LookUp List Information

CEDEN LookUp List: AnalytewithUnitperMatrix

AnalyteName	AnalyteDescr	CASNumber	pHab_Unit	Water_Unit	Sediment_Unit	Tox_Unit	Fish_Unit	Bivalve_Unit	Group1	Group2	Group3	Group4	Group5	Group6	LastUpdateDate
[DAsp3]Microcystin-RR	[Deaspartic acid3] Microcystin-RR	0		ug/L											2019-05-17
13C2-Perfluorooctanoic acid (PFOA)	13C2-Perfluorooctanoic acid (PFOA)	0		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS					2020-12-02
13c8-Perfluorooctanesulfonic acid (PFOS)	13c8-Perfluorooctanesulfonic acid (PFOS)	0		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS					2020-12-02
18a-Oleanane	18a-Oleanane	30759923					ng/g ww	ng/g dw	Organics	Hopanes					2014-01-28
2,2-bis(chloromethyl)propane-1,3-diyltetrakis(2-chloroethyl) bisphosphate	2,2-bis(chloromethyl)propane-1,3-diyltetrakis(2-chloroethyl) bisphosphate (V6)	38051104		ng/L					Organics	FlameRetardants					2014-03-13
2,4,6-tribromophenyl allyl ether	2,4,6-tribromophenyl allyl ether (ATE)	3278895			ng/g dw				Organics	FlameRetardants					2014-03-13
2-ethyl-1-hexyl-2,3,4,5-tetrabromobenzoate	2-ethyl-1-hexyl-2,3,4,5-tetrabromobenzoate (EHTBB)	183658277			ng/g dw				Organics	FlameRetardants					2014-03-13
2-Ethylhexyl-diphenyl phosphate	2-Ethylhexyl-diphenyl phosphate (EHDPP)	1241947		ng/L	ng/g dw				Organics	FlameRetardants					2014-03-13
6-Pack Ring	6-Pack Ring	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
6PPD-quinone	6PPD-quinone (N-(1,3-dimethylbutyl)-N'-phenyl-p-phenylenediamine-quinone)	2754428185		ng/L					Organics	para-Phenylenediamine (PPD) Derivatives					2026-01-23
6PPD-quinone-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: 6PPD-quinone-13C6	0		ng/L					Organics	para-Phenylenediamine (PPD) Derivatives					2026-01-23
Abamectin	Abamectin	71751412		ug/L					Organics	Pesticides					2019-06-13
AccesstoWaterbody_BikePath	AccesstoWaterbody_BikePath	0	none						Habitat	Debris					2014-11-04
AccesstoWaterbody_Fence	AccesstoWaterbody_Fence	0	none						Habitat	Debris					2014-11-04
AccesstoWaterbody_HeavyVegetation	AccesstoWaterbody_HeavyVegetation	0	none						Habitat	Debris					2014-11-04
AccesstoWaterbody_ParkingLot	AccesstoWaterbody_ParkingLot	0	none						Habitat	Debris					2014-11-04
AccesstoWaterbody_PicnicArea	AccesstoWaterbody_PicnicArea	0	none						Habitat	Debris					2014-11-04
AccesstoWaterbody_RestrictedAccessMaintenanceRoad	AccesstoWaterbody_RestrictedAccessMaintenanceRoad	0	none						Habitat	Debris					2014-11-04
AccesstoWaterbody_Roadway	AccesstoWaterbody_Roadway	0	none						Habitat	Debris					2014-11-04
AccesstoWaterbody_Walkway	AccesstoWaterbody_Walkway	0	none						Habitat	Debris					2014-11-04
Accumulation	Accumulation using Trash Protocol	0	score						Trash						2011-05-04
Acenaphthene	Acenaphthene	83329		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors		2007-07-27
Acenaphthene-d10(Surrogate)	Surrogate: Acenaphthene-d10	15067262		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors		2016-03-02
Acenaphthenes, C1-	C1-Acenaphthenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	LMW_PAH				2018-07-24
Acenaphthylene	Acenaphthylene	208968		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Acenaphthylene-d10(Surrogate)	Surrogate: Acenaphthylene-d10	0			ng/g dw										2019-04-23
Acenaphthylene-d8(IsoDilAnalogue)	Isotope Dilution Analogue: Acenaphthylene-d8	93951974		% recovery					Organics	PAHs	IDA				2023-11-14
Acenaphthylene-d8(Surrogate)	Surrogate: Acenaphthylene-d8	93951974		% recovery	% recovery		% recovery	% recovery	Organics	PAHs					2025-09-04
Acetaminophen	Acetaminophen	103902		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Acetaminophen(Surrogate)	Surrogate: Acetaminophen	0					% recovery	% recovery	Organics						2017-03-06
Acetaminophen-13C2-15N(Surrogate)	Surrogate: Acetaminophen-13C2-15N	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2016-03-02
Acetamiprid	Acetamiprid	135410207		ug/L	ng/g dw				Organics	Pesticides	Insecticides				2016-03-10
Acetamiprid-d3(Surrogate)	Surrogate: Acetamiprid-d3	1353869358		% recovery					Organics	Pesticides	Insecticides	Neonicotinoids			2025-12-15
Acetone	Acetone	67641		ug/L					Organics	VOCs					2007-07-27
Acetophenone	Acetophenone	98862			ug/Kg dw				Organics						2018-07-16
Acibenzolar-S-methyl	Acibenzolar-S-methyl	135158542		ng/L					Organics	Pesticides	Fungicides				2016-03-10
Acid Mine Drainage Extent	Acid Mine Drainage Extent	0	none						Habitat						2019-05-07
Acid Mine Drainage Intensity	Acid Mine Drainage Intensity	0	none						Habitat						2019-05-07
Acid Mine Drainage Proximity	Acid Mine Drainage Proximity	0	none						Habitat						2019-05-07
Acid Neutralizing Capacity	Acid Neutralizing Capacity (ANC)	0		ueq/L					Inorganics	Conventionals					2012-09-13
Acid Volatile Sulfides	Acid Volatile Sulfides (AVS)	0		ug/L	umol/g dw				Inorganics	Conventionals					2012-09-13
Acifluorfen	Acifluorfen	50594666		ug/L					Organics	Herbicides					2016-05-20
Acrinathrin	Acrinathrin	101007061			ug/Kg ww				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Acrolein	Acrolein	107028		ug/L			ug/Kg ww	ug/Kg dw	Organics	OrganochlorinePesticides					2008-11-07
Acrylonitrile	Acrylonitrile	107131		ug/L					Organics	VOCs					2014-01-29
Adsorbable Organic Fluorine	Adsorbable Organic Fluorine (AOF) [detected as Fluoride]	0		ug/L					Organics	PFAS					2025-11-21
Aesthetic Condition	Aesthetic Condition	0	none						Habitat	Debris					2014-11-04
AFDM_Algae	Ash Free Dry Mass primarily of Algae but other items may be weighed	0		mg/m3					Inorganics	Conventionals					2011-10-26
Age	Age	0					yr		Tissue						2009-08-20
Age Diversity and Natural Regeneration Metric	Metric assesses the age diversity and natural regeneration potential of woody species in the riparian and channel zones (excluding low-flow).	0	score						Habitat						2019-05-13
Age_Pond	Age (in years) of the pond if it is created	0	yr						Habitat						2012-09-13
Agricultural Other Extent	Agricultural Other Extent	0	none						Habitat						2019-05-07
Agricultural Other Intensity	Agricultural Other Intensity	0	none						Habitat						2019-05-07
Agricultural Other Proximity	Agricultural Other Proximity	0	none						Habitat						2019-05-07
Agricultural Runoff Extent	Agricultural Runoff Extent	0	none						Habitat						2019-05-07
Agricultural Runoff Intensity	Agricultural Runoff Intensity	0	none						Habitat						2019-05-07
Agricultural Runoff Proximity	Agricultural Runoff Proximity	0	none						Habitat						2019-05-07
Air Traffic Extent	Air Traffic Extent	0	none						Habitat						2019-05-07
Air Traffic Intensity	Air Traffic Intensity	0	none						Habitat						2019-05-07
Air Traffic Proximity	Air Traffic Proximity	0	none						Habitat						2019-05-07
Alachlor	Alachlor (Lasso)	15972608		ug/L	ug/Kg dw				Organics	Herbicides	Endocrine Disruptors				2013-05-28
Alachlor ethanesulfonic acid	Alachlor ethanesulfonic acid (ESA)	142363539		ug/L					Organics	Pesticides					2017-04-10
Alachlor oxanilic acid	Alachlor oxanilic acid (OXA)	0		ug/L					Organics	Pesticides					2017-04-10
Albuterol	Albuterol	18559949		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Albuterol-d3(Surrogate)	Surrogate: Albuterol-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2016-03-02
Aldicarb	Aldicarb	116063		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
Aldicarb Sulfone	Aldicarb Sulfone	1646884		ug/L	ug/Kg dw				Organics	Pesticides	Insecticides	Carbamates			2014-01-28
Aldicarb Sulfoxide	Aldicarb Sulfoxide	1646873		ug/L					Organics	Pesticides	Insecticides	Carbamates			2014-01-28
Aldrin	Aldrin	309002		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors		2007-07-27
Aldrin(Surrogate)	Surrogate: Aldrin	309002		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2016-03-02
Aldrin-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Aldrin-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
Aldrin-13C12(Surrogate)	Surrogate: Aldrin-13C12	309002			% recovery				Organics	Pesticides					2016-03-02
Algae Cover	Percent of stream's water surface upstream of sample location estimated to be covered with algae	0	%						FieldObservations	Habitat					2010-03-03
Algae Cover Filamentous	Percent of stream's water surface upstream of sample location estimated to be covered with filamentous algae	0	%						FieldObservations	Habitat					2010-03-03
Algae-attached	Percent of substrate in wetted channel upstream of sample location estimated to be covered with Algae-attached	0	%						FieldObservations	Habitat					2011-11-02
Algae-floating Mats	Percent of stream's water surface upstream of sample location estimated to be covered with Algae-floating Mats	0	%						FieldObservations	Habitat					2013-06-02
Algal Cover Periphyton	Percent of substrate in wetted channel upstream of sample location estimated to be covered with periphyton [living community attached to substrate including algae (not green filamentous type), aquatic mosses, fungi, diatoms & sessile invertebrates]	0	%						FieldObservations	Habitat					2010-03-03
Algal/Surface Mats/Benthic Algal Growth Extent	Algal/Surface Mats/Benthic Algal Growth Extent	0	none						Habitat						2019-05-07
Algal/Surface Mats/Benthic Algal Growth Intensity	Algal/Surface Mats/Benthic Algal Growth Intensity	0	none						Habitat						2019-05-07
Algal/Surface Mats/Benthic Algal Growth Proximity	Algal/Surface Mats/Benthic Algal Growth Proximity	0	none						Habitat						2019-05-07
Alkalinity as CaCO3	Alkalinity as CaCO3	471341		ug/L	mg/Kg dw				Inorganics	Conventionals	WaterQualityMeasurements	Habitat			2009-08-20
Allethrin	Allethrin	584792		ug/L	ug/Kg ww				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Alpha Linolenic Acid	Alpha Linolenic Acid	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid					2012-09-12
Alprazolam	Alprazolam	28981977		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Alprazolam-d5(Surrogate)	Surrogate: Alprazolam-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Aluminum	Aluminum	7429905		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals				2007-07-27
Aluminum Foil	Aluminum Foil	0	pieces						Debris	Trash	Non-Plastics	Metals			2014-11-04
Aluminum, Organic Monomeric	Organic Monomeric Aluminum (Organic Reactive)	0		ug/L					Inorganics	TraceElements	Metals				2013-05-21
Aluminum, Total Monomeric	Total Monomeric Aluminum (Organic + Inorganic Reactive)	0		ug/L					Inorganics	TraceElements	Metals				2013-05-21
Aluminum/Steel Can	Aluminum/Steel Can	0	pieces						Debris	Trash	Non-Plastics	Metals			2014-11-04
Ametryn	Ametryn	834128		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Aminobenzothiazole, 2-	2-Aminobenzothiazole (ABT)	136958		ng/L					Organics	Benzotriazoles and Benzothiazoles					2026-02-10
Aminocarb	Aminocarb	2032599		ug/L					Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
Aminomethyl Phosphonic Acid	Aminomethyl Phosphonic Acid (AMPA)	1066519		ug/L					Organics	Pesticides	Herbicides				2025-08-25
Aminopyralid	Aminopyralid	150114719		ug/L					Organics	Herbicides					2016-05-20
Amitriptyline	Amitriptyline	50486		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Amitriptyline-d5(Surrogate)	Surrogate: Amitriptyline-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2016-03-02
