Cover Bank	Percent of both bank surfaces upstream of sample location estimated to be covered by vegetation (plants & roots at water's edge)	0	none						FieldObservations	Habitat
Vegetation Cover Instream	Percent of stream's water surface upstream of sample location estimated to be covered by aquatic vegetation	0	none						FieldObservations	Habitat
Vegetation Cover Quality Metric	Metric assesses the quality of vegetation cover in the riparian and channel zones	0	score						Habitat
Vegetation Cover Structure Metric	Metric assesses structural complexity of the riparian environment in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte. Grasses are excluded.	0	score						Habitat
Velocity	Velocity	0		m/s					WaterQualityMeasurements
Verapamil	Verapamil	52539		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Vernolate	S-propyl N,N-dipropylcarbamothioate	0		ug/L
Versalide	Versalide	0					ng/g ww	ng/g dw	Organics	Musk
Vinclozolin	Vinclozolin	50471448		ug/L	ug/Kg dw				Organics	Pesticides	Fungicides
Vineyards Extent	Vineyards Extent	0	none						Habitat
Vineyards Intensity	Vineyards Intensity	0	none						Habitat
Vineyards Proximity	Vineyards Proximity	0	none						Habitat
Vinyl Acetate	Vinyl Acetate	108054		ug/L
Vinyl Chloride	Vinyl Chloride	75014		ug/L					Organics	VOCs
Virginiamycin	Virginiamycin	11006761		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Volume	Volume	0		L					Habitat
W1_HALL_SWAMP	Riparian human disturbance index, all types, proximity-weighted sum	0	none						Bioassessment
Wadeability	Wadeability	0	none						FieldObservations	Habitat
Walking Path Extent	Walking Path Extent	0	none						Habitat
Walking Path Intensity	Walking Path Intensity	0	none						Habitat
Walking Path Proximity	Walking Path Proximity	0	none						Habitat
Warfarin	Warfarin	81812		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs
Warfarin-d5(Surrogate)	Surrogate: Warfarin-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs
Waste, Food	Waste, Food	0	pieces						Debris	Natural	Non-Plastics	Biodegradable	Marine Origin
Waste, Pet	Waste, Pet	0	pieces						Debris	Natural	Non-Plastics	Toxic
Waste, Yard	Waste, Yard	0	pieces						Debris	Natural	Non-Plastics	Biodegradable	Marine Origin
Water Control Actions Other Extent	Water Control Actions Other Extent	0	none						Habitat
Water Control Actions Other Intensity	Water Control Actions Other Intensity	0	none						Habitat
Water Control Actions Other Proximity	Water Control Actions Other Proximity	0	none						Habitat
Water Control Features Other Extent	Water Control Features Other Extent	0	none						Habitat
Water Control Features Other Intensity	Water Control Features Other Intensity	0	none						Habitat
Water Control Features Other Proximity	Water Control Features Other Proximity	0	none						Habitat
Water level below Reference Point	Distance from reference point to water surface	0	m						Habitat
Water Level Fluctuations	Water Level Fluctuations	0	none						Habitat
Water Withdrawal	Water Withdrawal	0	none						Habitat
Waterbody Appeal	Waterbody Appeal	0	none						Habitat
Waterbody Disturbance	Waterbody Disturbance	0	none						Habitat
WaterbodyOrigin	Origin of the waterbody	0	none						Habitat
WaterClarity	WaterClarity	0		none					FieldObservations	Habitat
Wave Height	Wave Height	0	ft						Habitat	NULL
WaveAction	Wind Movement of Water on Surface	0	none						FieldObservations	Habitat
Weight	Weight	0	pounds		g ww	mg/ind			Toxicity
Weirs Extent	Weirs Extent	0	none						Habitat
Weirs Intensity	Weirs Intensity	0	none						Habitat
Weirs Proximity	Weirs Proximity	0	none						Habitat
WetlandClass	Class or type of wetland	0	none						Habitat
WetlandFunction_FloodControl	Function of the wetland for flood control use	0	none						Habitat
WetlandFunction_HumanUse	Function of the wetland for human use	0	none						Habitat
WetlandFunction_Stormwater	Function of the wetland for stormwater use	0	none						Habitat
WetlandFunction_Wildlife	Function of the wetland for wildlife use	0	none						Habitat
Wetted habitat	Wetted habitat (standing or flowing surface water)	0	%						Habitat
Wetted Width	Wetted Width	0	m						Habitat
Width	Width	0	m						Habitat
WindDirection	WindDirection	0	none						FieldObservations	Habitat
WindIntensity	Intensity of wind at the time of sampling	0	none						Habitat
WindSpeed	WindSpeed	0	none						FieldObservations	Habitat
Wire	Wire	0	pieces						Debris	Trash	Non-Plastics	Metals
Wood Debris	Wood Debris	0	pieces						Debris	Natural	Non-Plastics	Construction	Marine Origin
Wrapper, Food	Wrapper, Food	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Wrapper, Other	Wrapper, Other	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Wrapper, Plastic Straw	Wrapper, Plastic Straw	0	pieces						Debris	Trash	Plastics	Bags/Packaging
XBKF_W	Mean bankfull width of reach	0	m						Bioassessment
XCDENMID	Mean percent mid-channel canopy density	0	%						Bioassessment
XCMG	Riparian cover as sum of three layers physical-habitat metric	0	%						Bioassessment
XCMGW	Mean riparian woody cover as sum of three layers	0	none						Bioassessment
XFC_NAT_SWAMP	Mean sum of natural instream cover types	0	none						Bioassessment
XSLOPE	Mean slope (water surface gradient) of reach	0	%						Bioassessment
Xylene, m/p-	m-Xylene/p-Xylene	179601231		ug/L					Organics	VOCs	MTBE_BTEX	Xylenes
Xylene, o-	o-Xylene	95476		ug/L					Organics	VOCs	MTBE_BTEX	Xylenes
Xylenes, Total	Total Xylenes	1330207		ug/L					Organics	VOCs	MTBE_BTEX	Xylenes
Young/female	Young/female (#)	0				Num/Rep			Toxicity
Ytterbium	Ytterbium	7440644		ug/L					Inorganics
Yttrium	Yttrium	7440655		ug/L			ug/g ww	ug/g dw	Inorganics	Metals
Zinc	Zinc	7440666		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Ziram	Ziram	137304		ug/L					Organics	Pesticides	Fungicides
Zoxamide	Zoxamide	156052685		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides

CEDEN Data Checker Lookup Lists

CEDEN LookUp List: AnalytewithUnitperMatrix