Amlodipine	Amlodipine	88150429		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Ammonia as N	Ammonia as N	7664417		umol/L	ug/g ww				Inorganics	Conventionals	Nutrients				2007-07-27
Ammonia as N, Unionized	Unionized Ammonia as N	7664417		mg/L					Inorganics	Conventionals	Nutrients				2012-06-22
Ammonia as NH3	Ammonia as NH3	7664417		mg/L					Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			2007-07-27
Ammonia as NH3, Unionized	Unionized Ammonia as NH3	7664417		mg/L					Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			2012-06-27
Ammonium as N	Ammonium as N (NH4)	0		ug/L					Inorganics	Conventionals	Nutrients				2010-04-21
Amoxicillin	Amoxicillin	26787780		ng/L											2018-08-20
AMPA(Surrogate)	Surrogate: Aminomethyl Phosphonic Acid (AMPA)	77521290		% recovery					Organics	Pesticides					2016-05-20
Amphetamine	Amphetamine	300629		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Amphetamine-d5(Surrogate)	Surrogate: Amphetamine-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2016-03-02
AnalysisWeight	Analysis weight of sample	0			mg		mg	mg	Laboratory	Ancillary					2014-02-05
Anatoxin-A	Anatoxin-A	64285069		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2012-05-22
Anatoxin-a gene, Prokaryotic DNA (anaC)	Anatoxin-a gene, Prokaryotic DNA, Target Gene: anaC, Proprietary primer sequences from Bend Genetics LLC	0		gc/mL					Microbiological	Cyanotoxins	Gene Marker				2026-05-27
Angling Pressure	Angling Pressure	0	none						Habitat						2009-08-20
Anilazine	Anilazine	101053		ug/L					Organics	Pesticides	Fungicides				2016-10-25
Aniline	Aniline (Aminobenzene)(Phenylamine)	0		ug/L					Organics	VOCs					2016-05-20
Animal Burrows Extent	Animal Burrows Extent	0	none						Habitat						2019-05-07
Animal Burrows Intensity	Animal Burrows Intensity	0	none						Habitat						2019-05-07
Animal Burrows Proximity	Animal Burrows Proximity	0	none						Habitat						2019-05-07
AnimalPresence	describes presence of animals which may include tracks, scat, sounds or physical presence	0	none						FieldObservations	Habitat					2013-04-01
Anion-Cation Balance	Anion-Cation Balance	0		none					Inorganics						2017-03-29
AnoxicTransitionDepth	Depth of the oxic-anoxic transition zone, also called redox potential discontinuity	0			cm				FieldObservations	Habitat					2018-02-20
Anthracene	Anthracene	120127		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors		2007-07-27
Anthracene-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Anthracene-d10	1719068		% recovery											2024-01-19
Anthracene-d10(Surrogate)	Surrogate: Anthracene-d10	0		% recovery	%				Organics	PAHs					2016-03-02
Anthraquinone	Anthraquinone	84651			ug/Kg ww				Organics						2018-07-16
Anthropogenic (unknown base) fiber	Fiber that is anthropogenic because it is DYED, but material type could not be identified as plastic or natural	0							Microdebris	Anthropogenic		Fiber			2018-06-18
Anthropogenic Alt Channel Modification SubMetric	Metric assesses the impact of anthropogenic alterations based on channel modification	0	score						Habitat						2019-05-13
Anthropogenic Alt Hydromodification SubMetric	Metric assesses the impact of anthropogenic alterations based on hydromodification and Channel Evolution Models (CEMS)	0	score						Habitat						2019-05-13
Anthropogenic Alterations to Channel Morph Metric	Metric assesses the impact of anthropogenic alterations to channel morphology through hydromodification and channel modification. Metric is an average of the two previous submetrics.	0	score						Habitat						2019-05-13
Antimony	Antimony	7440360		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	Metals	Metalloids				2007-07-27
Appliance	Appliance	0	pieces						Debris	Trash	Non-Plastics	Large			2014-11-04
AquaticLife	AquaticLife using Trash Protocol	0	score						Trash						2011-05-04
Arachidonic	Arachidonic	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid					2012-09-12
Area	Area	0	m2						Tissue	Habitat					2012-06-01
Arsenate	Arsenate	0					ug/g ww	ug/g dw	Inorganics	Metals					2014-01-29
Arsenic	Arsenic	7440382		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals	Metalloids			2007-07-27
Arsenic, Inorganic	Inorganic Arsenic	7440382					ug/g ww	ug/g dw	Inorganics	TraceElements	Metals				2013-05-28
Arsenite	Arsenite	0					ug/g ww	ug/g dw	Inorganics	Metals					2014-01-29
Asbestos, Total	Total Asbestos	0		mf/L					Inorganics	Conventionals					2012-09-13
Ash Free Dry Mass	Ash-Free Dry Mass (AFDM, AFDW)	0		mg/L					Inorganics	Conventionals	Benthic				2011-11-10
Aspon	Aspon	3244904		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Atenolol	Atenolol	29122687		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Atenolol-d7(Surrogate)	Surrogate: Atenolol-d7	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2016-03-02
Atorvastatin	Atorvastatin	134523005		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Atraton	Atraton	1610179		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Atrazine	Atrazine	1912249		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Triazines	Herbicides	Endocrine Disruptors		2007-07-27
Atrazine-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Atrazine-13C3	0					% recovery	% recovery	Organics	Pest-Triazines	IDA				2023-10-03
Atrazine-13C3(Surrogate)	Surrogate: Atrazine-13C3	0		% recovery					Organics	Pesticides	Pest-Triazines				2016-03-02
Atrazine-d5(Surrogate)	Surrogate: Atrazine-d5	163165751		% recovery					Organics	Pesticides	Pest-Triazines	Herbicides	Endocrine Disruptors		2016-03-02
Atrazine-Desisopropyl-2-Hydroxy	Atrazine-Desisopropyl-2-Hydroxy	7313544		ug/L					Organics	Omega Fatty Acid					2012-09-12
ATVs Extent	ATVs Extent	0	none						Habitat						2019-05-07
ATVs Intensity	ATVs Intensity	0	none						Habitat						2019-05-07
ATVs Proximity	ATVs Proximity	0	none						Habitat						2019-05-07
Autopart	Autopart	0	pieces						Debris	Trash	Non-Plastics	Metals			2014-11-04
Avian_GFD	Avian_GFD	0		copies/100mL					Microbiological						2018-01-30
Azinphos Ethyl	Azinphos Ethyl	2642719		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides			2013-05-28
Azinphos Methyl	Azinphos Methyl (Guthion)	86500		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2013-05-28
Azinphos Methyl oxon	Azinphos Methyl oxon	0		ng/L					Organics	Pesticides					2018-03-04
Azinphos Methyl(Surrogate)	Surrogate: Azinphos Methyl	0		% recovery					Organics	Pesticides	OrganophosphatePest.	Insecticides			2016-03-02
Azinphos-methyl oxygen analog	Azinphos-methyl oxygen analog	0		ug/L					Organics	Pesticides					2017-04-10
Azinphos-Methyl-d6(IsoDilAnalogue)	Isotope Dilution Analogue: Azinphos-Methyl-d6	0					% recovery	% recovery	Organics	Pest-OPs	IDA				2023-10-27
Azithromycin	Azithromycin	83905015		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Azobenzene	Azobenzene (Diphenyl Diimide)	103333		ug/L					Organics	SVOCs					2014-01-29
Azoxystrobin	Azoxystrobin	131860338		ug/L	ug/Kg dw				Pesticides	Fungicides					2012-06-21
Back Water	Back Water present	0	none						Habitat						2009-08-20
Bacteriodales, Cow	Cow Bacteriodales	0		gc/mL					Microbiological	Pathogens	Conventionals				2010-04-21
Bacteriodales, Dog	Dog Bacteriodales	0		gc/mL					Microbiological	Pathogens	Conventionals				2010-04-21
Bacteriodales, Human	Human Bacteriodales	0		gc/mL					Microbiological	Pathogens	Conventionals				2010-04-21
Bacteriodales, Universal	Universal Bacteriodales	0		gc/mL					Microbiological	Pathogens	Conventionals				2010-04-21
Bacteriophage MS2	Bacteriophage MS2	0		PFU/L					Microbiological	Pathogens					2020-09-03
Bacteroidales, Avian (LeeSeaGull)	Avian Bacteroidales, Assay name: LeeSeaGull, 5’ AGGTGCTAATACCGCATAATACAGAG 3’, 5’ GCCGTTACCTCACCGTCTA 3’	0		gc/mL					Microbiological	MST					2025-09-02
Bacteroidales, Canine (BacCan)	Canine Bacteroidales, Assay name: BacCan, 5' GGAGCGCAGACGGGTTTT 3', 5' CAATCGGAGTTCTTCGTGATATCTA 3'	0		gc/mL					Microbiological	MST					2025-01-10
Bacteroidales, Canine (DogBact)	Canine Bacteroidales, Assay Name: DogBact	0		copies/100mL											2021-12-17
Bacteroidales, Cow	Cow Bacteroidales	0		gc/mL					Microbiological	Pathogens	Conventionals				2010-04-21
Bacteroidales, Cow (BacCow)	Cow Bacteroidales, Assay name: BacCow, 5' CCAACYTTCCCGWTACTC 3', 5' GGACCGTGTCTCAGTTCCAGTG 3'	0		gc/mL					Microbiological	MST					2025-01-10
Bacteroidales, Cow (CowM2)	Cow Bacteroidales, Assay name: CowM2, 5' CGGCCAAATACTCCTGATCGT 3', 5' GCTTGTTGCGTTCCTTGAGATAAT 3'	0		gc/mL					Microbiological	MST					2025-01-10
Bacteroidales, Dog	Dog Bacteroidales	0		none	copies/g dw				Microbiological	Pathogens	Conventionals				2010-04-21
Bacteroidales, Horse	Horse Bacteroidales	0		none					Microbiological	Pathogens	Conventionals				2014-08-01
Bacteroidales, Horse (HoF597F)	Horse Bacteroidales, Assay name: HoF597F, 5' CCAGCCGTAAAATAGTCGG 3', 5' CAATCGGAGTTCTTCGTG 3'	0		gc/mL					Microbiological	MST					2025-01-10
Bacteroidales, Human	Human Bacteroidales	0		none	copies/g dw				Microbiological	Pathogens	Conventionals				2010-04-21
Bacteroidales, Human (BacH)	Human Bacteroidales Marker BacH	0		gc/mL											2021-10-18
Bacteroidales, Human (HF183/BacR287)	Human Bacteroidales, Assay name: HF183/BacR287, 5'-ATCATGAGTTCACATGTCCG-3', 5'-CTTCCTCTCAGAACCCCTATCC-3'	0		gc/mL	none				Microbiological						2023-01-27
Bacteroidales, Human (HF183/BFDrev)	Human Bacteroidales, Assay name: HF183/BFDrev, 5' ATCATGAGTTCACATGTCCG 3', 5' CGTAGGAGTTTGGACCGTGT 3'	0		gc/mL											2022-09-14
Bacteroidales, Human (HF183TMCaMan)	Human Bacteroidales, Assay name: HF183TMCaMan, 5’ ATCATGAGTTCACATGTCCG 3’, 5’ CTTCCTCTCAGAACCCCTATCC 3’	0		copies/100 mL					Microbiological						2022-08-19
Bacteroidales, Human (HumM2)	Human Bacteroidales, Assay name: HumM2, 5'-CGTCAGGTTTGTTTCGGTATTG-3', 5'-TCATCACGTAACTTATTTATATGCATTAGC-3'	0		copies/100 mL					Microbiological						2023-01-27
Bacteroidales, Porcine (Pig2Bac)	Porcine Bacteroidales, Assay name: Pig2Bac	0		copies/100 mL					Microbiological						2022-02-11
Bacteroidales, Ruminant (Rum2Bac)	Ruminant Bacteroidales, Asssay name: Rum2Bac, 5' ACAGCCCGCGATTGATACTGGTAA 3', 5' CAATCGGAGTTCTTCGTGAT 3'	0		gc/mL	none				Microbiological	MST					2025-01-10
Bacteroidales, Universal	Universal Bacteroidales	0		none					Microbiological	Pathogens	Conventionals				2010-04-21
Bacteroidales, Universal (UniB)	Universal Bacteroidales, Assay name: UniB, 5' GGGGTTCTGAGAGGAAGGT 3', 5' CCGTCATCCTTCACGCTACT 3'	0		gc/mL					Microbiological	Pathogens	Conventional				2024-10-01
Bag, Large/Retail	Bag, Large/Retail	0	pieces						Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Bag, Pet Waste	Bag, Pet Waste	0	pieces						Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Bag, Single Use Plastic	Bag, Single Use Plastic	0	pieces						Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Bag, Takeout	Bag, Takeout	0	pieces						Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Bags/Packaging	Bags/Packaging	0	pieces						Debris	Trash	Plastics				2014-11-05
Balloon, Latex	Balloon, Latex	0	pieces						Debris	Trash	Plastics	Miscellaneous			2014-11-04
Balloon, Mylar	Balloon, Mylar	0	pieces						Debris	Trash	Plastics	Miscellaneous			2014-11-04
Bandage/Bandaid	Bandage/Bandaid	0	pieces						Debris	Trash	Plastics	Miscellaneous			2014-11-04
Bank Angle	Bank Angle	0	none						Habitat						2009-08-20
Bank Cover	Bank Cover	0	none						Habitat						2012-05-22
Bank Stability	Bank Stability (score zone 5m up and 5m downstream of transect between bankfull - wetted width)	0	none						Habitat						2009-08-20
Bankfull Height	Bankfull Height	0	m						Habitat						2009-08-20
Bankfull Width	Bankfull Width	0	m						Habitat						2009-08-20
Bankfull Width Reach	Visual estimate of the average bankfull width of the reach	0	m						Habitat						2009-08-20
Bar Present	Bar Present	0	none						Habitat						2009-08-20
Bar Width	Bar Width	0	m						Habitat						2009-08-20
Barban	Barban	101279		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Barban(Surrogate)	Surrogate: Barban	101279		% recovery					Organics	Pesticides	Pest-Carbamates				2016-03-02
Barium	Barium	7440393		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals					2007-07-27
Barometric Pressure	Barometric Pressure	0							Habitat						2011-11-01
Batteries, Large	Batteries, Large	0	pieces						Debris	Trash	Non-Plastics	Toxic			2014-11-04
Batteries, Small	Batteries, Small	0	pieces						Debris	Trash	Non-Plastics	Toxic			2014-11-04
Battery Voltage	Battery Voltage	0							FieldMeasure						2012-04-23
Bearing	Bearing	0	degrees						Habitat						2009-08-20
BeaufortScale	BeaufortScale	0	none						FieldObservations	Habitat					2009-08-20
Beaver Flow Modifications	Beaver Flow Modifications	0	none						Habitat						2009-08-20
Beaver Signs	Beaver Signs	0	none						Habitat						2009-08-20
Bendiocarb	Bendiocarb	22781233		ug/L					Organics	Pesticides	Pest-Carbamates				2013-05-20
Benfluralin	Benfluralin	1861401		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides				2016-03-10
Benomyl	Benomyl	17804352		ug/L					Organics	Pesticides	Pest-Carbamates	Endocrine Disruptors	Fungicides	Nematocides	2007-07-27
Benomyl/Carbendazim	Benomyl/Carbendazim	0		ug/L					Organics	Pesticides					2016-04-26
Bensulfuron Methyl	Bensulfuron Methyl	83055996		ug/L					Organics	Pesticides	Pest-Carbamates				2013-05-20
Bensulide	Bensulide	741582		ug/L					Organics	Herbicides					2016-05-20
Bentazon	Bentazon	25057890		ug/L					Organics	Pesticides					2016-05-20
Benz(a)anthracene	Benz(a)anthracene	56553		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2007-07-27
Benz(a)anthracene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benz(a)anthracene-d12	1718532		% recovery					Organics	PAH	IDA				2023-11-14
Benz(a)anthracene-d12(Surrogate)	Surrogate: Benz(a)anthracene-d12	1718532		% recovery	% recovery		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2016-03-02
Benz(a)anthracene-d12/Chrysene-d12(Surrogate)	Surrogate: Benz(a)anthracene-d12/Chrysene-d12	0		% recovery					Organics	PAHs					2014-01-28
Benz(a)anthracenes/Chrysenes, C1-	C1-Benz(a)anthracenes/Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs					2014-01-28
Benz(a)anthracenes/Chrysenes, C2-	C2-Benz(a)anthracenes/Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs					2014-01-28
Benz(a)anthracenes/Chrysenes, C3-	C3-Benz(a)anthracenes/Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs					2014-01-28
Benz(a)anthracenes/Chrysenes, C4-	C4-Benz(a)anthracenes/Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs					2014-01-28
Benz(e)pyrene-d12(Surrogate)	Surrogate: Benz(e)pyrene-d12	205440820		% recovery	% recovery		% recovery	% recovery	Organics	PAHs	Semi-VOAs				2016-03-02
Benzaldehyde	Benzaldehyde	100527		% recovery					Organics	VOCs					2014-01-29
Benzene	Benzene	71432		ug/L					Organics	VOCs	MTBE_BTEX				2007-07-27
Benzidine	Benzidine	92875		ug/L					Organics	SVOCs					2014-01-29
Benzo(a)fluoranthene	Benzo(a)fluoranthene	203338		ug/L	ng/g dw				Organics	PAHs	SVOCs				2012-05-22
Benzo(a)pyrene	Benzo(a)pyrene	50328		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2007-07-27
Benzo(a)pyrene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(a)pyrene-d12	63466717		% recovery					Organics	PAHs	IDA				2023-11-14
Benzo(a)pyrene-d12(Surrogate)	Surrogate: Benzo(a)pyrene-d12	63466717		% recovery	% recovery		% recovery	% recovery	Organics	PAHs					2025-08-25
Benzo(b)fluoranthene	Benzo(b)fluoranthene	205992		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2007-07-27
Benzo(b)fluoranthene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(b)fluoranthene-d12	93951985		% recovery					Organics	PAHs	IDA				2023-11-07
Benzo(b)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12	93951985		% recovery	% recovery		% recovery	% recovery	Organics	PAHs					2016-03-02
Benzo(b)fluorene, 11H-	11H-Benzo(b)fluorene	243174			ng/g dw										2019-04-23
Benzo(b/j/k)fluoranthene	Benzo(b)fluoranthene/Benzo(j)fluoranthene/Benzo(k)fluoranthene	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Semi-VOAs	HMW_PAH	Endocrine Disruptors		2013-05-28
Benzo(b/j/k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12/Benzo(j)fluoranthene-d12/Benzo(k)fluoranthene-d12	0		% recovery					Organics	PAHs					2013-05-28
Benzo(b/k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12/Benzo(k)fluoranthene-d12	0		% recovery					Organics	PAHs					2013-05-28
Benzo(e)pyrene	Benzo(e)pyrene	192972		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2007-07-27
Benzo(e)pyrene-d12(Surrogate)	Surrogate: Benzo(e)pyrene-d12	205440820		% recovery	% recovery				Organics	PAHs	SVOCs				2016-03-02
Benzo(g,h,i)perylene	Benzo(g,h,i)perylene	191242		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2007-07-27
Benzo(g,h,i)perylene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(g,h,i)perylene-d12	93951667		% recovery					Organics	PAHs	IDA				2023-11-07
Benzo(g,h,i)perylene-d12(Surrogate)	Surrogate: Benzo(g,h,i)perylene-d12	93951667		% recovery	% recovery		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2016-03-02
Benzo(j)fluoranthene	Benzo(j)fluoranthene	0					ug/Kg ww	ug/Kg dw	Organics	PAHs					2008-11-07
Benzo(j/k)fluoranthene	Benzo(j)fluoranthene/Benzo(k)fluoranthene	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2013-04-10
Benzo(k)fluoranthene	Benzo(k)fluoranthene	207089		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2007-07-27
Benzo(k)fluoranthene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(k)fluoranthene-d12	93952013		% recovery					Organics	PAHs	IDA				2023-11-14
Benzo(k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(k)fluoranthene-d12	0		% recovery	% recovery		% recovery	% recovery	Organics	PAHs					2014-01-28
Benzobicyclon	Benzobicyclon pesticide	156963665		ug/L											2017-12-12
Benzofluoranthenes/Benzopyrenes, C1-	C1-Benzofluoranthenes/Benzopyrenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Alkylated PAHs				2018-07-24
Benzofluoranthenes/Benzopyrenes, C2-	C2-Benzofluoranthenes/Benzopyrenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Alkylated PAHs				2018-07-24
Benzoic Acid	Benzoic Acid	0		ug/L	ug/Kg dw				Organics	Herbicides					2016-05-20
Benzophenone	Benzophenone	119619			ug/Kg dw				Organics						2018-07-16
Benzothiazole, 2-(4-Morpholinyl)	2-(4-Morpholinyl)Benzothiazole (2,4-MoBT)	4225267		ng/L					Organics	Benzotriazoles and Benzothiazoles					2026-02-10
Benzothiazolone	Benzothiazolone (2-Benzothiazolinone) (2-Hydroxy-Benzothiazole)	934349		ng/L					Organics	Benzotriazoles and Benzothiazoles					2026-02-10
Benzothiophene	Benzothiophene	95158		ng/L			ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Benzothiophene, C1-	C1-Benzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Benzothiophene, C2-	C2-Benzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Benzothiophene, C3-	C3-Benzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Benzotriazole, 1H	1H-Benzotriazole	95147		ng/L											2021-05-07
Benzoylecgonine	Benzoylecgonine	519095		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Benzoylecgonine-d8(Surrogate)	Surrogate: Benzoylecgonine-d8	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2016-03-02
Benztropine	Benztropine	86135		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Benztropine-d3(Surrogate)	Surrogate: Benztropine-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2016-03-02
Benzyl Alcohol	Benzyl Alcohol	0		ug/L	ug/Kg dw				Organics	VOCs					2016-05-20
Beryllium	Beryllium	7440417		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals					2007-07-27
Betamethasone	Betamethasone	378449		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Bicarbonate	Bicarbonate	71523		ug/L	mg/Kg dw				Inorganics	Conventionals					2012-09-13
Bicarbonate Alkalinity as CaCO3	Bicarbonate Alkalinity as CaCO3	471341		mg/L					Inorganics	Conventionals	WaterQualityMeasurements				1900-01-01
Bifenox	Bifenox	42576023		ug/L					Organics	Pesticides	Herbicides				2016-10-25
Bifenthrin	Bifenthrin	82657043		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Bifenthrin, Total(Surrogate)	Surrogate: Total Bifenthrin	0		% recovery											2022-06-07
Bifenthrin-d5(Surrogate)	Surrogate: Bifenthrin-d5 ((rac-cis)-Z-Bifenthrin-d5)	2714484156		% recovery	% recovery				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Bifenthrin-d6(Surrogate)	Surrogate: Bifenthrin-d6	0		% recovery	% recovery				SVOC	Pesticides					2023-08-17
Biodegradable, Other	Biodegradable, Other	0	pieces						Debris	Natural	Non-Plastics	Biodegradable			2014-11-04
Biomass (wt/orig indiv)	Biomass (weight/original individual)	0		mg/ind		mg/ind			Toxicity						2007-07-27
Biphenyl	Biphenyl	92524		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Biphenyl-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Biphenyl-d10	1486017		% recovery					Organics	PAHs	IDA				2023-11-07
Biphenyl-d10(Surrogate)	Surrogate: Biphenyl-d10	1486017		% recovery	% recovery		ng/g ww	ng/g dw	Organics	PAHs	SVOCs				2007-07-27
Biphenyls, C1-	C1-Biphenyls	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	LMW_PAH				2018-07-24
Biphenyls, C2-	C2-Biphenyls	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	LMW_PAH				2018-07-24
Bis(1,3-dichloro-2-propyl) phosphate	Bis(1,3-dichloro-2-propyl) phosphate (BDCPP)	72236727			ng/g dw				Organics	FlameRetardants					2014-03-13
Bis(2,4,6-tribromophenoxy)ethane-1,2	1,2-bis(2,4,6-tribromophenoxy)ethane (BTBPE)	37853591			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2024-11-07
Bis(2,4,6-tribromophenoxy)ethane-1,2-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2-bis(2,4,6-tribromophenoxy)ethane-13C12 (BTBPE-13C12)	0					% recovery	% recovery	Organics	FlameRetardants	IDA				2024-10-31
Bis(2-chloro-1-methylethyl) ether	Bis(2-chloro-1-methylethyl) ether	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	SVOCs					2014-01-29
Bis(2-chloroethoxy)methane	Bis(2-chloroethoxy)methane	111911		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2007-07-27
Bis(2-chloroethyl)ether	Bis(2-chloroethyl)ether	111444		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2007-07-27
Bis(2-chloroisopropyl) ether	Bis(2-chloroisopropyl) ether	39638329		ug/L	ug/Kg dw				Organics	SVOCs					2016-08-26
Bis(2-ethly-1-hexyl)tetrabromophthalate	Bis(2-ethly-1-hexyl)tetrabromophthalate (BEHTBP)	26040517			ng/g dw				Organics	FlameRetardants					2014-03-13
Bis(2-ethylhexyl)adipate	Bis(2-ethylhexyl)adipate	103231		ug/L					Organics	SVOCs					2016-05-20
Bis(2-ethylhexyl)phthalate	Bis(2-ethylhexyl)phthalate	117817		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs	Endocrine Disruptors				2024-03-01
Bis(2-ethylhexyl)phthalate-d4(Surrogate)	Surrogate: Bis(2-ethylhexyl)phthalate-d4	0		% recovery					Organics	SVOCs					2014-01-29
Bis(alpha,alpha-Dimethylbenzyl)Diphenylamine, 4,4-	4,4-Bis(alpha,alpha-Dimethylbenzyl)Diphenylamine (SDPA-diAMS)	10081671		ng/L					Organics	Substituted Diphenylamines (SDPAs)					2026-02-10
Bisphenol A	Bisphenol A	80057		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Bisphenol A-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol A-13C12	263261650		% recovery					Organics	PPCPs	Bisphenols				2026-05-27
Bisphenol A-d16(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol A-d16	96210876		% recovery					Organics						2022-07-22
Bisphenol A-d16(Surrogate)	Surrogate: Bisphenol A-d16	96210876		% recovery					Organics	PPCPs	Bisphenols				2026-06-12
Bisphenol A-d6(Surrogate)	Surrogate: Bisphenol A-d6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2016-03-02
Bisphenol AF	Bisphenol AF	1478611		ng/L					Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol AF-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol AF-13C12	0		% recovery					Organics	PPCPs	Bisphenols				2026-05-27
Bisphenol B	Bisphenol B	77407		ng/L					Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol B-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol B-13C12	0		% recovery					Organics	PPCPs	Bisphenols				2026-05-27
Bisphenol E	Bisphenol E	2081085		ng/L					Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol F	Bisphenol F	620928		ng/L					Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol F-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol F-13C12	0		% recovery					Organics	PPCPs	Bisphenols				2026-05-27
Bisphenol S	Bisphenol S	80091		ng/L					Organics	PPCPs	Bisphenols				2017-09-19
Bisphenol S-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol S-13C12	0		% recovery					Organics	PPCPs	Bisphenols				2026-05-27
Bispyribac Sodium	Bispyribac Sodium	125401925		ug/L					Organics	Pesticides	Herbicides				2016-10-25
Bivalve CI Mean	Bivalve Condition Index Mean	0					g/mL	g/mL	Organics	Inorganics	Metals	Conventionals	Semi-VOAs	VOAs	2012-10-30
Bivalve CI SE	Bivalve Condition Index Standard Error	0					g/mL	g/mL	Organics	Inorganics	Metals	Conventionals	Semi-VOAs	VOAs	2012-10-30
Blue-Green Algae Phycocyanin	Blue-Green Algae Phycocyanin (BGA-PC)	0		ug/L					WaterQualityMeasurements						2014-05-07
BOD	Biochemical Oxygen Demand (BOD) - 5 day test	0		mg/L					Inorganics	Conventionals					2007-07-27
Bolstar	Bolstar (Sulprofos)	35400432		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Boron	Boron	7440428		ug/L	mg/Kg dw		ug/g ww	ug/g dw	Inorganics	Conventionals	Metals	Metalloids			2007-07-27
Boscalid	Boscalid	188425856		ug/L	ug/Kg dw				Organics	Fungicides					2016-05-20
Bottle Cap, Metal	Bottle Cap, Metal	0	pieces						Debris	Trash	Non-Plastics	Metals			2014-11-04
Bottle Cap, Plastic	Bottle Cap, Plastic	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
Bottle, Beach	Bottle, Beach	0	pieces						Debris	Trash	Plastics	Toxic			2014-11-04
Bottle, Cleaning	Bottle, Cleaning	0	pieces						Debris	Trash	Plastics	Toxic			2014-11-04
Bottle, Glass	Bottle, Glass	0	pieces						Debris	Trash	Non-Plastics	Household			2014-11-04
Bottle, Plastic	Bottle, Plastic Beverage	0	pieces						Debris	Trash	Plastics				2022-11-02
Bottle, Shampoo	Bottle, Shampoo	0	pieces						Debris	Trash	Plastics	Household			2014-11-04
Bottle, Soda	Bottle, Soda	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
Bottle, Sport	Bottle, Sport	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
Bottle, Water	Bottle, Water	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
Brick	Brick	0	pieces						Debris	Trash	Non-Plastics	Construction			2014-11-04
Bridge	Bridge	0	none						Habitat	Debris					2014-11-04
Bridge Fence	Bridge Fence	0	none						Habitat	Debris					2014-11-04
Bridge Fence Height	Bridge Fence Height	0	m						Habitat	Debris					2014-11-04
Bridges, Culverts	Bridges, Culverts	0	none						Habitat						2009-08-20
Bromacil	Bromacil	314409		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Bromide	Bromide	24959679		ug/L					Inorganics	Conventionals	Nutrients				2013-05-28
Bromo-2-Nitrobenzene, 1-(Surrogate)	Surrogate: 1-Bromo-2-Nitrobenzene	0		% recovery					Organics	VOCs					2019-07-24
Bromo-3,5-dimethylphenyl-N-methylcarbamate, 4-(Surrogate)	Surrogate: 4-Bromo-3,5-dimethylphenyl-N-methylcarbamate (BDMC)	672991		% recovery					Organics	OrganochlorinePesticides					2016-03-02
Bromoacetic Acid	Bromoacetic Acid (Monobromoacetic Acid)(MBAA)	79083		ug/L					Organics	Haloacetic acids (HAAs)					2025-11-05
Bromobenzene	Bromobenzene (Phenyl Bromide)	108861		ug/L					Organics	VOCs					2013-05-28
Bromochloromethane	Bromochloromethane	74975		ug/L					Organics	VOCs					2007-07-27
Bromodichloromethane	Bromodichloromethane (Dichlorobromomethane)	75274		ug/L			ug/Kg ww	ug/Kg dw	Organics	VOCs					2011-05-03
Bromofluorobenzene, 4-	4-Bromofluorobenzene	460004		% recovery	ug/Kg ww				Organics	VOCs					2016-05-20
Bromofluorobenzene, 4-(Surrogate)	Surrogate: 4-Bromofluorobenzene	460004		ug/L	% recovery				Organics	VOCs					2016-03-02
Bromoform	Bromoform (Tribromomethane)	75252		ug/L					Organics	VOCs					2007-07-27
Bromomethane	Bromomethane (Methyl Bromide)	74839		ug/L					Organics	VOCs					2013-05-28
Bromophenyl Phenyl Ether, 4-	4-Bromophenyl Phenyl Ether	101553		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2013-05-28
Bromuconazole	Bromuconazole (Bromoconazole)	116255482		ng/L					Organics	Pesticides	Fungicides				2023-02-02
Bulk Density	Bulk Density	0			g/cm3 ww				WaterQualityMeasurements	Ancillary					2014-02-05
Bumetrizole	Bumetrizole (UV-326) (2-tert-butyl-6-(5-Chloro-2H-1,2,3-Benzotriazol-2-yl)-4-Methylphenol)	3896115		ng/L					Organics	Benzotriazoles and Benzothiazoles					2026-02-10
Burns Extent	Burns Extent	0	none						Habitat						2019-05-07
Burns Intensity	Burns Intensity	0	none						Habitat						2019-05-07
Burns Proximity	Burns Proximity	0	none						Habitat						2019-05-07
Butachlor	Butachlor	23184669		ug/L					Organics	Herbicides					2007-07-27
Butanone, 2-	2-Butanone (Methyl Ethyl Ketone)	78933		ug/L					Organics	VOCs					2013-05-28
Butralin	Butralin	33629479		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides				2016-03-10
Butyl Benzyl Phthalate	Butyl Benzyl Phthalate	85687		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs	Endocrine Disruptors				2013-05-28
Butyl Benzyl Phthalate-d4(Surrogate)	Surrogate: Butyl Benzyl Phthalate-d4	0		% recovery					Organics	SVOCs					2014-01-29
Butylate	Butylate	2008415		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates				2007-07-27
Butylbenzene, n-	n-Butylbenzene	104518		ug/L					Organics	VOCs					2007-07-27
Butylbenzene, sec-	sec-Butylbenzene	135988		ug/L					Organics	VOCs					2007-07-27
Butylbenzene, tert-	tert-Butylbenzene	98066		ug/L					Organics	VOCs					2007-07-27
Butyl-N-ethyl-2,6-dinitro-4-(trifluoromethyl)aniline, N-	N-Butyl-N-ethyl-2,6-dinitro-4-(trifluoromethyl)aniline (Benfluralin)	0		ug/L					Organics	Pesticides	Herbicides				2017-04-04
Butyltin as Sn	Butyltin as Sn	0			ug/Kg dw				Organics	Organotins					2016-05-20
C. coli		0		copies/100 mL											2018-02-13
C. jejuni		0		copies/100 mL											2018-02-13
CA_LRM	Score for the California Logistic Regression Model (CA LRM)	0			score				Sediment Quality Objectives	Index/Metric					2022-03-18
Cadmium	Cadmium	7440439		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals				2007-07-27
Caffeine	Caffeine	58082		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2009-09-29
Caffeine-13C(Surrogate)	Surrogate: Caffeine-13C	202282982		% recovery			% recovery	% recovery	Organics	PPCPs					2013-05-28
Caffeine-13C3(Surrogate)	Surrogate: Caffeine-13C3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
CAFOs Extent	CAFOs Extent	0	none						Habitat						2019-05-07
CAFOs Intensity	CAFOs Intensity	0	none						Habitat						2019-05-07
CAFOs Proximity	CAFOs Proximity	0	none						Habitat						2019-05-07
Calcium	Calcium	7440702		ug/L	mg/Kg dw		ug/g ww	ug/g dw	Inorganics	Conventionals	Metals				2007-07-27
Calcium Bound Phosphorus	Calcium Bound Phosphorus	0			ug/g dw				Inorganics	Conventional	Nutrients				2022-03-01
Camphor	Camphor	76222			ug/Kg dw				Organics						2018-07-16
Canopy Cover	Canopy Cover	0	none						Habitat						2016-09-06
Caprolactam	Caprolactam (Azepan-2-one)	105602		ng/L					Organics	PPCPs					2026-02-10
Captafol	Captafol	2425061		ug/L					Organics	Pesticides	Fungicides				2016-10-25
Captan	Captan	133062		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
Carbadox	Carbadox	6804075		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Carbamazepine	Carbamazepine	298464		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Carbamazepine(Surrogate)	Surrogate: Carbamazepine	0					% recovery	% recovery	Organics						2017-03-06
Carbaryl	Carbaryl	63252		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides	Endocrine Disruptors		2007-07-27
Carbaryl-D7(Surrogate)	Surrogate: Carbaryl-D7	362049567		% recovery	% recovery				Organics	Pesticides	Pest-Carbamates	Insecticides			2024-07-22
Carbazole	Carbazole	86748		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2007-07-27
Carbazole(Surrogate)	Surrogate: Carbazole	86748		% recovery					Organics	Semi-VOAs					2011-10-13
Carbendazim	Carbendazim	10605217		ng/L					Organics	Pesticides	Fungicides				2016-03-10
Carbofuran	Carbofuran	1563662		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides	Nematocides		2007-07-27
Carbon Dioxide, Daily Mean	Daily Mean Carbon Dioxide (Calculated)	124389		uatm					WaterQualityMeasurements	Conventionals					2024-09-06
Carbon dioxide, free	Carbon dioxide, free	124389		mg/L											2017-04-28
Carbon Dioxide, total	Carbon Dioxide, total	124389		mg/L											2017-04-28
Carbon Disulfide	Carbon Disulfide	0		ug/L					Inorganics	Conventionals					2016-05-20
Carbon Tetrachloride	Carbon Tetrachloride	56235		ug/L					Organics	VOCs					2013-05-28
Carbon, Total	Total Carbon	7440440		mg/L	% dw		%	%	Inorganics	Conventionals					2013-05-20
Carbon-13/Carbon-12 Ratio	Carbon-13/Carbon-12 Ratio	14762744		per mil					Radiochemistry						2013-06-03
Carbon-14	Carbon-14	14762755		% modern					Radiochemistry						2013-06-06
Carbon-14 Counting Error	Carbon-14 Counting Error	0		% modern					Inorganics						2013-06-06
Carbonate	Carbonate	3812326		ug/L	mg/Kg dw				Inorganics	Conventionals					2012-09-13
Carbonate Alkalinity as CaCO3	Carbonate Alkalinity as CaCO3	471341		mg/L					Inorganics	Conventionals	WaterQualityMeasurements				1900-01-01
Carbophenothion	Carbophenothion (Trithion)	786196		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Carboxin	Carboxin (6-methyl-N-phenyl-2,3-dihydro-1,4-oxathiine-5-carboxamide)	0		ug/L											2017-01-12
Carfentrazone Ethyl	Carfentrazone Ethyl	128639021		ug/L					Organics	Pesticides					2013-06-27
Cascade/Falls	Cascade/Falls	0	%						Habitat						2009-08-20
Catellicoccus, Gull	Gull Catellicoccus	0		copies/100 mL	copies/g dw				Microbiological	Pathogens					2016-05-20
Catellicoccus, Gull (Gull2)	Gull Catellicoccus marimammalium, Assay name: Gull2, 5'-TGCATCGACCTAAAGTTTTGAG-3', 5'-GTCAAAGAGCGAGCAGTTACTA-3'	0		gc/mL					Microbiological						2023-01-27
Cattle Grazing Intensity	Cattle Grazing Intensity	0	none						Habitat						2019-05-07
Cattle GrazingExtent	Cattle GrazingExtent	0	none						Habitat						2019-05-07
Cattle GrazingProximity	Cattle GrazingProximity	0	none						Habitat						2019-05-07
CBOD5	Carbonaceous Biological Oxygen Demand (CBOD) - 5 day test	0		mg/L					WaterQualityMeasurements	Conventionals					2018-01-18
CD/DVD	CD/DVD	0	pieces						Debris	Trash	Plastics	Household			2014-11-04
CDOM	Colored Dissolved Organic Matter	0		ug/L					Habitat						2013-12-18
Cefotaxime	Cefotaxime	63527526		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Celestolide	Celestolide	0					ng/g ww	ng/g dw	Organics	Pesticides					2008-06-27
Ceramic Pot/Shard	Ceramic Pot/Shard	0	pieces						Debris	Trash	Non-Plastics	Household			2014-11-04
Cerium	Cerium	7440451		ug/L					Inorganics						2013-05-20
Cesium	Cesium	7440462			mg/Kg dw		ug/g ww	ug/g dw	Inorganics	Metals					2009-08-05
Cetirizine	Cetirizine	83881510		ng/L					Organics	PPCPs					2026-02-10
Channel Constraining Feature	Channel Constraining Feature	0	none						Habitat						2009-08-20
Channel Constraint	Channel Constraint	0	none						Habitat						2009-08-20
Channel Engineered	Channel has been modified/engineered	0	none						Habitat	FieldObservations					2016-03-02
Channel Grasses	Channel Grasses	0	%						Habitat						2019-05-07
Channel Margin in Contact	Channel Margin in Contact	0	%						Habitat						2009-08-20
Channel NonWoody Veg	Channel NonWoody Veg	0	%						Habitat						2019-05-07
Channel Pattern	Channel Pattern	0	none						Habitat						2009-08-20
Channel Unit	Channel Unit	0	none						Habitat						2009-08-20
Channel Width Reach	Channel width used to define reach	0	m						Habitat						2009-10-29
Channel Woody Veg	Channel Woody Veg	0	%						Habitat						2019-05-07
Channelization	Channelization	0	none						Habitat						2009-08-20
Chemical Group A	Total of (Aldrin,Dieldrin,Endrin,Heptachlor,Heptachlor Epoxide,Chlorine,HCH, Endosulfan,Toxaphene)	0					ug/Kg ww	ug/Kg dw	Organics	Pesticides					2014-01-28
Chemical Treatment	Chemical Treatment	0	none						Habitat						2009-08-20
Chicken/Duck, Mitochondrial DNA (cytb)	Chicken/Duck Mitochondrial DNA, Target gene: Cytochrome b, 5′-AAATCCCACCCCCTACTAAAAATAAT-3′, 5′-CAGATGAAGAAGAATGAGGCG-3′, 5′-FAM-ACAACTCCCTAATCGACCT-NFQ-MGB-3′	0		gc/mL					Microbiological	MST					2025-10-02
Chloramben	Chloramben	133904		ug/L					Organics	Herbicides					2016-05-20
Chlorantraniliprole	Chlorantraniliprole	500008457		ug/L					Organics	Pesticides	Insecticides				2016-03-10
Chlorate	Chlorate	14866683		ug/L					Inorganics	Conventionals	Nutrients				2013-05-28
Chlorbenside	Chlorbenside	0					ug/Kg ww	ug/Kg dw	Organics	Pesticides					2008-11-07
Chlordane	Chlordane, not otherwise specified	57749		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs				2007-12-14
Chlordane, cis-	cis-Chlordane (alpha-Chlordane)	5103719		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Chlordanes		2013-05-28
Chlordane, cis-(Surrogate)	Surrogate: cis-Chlordane (alpha-Chlordane)	5103719			% recovery				Organics	Pesticides					2013-05-27
Chlordane, Technical	Chlordane, mixture of many related chemicals, of which 10 are major components	12789036		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OCHs				2007-07-27
Chlordane, Total	Total Chlordane, sum of cis-chlordane and trans-chlordane	0		ug/L	ug/g dw										2019-06-11
Chlordane, trans-	trans-Chlordane (gamma-Chlordane)	5103742		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Chlordanes		2013-05-28
Chlordane, trans-(Surrogate)	Surrogate: trans-Chlordane (gamma-Chlordane)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2013-05-27
Chlordane-13C10, trans-(IsoDilAnalogue)	Isotope Dilution Analogue: trans-Chlordane-13C10 (gamma-Chlordane)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
Chlordene	Chlordene	3734483		ug/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2007-07-27
Chlordene Plus	Chlordene Plus (CP)	0			ng/g dw				Organics	FlameRetardants					2014-03-13
Chlordene, cis-	cis-Chlordene (alpha-Chlordene)	56534022		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2013-05-28
Chlordene, trans-	trans-Chlordene (gamma-Chlordene)	56641384		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2013-05-28
Chlorfenapyr	Chlorfenapyr	122453730		ug/L					Organics	Pesticides					2016-10-25
Chlorfenvinphos	Chlorfenvinphos	470906		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs				2007-07-27
Chloride	Chloride	16887006		ug/L					Inorganics	Conventionals	Nutrients				2007-07-27
Chlorimuron Ethyl	Chlorimuron Ethyl	90982324		ug/L					Organics	SVOCs					2013-05-20
Chlorine, Free	Free Chlorine	0		mg/L					WaterQualityMeasurements	Ancillary					2014-02-05
Chlorine, Total Residual	Total Residual Chlorine	0		mg/L					WaterQualityMeasurements						2007-07-27
Chlorite	Chlorite	14998277		ug/L					Inorganics	Conventionals	Nutrients				2013-05-28
Chlormefos	Chlormefos	0		% recovery											2019-12-28
Chloro-2-methylphenol, 4-	4-Chloro-2-methylphenol	1570645		ug/L					Organics	Pesticides					2017-04-20
Chloro-2-methylphenoxy) Butanoic Acid, 4-(4-	4-(4-Chloro-2-methylphenoxy) Butanoic Acid (MCPB)	94815		ug/L					Organics	SVOCs					2013-05-20
Chloro-3-methylphenol, 4-	4-Chloro-3-methylphenol	59507		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	Chlorinated Phenols	Germicides		2007-07-27
Chloroacetic Acid	Chloroacetic Acid (Monochloracetic Acid)(MCAA)	79118		ug/L					Organics	Haloacetic acids (HAAs)					2025-11-05
Chloroaniline, 4-	4-Chloroaniline	106478		ug/L	ug/Kg dw				Organics	SVOCs					2007-07-27
Chlorobenzene	Chlorobenzene	108907		ug/L					Organics	VOCs					2007-07-27
Chlorobenzene-d5(Surrogate)	Surrogate: Chlorobenzene-d5	3114554		% recovery					Organics	VOCs					2016-03-02
Chlorobenzilate	Chlorobenzilate	510156		ug/L					Organics	Pesticides					2016-10-25
Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid, 11-	11-Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid (11Cl-PF3OUdS)	763051929		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-04-04
Chloroethane	Chlorethane (Ethyl Chloride)	75003		ug/L					Organics	VOCs					2013-05-28
Chloroethyl Vinyl Ether, 2-	2-Chloroethyl Vinyl Ether	110758		ug/L					Organics	VOCs					2013-05-28
Chloroform	Chloroform	67663		ug/L					Organics	VOCs	Insecticides				2007-07-27
Chlorohexadecafluoro-3-oxanonane-1-sulfonate, 9-	9-chlorohexadecafluoro-3-oxanonane-1-sulfonate (9Cl-PF3ONS)	1621485219			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2023-11-02
Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid, 9-	9-Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid (9Cl-PF3ONS)	756426581		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-04-04
Chloromethane	Chloromethane (Methyl Chloride)	74873		ug/L					Organics	VOCs					2013-05-28
Chloro-N-(2,6-diethylphenyl) acetamide, 2-	2-chloro-N-(2,6-diethylphenyl) acetamide	6967299			ug/Kg dw				Organics	Pesticides					2017-04-10
Chloronaphthalene, 2-	2-Chloronaphthalene	91587		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2007-07-27
Chloroneb(Surrogate)	Surrogate: Chloroneb	2675776		% recovery					Organics	Pesticides	Pest-OCHs	Fungicides			2010-05-02
Chlorophenol, 2-	2-Chlorophenol	95578		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	Chlorinated Phenols			2007-07-27
Chlorophenol-d4, 2- (Surrogate)	2-Chlorophenol-d4 (Surrogate)	93951736		% recovery											2017-01-12
Chlorophenyl Phenyl Ether, 4-	4-Chlorophenyl Phenyl Ether	7005723		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2013-05-28
Chlorophenyl)-N'-methylurea, N-(4-	N-(4-Chlorophenyl)-N'-methylurea	5352885		ug/L					Organics	Herbicides					2013-05-20
Chlorophyll a	Chlorophyll a	479618		ug/L					Inorganics	Conventionals	Benthic	WaterQualityMeasurements			2011-11-10
Chlorophyll a & b	Chlorophyll a & b	0		ug/L					Inorganics	Conventionals					2016-05-20
Chlorophyll b	Chlorophyll b	0		ug/L					Inorganics	Conventionals					2016-05-20
Chlorophyll, Total	Total Chlorophyll	0		ug/L					WaterQualityMeasurements						2011-05-03
ChlorophyllSampleVolume	Volume of material and liquid filtered to produce the chlorophyll a sample	0		mL					Habitat						2009-10-29
Chloropicrin	Chloropicrin	0		ug/L					Organics	Pesticides					2017-04-04
Chlorothalonil	Chlorothalonil	1897456		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs	Algaecides	Fungicides	Nematocides	2007-07-27
Chlorotoluene, 2-	2-Chlorotoluene	95498		ug/L					Organics	VOCs					2007-07-27
Chlorotoluene, 4-	4-Chlorotoluene	106434		ug/L					Organics	VOCs					2007-07-27
Chloroxuron	Chloroxuron (Chloroxyfenidim) (Norex)	1982474		ug/L					Organics	Herbicides					2013-05-28
Chloroxuron(Surrogate)	Surrogate: Chloroxuron (Chloroxyfenidim) (Norex)	0		% recovery	% recovery				Organics	Pesticides	Herbicides				2017-02-27
Chlorpropham	Chlorpropham	101213		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Chlorpyrifos	Chlorpyrifos	2921882		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Chlorpyrifos Methyl	Chlorpyrifos Methyl	5598130		ug/L	ng/g dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2013-05-28
Chlorpyrifos Methyl(Surrogate)	Surrogate: Chlorpyrifos Methyl	5598130		% recovery					Organics	Pesticides	Pest-OPs	Insecticides			2016-03-02
Chlorpyrifos Methyl/Fenchlorphos	Chlorpyrifos Methyl/Fenchlorphos	0			ng/g dw				Organics	Pesticides					2016-05-20
Chlorpyrifos Oxon	Chlorpyrifos Oxon	5598152		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	OrganophosphatePest.	Insecticides			2013-05-29
Chlortetracycline	Chlortetracycline	57625		ug/L					Organics	PPCPs					2012-05-22
Chlorzoxazone	Chlorzoxazone	95250			ug/Kg dw										2021-03-15
Cholesterol	Cholesterol	57885			ug/Kg dw				Organics						2018-07-16
Chromium	Chromium	7440473		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals				2007-07-27
Chromium III	Chromium III (Trivalent Chromium)	16065831		ug/L					Metals						2025-08-25
Chromium VI	Chromium VI	18540299		ug/L	ug/Kg dw				Metals						2011-10-25
Chrysene	Chrysene	218019		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2007-07-27
Chrysene/Triphenylene	Chrysene/Triphenylene (CAS #EDF-359)	0			ng/g dw				Organics	PAHs					2012-05-22
Chrysene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Chrysene-d12	1719035		% recovery					Organics	PAHs	IDA				2023-11-07
Chrysene-d12(Surrogate)	Surrogate: Chrysene-d12	1719035		ug/L	ug/Kg dw		% recovery	% recovery	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2007-07-27
Chrysenes, C1-	C1-Chrysenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2010-06-21
Chrysenes, C2-	C2-Chrysenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2010-06-21
Chrysenes, C3-	C3-Chrysenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2010-06-21
Chrysenes, C4-	C4-Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs					2012-04-04
Cigarette Box/Wrapper	Cigarette Box/Wrapper	0	pieces						Debris	Trash	Plastics	Miscellaneous			2014-11-04
Cigarette Butt	Cigarette Butt	0	pieces						Debris	Trash	Plastics	Toxic			2014-11-04
Cimetidine	Cimetidine	51481619		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Cimetidine-d3(Surrogate)	Surrogate: Cimetidine-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2016-03-02
Cinerin-1	Cinerin-1	25402066		ug/L	ng/g dw				Organics	Pesticides	Pyrethrins	Insecticides			2026-05-08
Cinerin-2	Cinerin-2 (Cinerin II)	121200		ug/L	ng/g dw				Organics	Pesticides	Pyrethrins	Insecticides			2026-05-08
Ciodrin	Ciodrin (Crotoxyphos)	7700176		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Ciprofloxacin	Ciprofloxacin	85721331		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Ciprofloxacin-13C3-N15(Surrogate)	Surrogate: Ciprofloxacin-13C3-N15	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Circumference	Circumference	0	m						Habitat						2012-09-13
Clarithromycin	Clarithromycin	81103119		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Clay	Clay	0		mg/L	% ww				Inorganics	Conventionals	GrainSize				2011-09-08
Clay, Fine_WS (<0.00098 mm_Phi >10)	Fine Clay_Wentworth Scale (<0.00098 mm_Phi >10)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Clay, Medium_WS (0.00098 to <0.00195 mm_Phi 10 to >9)	Medium Clay_Wentworth Scale (0.00098 to <0.00195 mm_Phi 10 to >9)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Clay, Very Fine_WS (0.0005 to <0.00098 mm_Phi >10)	Very Fine Clay_Wentworth Scale (0.0005 to <0.00098 mm_Phi >10)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Clay, Very Very Fine_WS (<0.0005 mm_Phi >10)	Very Very Fine Clay_Wentworth Scale (<0.0005 mm_Phi >10)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Clay_AS (<0.005 mm)	Clay_ASTM Scale (<0.005 mm)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Clay_WS (<0.0039 mm_Phi >8)	Clay_Wentworth Scale (<0.0039 mm_Phi >8)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Clinafloxacin	Clinafloxacin	105956998		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Clomazone	Clomazone (Dimethazone)	81777891		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides				2013-05-30
Clonidine	Clonidine	4205907		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Clonidine-d4(Surrogate)	Surrogate: Clonidine-d4	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Clostridiales, Human (LACHNO3)	Human Clostridiales, Assay Name: LACHNO3	0		copies/100mL											2021-12-14
Clothianidin	Clothianidin	210880925		ug/L	ng/g dw				Pesticides						2012-06-21
Clothianidin-d3(Surrogate)	Surrogate: Clothianidin-d3	0		% recovery	% recovery				Organics	Pesticides					2018-08-07
Clothing, synthetic fabric	Clothing, synthetic fabric	0	pieces						Debris	Trash	Plastics	Household			2014-11-04
CloudCover	Cloud cover at the time of sampling	0	%						Habitat						2012-09-13
Cloxacillin	Cloxacillin	61723		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Cobalt	Cobalt	7440484		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals					2007-07-27
Cocaine	Cocaine	50362		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Cocaine-d3(Surrogate)	Surrogate: Cocaine-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
COD	Chemical Oxygen Demand (COD)	0		mg/L					Inorganics	Conventionals					2007-07-27
Codeine	Codeine	76573		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Codeine-d6(Surrogate)	Surrogate: Codeine-d6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Coliform, Fecal	Fecal Coliform	0		MPN/100 mL	MPN/g dw		MPN/g ww	MPN/g dw	Microbiological	Pathogens	Conventionals				2010-09-29
Coliform, Total	Total Coliform	0		MPN/100 mL	MPN/g dw		MPN/g ww	MPN/g dw	Microbiological	Pathogens	Conventionals				2010-09-29
Colloid	Colloid	0			%										2020-03-13
CollSub_PlantDead	Algae collected from dead plant (including wood) substratum	0	none						Habitat						2012-09-13
CollSub_PlantLive	Algae collected from live plant (including wood) substratum	0	none						Habitat						2012-09-13
CollSub_Rock	Algae collected from rock (including concrete and consolidated sediment) substratum	0	none						Habitat						2012-09-13
CollSub_SedSoft	Algae collected from soft sediment substratum	0	none						Habitat						2012-09-13
Color	Color	0		none	none				FieldObservations	Habitat					2009-08-20
Color, True	Color of water from which turbidity has been removed	0		CU					Inorganics	Conventionals					2012-09-13
Commercial	Commercial	0	none						Habitat						2009-08-20
Composition	Composition	0			none				FieldObservations	Habitat					2009-08-20
Computer	Computer	0	pieces						Debris	Trash	Plastics	Non-Plastics	Toxic	Large	2014-11-04
Concrete/Asphalt	Concrete/Asphalt	0	pieces						Debris	Trash	Non-Plastics	Construction			2014-11-04
Condom	Condom	0	pieces						Debris	Trash	Plastics				2022-11-02
Construction	Construction	0	none						Habitat						2008-04-02
Construction Debris	Construction debris such as brick, wood, sheetrock using Trash Protocol	0	pieces						Trash						2011-05-04
Construction Other	Construction Other	0	pieces						Debris	Trash	Non-Plastics	Construction			2014-11-04
Construction Wood/Pellets	Construction Wood/Pellets	0	pieces						Debris	Trash	Non-Plastics	Large			2014-11-04
Container, Chemical	Container, Chemical	0	pieces						Debris	Trash	Plastics	Toxic			2014-11-04
Container, Juice	Container, Juice	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
Container, Plastic	Container, Plastic	0	pieces						Debris	Trash	Plastics				2022-11-02
Container, Storage	Container, Storage	0	pieces						Debris	Trash	Plastics	Household			2014-11-04
Container, Styrofoam	Container, Styrofoam	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
Copper	Copper	7440508		ug/L	umol/g dw		ug/L	ug/L	Inorganics	TraceElements	Metals				2007-07-27
Coprostanol, beta-3-	3-beta-Coprostanol	360689			ug/Kg dw				Organics						2018-07-18
Coronene	Coronene	0		RPD	ug/Kg dw				Organics	PAHs					2014-01-28
Cotinine	Cotinine	486566		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Cotinine-d3(Surrogate)	Surrogate: Cotinine-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Cotton fiber	When cotton is obviously the top hit and cellulose is several hits down. Then we can say it is specifically Cotton. For DYED or CLEAR anthropogenic cotton only and should just be called cotton.	0							Microdebris	Anthropogenic	Natural Based	Fiber			2018-04-26
Coumaphos	Coumaphos	56724		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
CPOM	Coarse particulate organic matter	0	none						Habitat						2009-08-20
Cropland	Cropland	0	none						Habitat						2009-08-20
Crops Irrigated Extent	Crops Irrigated Extent	0	none						Habitat						2019-05-07
Crops Irrigated Intensity	Crops Irrigated Intensity	0	none						Habitat						2019-05-07
Crops Irrigated Proximity	Crops Irrigated Proximity	0	none						Habitat						2019-05-07
Crops NonIrrigated Extent	Crops NonIrrigated Extent	0	none						Habitat						2019-05-07
Crops NonIrrigated Intensity	Crops NonIrrigated Intensity	0	none						Habitat						2019-05-07
Crops NonIrrigated Proximity	Crops NonIrrigated Proximity	0	none						Habitat						2019-05-07
Cryptosporidium	Cryptosporidium	0		oocysts/L					Microbiological	Pathogens	Conventionals				2013-05-28
Cryptosporidium Oocysts Fluorescence	Cryptosporidium Oocysts Fluorescence	0		oocysts/L					Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Amorphous Structure	Cryptosporidium Oocysts/Amorphous Structure	0		oocysts/L					Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/DAPI & DIC Positive	Cryptosporidium Oocysts/DAPI & DIC Positive	0		oocysts/L					Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Empty	Cryptosporidium Oocysts/Empty	0		oocysts/L					Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Flourescence Antibody	Cryptosporidium Oocysts/Flourescence Antibody	0		oocysts/L					Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Internal Structure	Cryptosporidium Oocysts/Internal Structure	0		IFA+/100L					Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Internal Structure (One)	Cryptosporidium Oocysts/Internal Structure (One)	0		oocysts/L					Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Negative	Cryptosporidium Oocysts/Negative	0		oocysts/L					Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Positive	Cryptosporidium Oocysts/Positive	0		oocysts/L					Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Positive (Internal Staining)	Cryptosporidium Oocysts/Positive (Internal Staining)	0		oocysts/L					Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Positive (Stained Nuclei)	Cryptosporidium Oocysts/Positive (Stained Nuclei)	0		oocysts/L					Microbiological	Pathogens					2017-03-27
Cryptosporidium Oocysts/Total IFA Count	Cryptosporidium Oocysts/Total IFA Count	0		IFA+/100L					Microbiological	Pathogens					2017-03-27
Cumylphenol, 4-	4-Cumylphenol	599644			ug/Kg dw				Organics	Phenols					2018-07-16
Cup	Cup	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
Cup, Styrofoam	Cup, Styrofoam	0	pieces						Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Cup, Waxed Paper	Cup, Waxed Paper	0	pieces						Debris	Trash	Plastics	Non-Plastics	FoodService		2014-11-04
Cup/Plate, Plastic	Cups/plates, Plastic	0	pieces						Debris	Trash	Plastics				2022-11-02
Cup/Plate, Polystryene Foam	Cup/plate, Polystyrene Foam, e.g., Styrofoam	0	pieces						Debris	Trash	Plastics				2022-11-02
Cup/Plate, Waxed Paper	Cup/plate, Waxed Paper	0	pieces						Debris	Trash	Non-Plastics				2022-11-02
Cyanazine	Cyanazine	21725462		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Cyanide	Cyanide	57125		ug/L	mg/Kg dw				Inorganics	Conventionals					2007-07-27
Cyanobacteria	Potentially toxigenic (PTOX) genera of cyanobacteria	0		none											2018-12-05
Cyanobacteria, Prokaryotic DNA (16S)	Total Cyanobacteria, Prokaryotic DNA, Target gene: 16S, Proprietary primer sequences from Bend Genetics LLC	0		gc/mL					Microbiological	Cyanotoxins	Gene Marker				2026-05-27
CyanotoxinSampleVolume	Volume of material and liquid in Cyanotoxin sample	0		mL					Habitat						2012-09-13
Cyantraniliprole	Cyantraniliprole	736994631		ng/L					Organics	Pesticides	Insecticides				2016-03-10
Cyazofamid	Cyazofamid	120116883		ng/L					Organics	Pesticides	Fungicides				2016-03-10
Cycloate	Cycloate	1134232		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates				2013-07-01
Cyclohexyl-2-Benzothiazol-Amine, N-	N-Cyclohexyl-2-Benzothiazol-Amine (N-Cyclohexyl-1,3-Benzothiazol-2-Amine) (NCBA)	28291750		ng/L					Organics	Benzotriazoles and Benzothiazoles					2026-02-10
Cyfluthrin, beta-	beta-Cyfluthrin	1820573270		ug/L	ng/g dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyfluthrin, gamma-	gamma-Cyfluthrin	76703623			ng/g dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyfluthrin, total	Total Cyfluthrin	68359375		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyfluthrin-1	Cyfluthrin peak 1	68359375		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyfluthrin-2	Cyfluthrin peak 2	68359375		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyfluthrin-3	Cyfluthrin peak 3	68359375		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyfluthrin-4	Cyfluthrin peak 4	68359375		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyhalofop-butyl	Cyhalofop-butyl	122008859		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides				2016-03-10
Cyhalothrin	Cyhalothrin	68085858		ng/L	ug/Kg ww				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyhalothrin, gamma-	gamma-Cyhalothrin	76703623		ug/L	ng/g dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyhalothrin, lambda-1	lambda-Cyhalothrin, peak 1 or Warrior-1	91465086		ug/L	ug/Kg ww				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyhalothrin, lambda-2	lambda-Cyhalothrin, peak 2 or Warrior-2	91465086		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyhalothrin, Total	Total Cyhalothrin	68085858		ng/L	ng/g dw										2022-02-11
Cyhalothrin, Total lambda-	Total lambda-Cyhalothrin, sum peaks 1 & 2	91465086		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyhalothrin-d6, Total lambda-(Surrogate)	Surrogate: Total lambda-Cyhalothrin-d6	0		% recovery					Organics	Pesticides					2018-03-21
Cylindrospermopsin	Cylindrospermopsin	0		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2012-05-22
Cylindrospermopsin gene, Prokaryotic DNA (cyrA)	Cylindrospermopsin gene, Prokaryotic DNA, Target Gene: cyrA, Proprietary primer sequences from Bend Genetics LLC	0		gc/mL					Microbiological	Cyanotoxins	Gene Marker				2026-05-27
Cymene, p-	p-Cymene	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	VOCs					2014-01-28
Cymoxanil	Cymoxanil	57966957		ng/L					Organics	Pesticides	Fungicides				2016-03-10
Cypermethrin, Total	Total Cypermethrin, sum peaks 1,2,3 & 4	52315078		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cypermethrin-1	Cypermethrin peak 1	67375308		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cypermethrin-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Cypermethrin-13C6	0			% recovery				Organics	Pesticides	Instecticides	Pyrethroids	IDA		2023-10-25
Cypermethrin-13C6(Surrogate)	Surrogate: Cypermethrin-13C6	0		% recovery					Organics	Pesticides	Insecticides	Pyrethroids			2014-01-29
Cypermethrin-2	Cypermethrin peak 2	65731842		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cypermethrin-3	Cypermethrin peak 3	67375308		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cypermethrin-4	Cypermethrin peak 4	52315078		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Cyproconazole	Cyproconazole	94361065		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Cyprodinil	Cyprodinil	121552612		ug/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
d13C_VPDB	Delta 13C, relative to Vienna Pee Dee Belemnite	0					per mil	per mil	Organics	IsotopicSignature					2015-05-07
d15N_Air-N2	Delta 15N, relative to Atmospheric Nitrogen	0					per mil	per mil	Organics	IsotopicSignature					2015-05-07
d34S_VCDT	Delta 34S, relative to Vienna Canyon Diablo Troilite	0					per mil	per mil	Organics	IsotopicSignature					2015-05-07
Dacthal	Dacthal	1861321		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs				2007-07-27
Dairies Extent	Dairies Extent	0	none						Habitat						2019-05-07
Dairies Intensity	Dairies Intensity	0	none						Habitat						2019-05-07
Dairies Proximity	Dairies Proximity	0	none						Habitat						2019-05-07
Dam Extent	Dam Extent	0	none						Habitat						2019-05-07
Dam Intensity	Dam Intensity	0	none						Habitat						2019-05-07
Dam Proximity	Dam Proximity	0	none						Habitat						2019-05-07
Dams	Dams	0	none						Habitat						2009-08-20
DBCE(Surrogate)	Surrogate: Dibutylchlorendate	1770805		ug/L	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs				2007-07-27
DCBP(p,p')	p,p'-Dichlorobenzophenone (DCBP)	90982		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs				2007-07-27
DDD(o,p')	o,p'-DDD	53190		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		2007-07-27
DDD(o,p')(Surrogate)	Surrogate: o,p'-DDD	53190		% recovery	% recovery				Organics	Pesticides	OrganochlorinePesticides	Semi-VOAs	Insecticides	DDTs	2016-03-02
DDD(o,p')/PCB 118	o,p'-DDD/PCB 118	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides/PCBs					2014-01-28
DDD(p,p')	p,p'-DDD	72548		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		2007-07-27
DDD(p,p')(Surrogate)	Surrogate: p,p'-DDD	72548		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		2016-03-02
DDD-13C(p,p')(Surrogate)	Surrogate: p,p'-DDD-C13	0		% recovery					Organics	Pesticides					2018-03-04
DDD-13C12(o,p')(IsoDilAnalogue)	Isotope Dilution Analogue: o,p'-DDD-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-26
DDD-13C12(p,p')(IsoDilAnalogue)	Isotope Dilution Analogue: p,p'-DDD-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
DDD-d8(p,p')(Surrogate)	Surrogate: p,p'-DDD-d8	0					% recovery	% recovery	Organics	Pesticides					2013-05-29
DDE(o,p')	o,p'-DDE	3424826		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		2007-07-27
DDE(o,p')(Surrogate)	Surrogate: o,p'-DDE	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2010-07-14
DDE(p,p')	p,p'-DDE	72559		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		2007-07-27
DDE(p,p')(Surrogate)	Surrogate: p,p'-DDE	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2010-07-14
DDE(p,p')/PCB 087	p,p'-DDE/PCB 087	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides/PCBs					2014-01-28
DDE-13C12(o,p')(IsoDilAnalogue)	Isotope Dilution Analogue: o,p'-DDE-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
DDE-13C12(p,p')(IsoDilAnalogue)	Isotope Dilution Analogue: p,p'-DDE-13C12	201612502		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
DDMS(p,p')	p,p'-DDMS	0			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides					2011-08-22
DDMU(p,p')	p,p'-DDMU	1022226		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		2011-11-28
DDT(o,p')	o,p'-DDT	789026		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		2007-07-27
DDT(o,p')(Surrogate)	Surrogate: o,p'-DDT	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2010-07-14
DDT(p,p')	p,p'-DDT	50293		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs		2007-07-27
DDT(p,p')(Surrogate)	Surrogate: p,p'-DDT	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2010-07-14
DDT(p,p')/PCB 187	p,p'-DDT/PCB 187	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides/PCBs					2014-01-28
DDT-13C12(o,p')(IsoDilAnalogue)	Isotope Dilution Analogue: o,p'-DDT-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
DDT-13C12(p,p')(IsoDilAnalogue)	Isotope Dilution Analogue: p,p'-DDT-13C12	104215841		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
Dead Domestic Animals	Dead Domestic Animals	0	pieces						Debris	Trash	Non-Plastics	Marine Origin			2014-11-04
Debris Lines/Silt-Laden Vegetation Extent	Debris Lines/Silt-Laden Vegetation Extent	0	none						Habitat						2019-05-07
Debris Lines/Silt-Laden Vegetation Intensity	Debris Lines/Silt-Laden Vegetation Intensity	0	none						Habitat						2019-05-07
Debris Lines/Silt-Laden Vegetation Proximity	Debris Lines/Silt-Laden Vegetation Proximity	0	none						Habitat						2019-05-07
DebrisLandUse_Commercial	DebrisLandUse_Commercial	0	none						Habitat	Debris					2014-11-04
DebrisLandUse_Industrial	DebrisLandUse_Industrial	0	none						Habitat	Debris					2014-11-04
DebrisLandUse_LimitedTimeParking	DebrisLandUse_LimitedTimeParking	0	none						Habitat	Debris					2014-11-04
DebrisLandUse_OpenSpace	DebrisLandUse_OpenSpace	0	none						Habitat	Debris					2014-11-04
DebrisLandUse_Park	DebrisLandUse_Park	0	none						Habitat	Debris					2014-11-04
DebrisLandUse_ParkingLot	DebrisLandUse_ParkingLot	0	none						Habitat	Debris					2014-11-04
DebrisLandUse_Residential	DebrisLandUse_Residential	0	none						Habitat	Debris					2014-11-04
Decabromodiphenylethane	Decabromodiphenylethane (DBDPE)	84852539			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2014-03-13
Decabromodiphenylethane-13C14(IsoDilAnalogue)	Isotope Dilution Analogue: Decabromodiphenylethane-13C14 (DBDPE-13C14)	0					% recovery	% recovery	Organics	FlameRetardants	IDA				2024-10-31
Decachlorobiphenyl(Surrogate)	Surrogate: Decachlorobiphenyl	2051243		ug/L	mg/Kg dw		% recovery	% recovery	Organics	PCBs					2007-07-27
Decafluorobiphenyl(Surrogate)	Surrogate: Decafluorobiphenyl	434902		% recovery	% recovery				Organics	PAHs	SVOCs				2016-03-02
Decalin	Decalin	91178					ng/g ww	ng/g dw	Organics	VOCs					2014-01-28
Decalin, C1-	C1-Decalin	0					ng/g ww	ng/g dw	Organics	VOCs					2014-01-28
Decalin, C2-	C2-Decalin	0					ng/g ww	ng/g dw	Organics	VOCs					2014-01-28
Decalin, C3-	C3-Decalin	0					ng/g ww	ng/g dw	Organics	VOCs					2014-01-28
Decalin, C4-	C4-Decalin	0					ng/g ww	ng/g dw	Organics	VOCs					2014-01-28
Decamethylcyclopentasiloxane	Decamethylcyclopentasiloxane	541026			ug/Kg dw										2021-05-19
Decane, 2-phenyl-	2-Phenyl-decane	0			ng/g dw				Organics	VOCs					2016-05-20
Decane, 3-phenyl-	3-Phenyl-decane	0			ng/g dw				Organics	VOCs					2016-05-20
Decane, 4-phenyl-	4-Phenyl-decane	0			ng/g dw				Organics	VOCs					2016-05-20
Decane, 5-phenyl-	5-Phenyl-decane	0			ng/g dw				Organics	VOCs					2016-05-20
Decane, n-	n-Decane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes					2014-01-28
Dechlorane 601	Dechlorane 601	0			ng/g dw				Organics	FlameRetardants					2014-03-13
Dechlorane 602	Dechlorane 602	31107445			ng/g dw				Organics	FlameRetardants					2014-03-13
Dechlorane 603	Dechlorane 603	0			ng/g dw				Organics	FlameRetardants					2014-03-13
Dechlorane 604	Dechlorane 604	0			ng/g dw				Organics	FlameRetardants					2014-03-13
Dechlorane 604 Component B	Dechlorane 604 Component B	0			ng/g dw				Organics	FlameRetardants					2014-03-13
Dechlorane Plus Mono Adduct	Dechlorane Plus Mono Adduct (DPMA)	0			ng/g dw				Organics	FlameRetardants					2014-03-13
Dechlorane Plus, anti-	anti-Dechlorane Plus (anti-DP)	135821748			ng/g dw				Organics	FlameRetardants					2025-08-25
Dechlorane Plus, syn-	syn-Dechlorane Plus (syn-DP)	135821033			ng/g dw				Organics	FlameRetardants					2025-08-25
Dehydronifedipine	Dehydronifedipine	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Deisopropyl-Atrazine	Deisopropyl-Atrazine	1007289		ug/L					Organics	Triazines					2009-02-18
Delta 13C	Delta 13C	0					ppt	ppt	Organics	Statistic					2014-01-28
Delta 15N	Delta 15N	0					ppt	ppt	Organics	Statistic					2014-01-28
Delta 15N - baseline corrected	Delta 15N - baseline corrected	0					ppt	ppt	Organics	Statistic					2014-01-28
Deltamethrin	Deltamethrin	52918635		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Deltamethrin/Tralomethrin	Deltamethrin/Tralomethrin	0		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Deltamethrin-d6, Total(Surrogate)	Surrogate: Total Deltamethrin-d6	0		% recovery	% recovery										2021-08-20
Demeton, Total	Total Demeton	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Ops				2010-05-18
Demeton-O	Demeton-O	298033		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides					2016-05-20
Demeton-s	Demeton-s	126750		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Density	Density of Sample	0		sigma-t					Habitat						2007-07-27
Deposits	Deposits	0	none						Habitat						2014-04-17
Desethyl-Atrazine	Desethyl-Atrazine	6190654		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	Pest-Triazines				2009-01-12
Desethyl-desisopropyl-atrazine	Desethyl-desisopropyl-atrazine	3397624		ug/L					Organics	Pesticides	Pest-Triazines				2013-05-20
Desisopropyl-Atrazine	Desisopropyl-Atrazine	1007289		ug/L					Organics	Pesticides	Pest-Triazines				2009-01-12
Desmethyldiltiazem	Desmethyldiltiazem	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Desmethyl-LR	Desmethyl-LR	120011667		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2012-05-22
Desmethyl-RR	Desmethyl-RR	0		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2012-05-22
Desmetryn	Desmetryn	1014693		ug/L					Organics	Pesticides	Pest-Triazines				2009-01-12
Desthio-prothioconazole	Desthio-prothioconazole	120983644		ng/L					Organics	Pesticides	Fungicides				2016-03-10
Detergent	Detergent	0		mg/L					FieldObservations						2015-06-26
Deuterium/Hydrogen Ratio	Deuterium/Hydrogen Ratio	7782390		per mil					Isotopes						2013-05-20
Di(2-ethylhexyl) phosphate	Di(2-ethylhexyl) phosphate (DEHP)	298077			ng/g dw				Organics	FlameRetardants					2014-03-13
Diaminochlorotriazine (DACT)	Diaminochlorotriazine (DACT)	0		ug/L					Organics	Pesticides					2017-04-20
Diazepam	Diazepam	439145		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Diazepam-d5(Surrogate)	Surrogate: Diazepam-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Diazinon	Diazinon	333415		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OPs				2007-07-27
Diazinon oxon	Diazinon oxon	0		ng/L					Organics	Pesticides					2018-03-04
Diazinon(Surrogate)	Surrogate: Diazinon	0		% recovery					Organics	Pesticides	OrganophosphatePest.	OrganochlorinePesticides			2011-04-07
Diazinon-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Diazinon-d10	100155473					% recovery	% recovery	Organics	Pest-OPs	IDA				2023-10-27
Diazinon-d10(Surrogate)	Surrogate: Diazinon-d10	100155473		% recovery	% recovery				Organics	SVOC	Insecticide				2023-08-17
Diazoxon	Diazoxon	962583		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	OrganophosphatePest.	OrganochlorinePesticides			2011-07-15
Dibenz(a,h)anthracene	Dibenz(a,h)anthracene	53703		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH			2013-05-28
Dibenz(a,h)anthracene, C1-	C1-Dibenz(a,h)anthracene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Dibenz(a,h)anthracene, C2-	C2-Dibenz(a,h)anthracene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Dibenz(a,h)anthracene, C3-	C3-Dibenz(a,h)anthracene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Dibenz(a,h)anthracene-d14(IsoDilAnalogue)	Isotope Dilution Analogue: Dibenz(a,h)anthracene-d14	13250981		% recovery					Organics	PAHs	IDA				2023-11-14
Dibenz(a,h)anthracene-d14(Surrogate)	Surrogate: Dibenz(a,h)anthracene-d14	13250981		% recovery	% recovery		% recovery	% recovery	Organics	PAHs					2025-09-04
Dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene	Dibenzo(a,h)anthracene/indeno(1,2,3-cd)pyrene	0			ng/g dw										2019-04-23
Dibenzofuran	Dibenzofuran	132649		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Insecticides				2007-07-27
Dibenzothiophene	Dibenzothiophene	132650		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs				2007-07-27
Dibenzothiophene-d8(IsoDilAnalogue)	Isotope Dilution Analogue: Dibenzothiophene-d8	33262292		% recovery					Organics	PAHs	IDA				2023-11-07
Dibenzothiophene-d8(Surrogate)	Surrogate: Dibenzothiophene-d8	33262292		% recovery	% recovery		% recovery	% recovery	Organics	PAHs	SVOCs				2007-07-27
Dibenzothiophenes, C1-	C1-Dibenzothiophenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs				2010-06-21
Dibenzothiophenes, C2-	C2-Dibenzothiophenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs				2010-06-21
Dibenzothiophenes, C3-	C3-Dibenzothiophenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs				2010-06-21
Dibenzothiophenes, C4-	C4-Dibenzothiophenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Alkylated PAHs				2018-07-24
Dibromo-2,3-dichlorophenyl-hexachloro-norbornene, 4,6-	4,6-Dibromo-2,3-dichlorophenyl-hexachloro-norbornene (Br2Cl2-DEC604)	0			ng/g dw				Organics	FlameRetardants					2015-07-16
Dibromo-3-Chloropropane, 1,2-	1,2-Dibromo-3-Chloropropane (DBCP)	96128		ug/L					Organics	VOCs					2013-05-28
Dibromo-4-(1,2-dibromoethyl)cyclohexane, alpha-1,2-	alpha-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (alpha-DBE-DBCH)	3322938			ng/g dw				Organics	FlameRetardants					2015-07-16
Dibromo-4-(1,2-dibromoethyl)cyclohexane, beta-1,2-	beta-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (beta-DBE-DBCH)	3322938			ng/g dw				Organics	FlameRetardants					2015-07-16
Dibromo-4-(1,2-dibromoethyl)cyclohexane, gamma-1,2-	gamma-1,2-Dibromo-4-(1,2-dibromoethyl)cyclohexane (gamma-DBE-DBCH)	3322938			ng/g dw				Organics	FlameRetardants					2015-07-16
Dibromo-4-hydroxybenzonitrile, 3,5-	3,5-Dibromo-4-hydroxybenzonitrile (Bromoxynil)	1689845		ug/L					Organics	SVOCs					2013-05-20
Dibromoacetic Acid	Dibromoacetic Acid (DBAA)	631641		ug/L					Organics	Haloacetic acids (HAAs)					2025-11-05
Dibromoaldrin	Dibromoaldrin (DBALD)	0			ng/g dw				Organics	FlameRetardants					2015-07-16
Dibromochloromethane	Dibromochloromethane	124481		ug/L					Organics	VOCs					2007-07-27
Dibromoethane, 1,2-	1,2-Dibromoethane	106934		ug/L					Organics	VOCs	Insecticides				2007-07-27
Dibromofluoromethane	Dibromofluoromethane	1868537		ug/L					Organics	VOCs					2025-08-25
Dibromofluoromethane(Surrogate)	Surrogate: Dibromofluoromethane	186857		% recovery					Organics	VOCs					2007-07-27
Dibromomethane	Dibromomethane	74953		ug/L					Organics	VOCs					2007-07-27
Dibromooctafluorobiphenyl(Surrogate)	Surrogate: Dibromooctafluorobiphenyl	10386842			% recovery		% recovery	% recovery	Organics	Pesticides	OrganochlorinePesticides				2013-05-30
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)	Surrogate: 4,4'-Dibromooctafluorobiphenyl (DBOFB)	10386842		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs				2016-03-02
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)DB-608	Surrogate: 4,4’-Dibromooctafluorobiphenyl run on column DB-608	10386842		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs				2016-03-02
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)HP-5	Surrogate: 4,4’-Dibromooctafluorobiphenyl run on column HP-5	10386842		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs				2016-03-02
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)	Surrogate: 4-4' Dibromooctafluorobiphenyl (DBOFB)	10386800		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs				2013-05-28
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)DB-608	Surrogate: 4,4’-dibromooctafluorobiphenyl run on column DB-608	10386800		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs				2013-05-28
Dibromooctafluorobiphenyl, 4-4'-(Surrogate)HP-5	Surrogate: 4,4’-dibromooctafluorobiphenyl run on column HP-5	10386800		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs				2013-05-28
Dibromophenyl-hexachloro-norbornene	Dibromophenyl-hexachloro-norbornene (Br2-DEC604)	0			ng/g dw				Organics	FlameRetardants					2015-07-16
Dibromopropane, 1,2-(Surrogate)	Surrogate: 1,2-Dibromopropane	78751		% recovery					Organics						2021-10-19
Dibutyl phosphate	Dibutyl phosphate (DBP)	107664			ng/g dw				Organics	FlameRetardants					2014-03-13
Dibutylchlorendate	Dibutylchlorendate	0					% recovery	% recovery	Organics	Pesticides					2011-05-11
Dibutylchlorendate(Surrogate)	Surrogate: Dibutylchlorendate (DBCE)	1770805		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2026-05-08
Dibutyltin as Sn	Dibutyltin as Sn (DBT)	1191486		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Organotins	Biocide				2025-08-25
Dicamba	Dicamba (2,5-Dichloro-6-methoxybenzoic Acid)	1918009		ug/L	ug/kg				Organics	Herbicides					2013-05-28
Dichlofenthion	Dichlofenthion	97176		ug/L	ng/g dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides		2007-07-27
Dichlofenthion(Surrogate)	Surrogate: Dichlofenthion	97176		% recovery	% recovery				Organics	Pesticides					2015-08-21
Dichlone	Dichlone	117806		ug/L					Organics	Pesticides	Fungicides				2016-10-25
Dichloran	Dichloran (Botran) (Benzenamine, 2,6-dichloro-4-nitro-)	99309		ug/L	ug/Kg ww				Pyrethroid Pesticides						2015-07-02
Dichloro-2 butene, cis 1,4-	Cis-1,4-dichloro-2 butene	0		ug/L					Organics						2018-02-13
Dichloro-2 butene, trans 1,4-	Trans-1,4-dichloro-2 butene	110576		ug/L											2016-07-29
Dichloroacetate(Surrogate)	Surrogate: Dichloroacetate	13425804		% recovery					Organics	Acids					2025-08-25
Dichloroacetic Acid	Dichloroacetic Acid (DCAA)	79436		ug/L					Organics	Haloacetic acids (HAAs)					2025-11-05
Dichloroaniline, 3,4-	3,4-Dichloroaniline	0		ug/L											2019-01-23
Dichloroaniline, 3,5-	3,5-Dichloroaniline	626437		ng/L	ug/Kg dw				Organics	Pesticides					2016-03-10
Dichlorobenzenamine, 3,4-	3,4-Dichlorobenzenamine (3,4-DCA)	95761		ug/L	ug/Kg dw				Pesticides						2013-05-31
Dichlorobenzene, 1,2-	1,2-Dichlorobenzene	95501		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs	SVOCs	Herbicides			2007-07-27
Dichlorobenzene, 1,3-	1,3-Dichlorobenzene	541731		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs	SVOCs	Insecticides			2007-07-27
Dichlorobenzene, 1,4-	1,4-Dichlorobenzene	106467		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs	SVOCs	Insecticides			2007-07-27
Dichlorobenzene-13C6,1,4-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,4-Dichlorobenzene-13C6	201595597			% recovery		% recovery	% recovery							2024-01-19
Dichlorobenzene-d4, 1,2-(Surrogate)	Surrogate: 1,2-Dichlorobenzene-d4	2199691		ug/L					Organics	VOCs					2016-05-20
Dichlorobenzene-d4, 1,4-(Surrogate)	Surrogate: 1,4-Dichlorobenzene-d4	3855821		% recovery	% recovery		% recovery	% recovery	Organics	VOCs	SVOCs	Insecticides			2013-05-28
Dichlorobenzidine, 3,3'-	3,3'-Dichlorobenzidine	91941		ug/L	ug/Kg dw				Organics	Semi-VOAs					2011-05-11
Dichlorobenzoic Acid, 3,5-	3,5-Dichlorobenzoic Acid	51365		ug/L					Organics	VOCs					2016-05-20
Dichlorobenzonitrile, 2,6-	2,6-Dichlorobenzonitrile (Dichlobenil)	1194656		ug/L					Organics	Pesticides	Herbicides				2016-10-25
Dichlorobenzophenone(p,p')	p,p'-Dichlorobenzophenone	0					ug/Kg ww	ug/Kg dw	Organics	Pesticides					2014-01-28
Dichlorodifluoromethane	Dichlorodifluoromethane	75718		ug/L					Organics	VOCs					2007-07-27
Dichloroethane, 1,1-	1,1-Dichloroethane	75343		ug/L					Organics	VOCs					2007-07-27
Dichloroethane, 1,2-	1,2-Dichloroethane	107062		ug/L					Organics	VOCs		Insecticides			2007-07-27
Dichloroethane-d4, 1,2-(Surrogate)	Surrogate: 1,2-Dichloroethane-d4	17060070		ug/L					Organics	VOCs					2007-07-27
Dichloroethylene, 1,1-	1,1-Dichloroethylene (1,1-Dichloroethene)	75354		ug/L					Organics	VOCs					2013-05-28
Dichloroethylene, cis 1,2-	cis-1,2-Dichloroethylene (cis-1,2-Dichloroethene)	156592		ug/L					Organics	VOCs					2013-05-28
Dichloroethylene, Total 1,2-	Total 1,2-Dichloroethylene	0		ug/L					Organics	VOCs					2017-03-29
Dichloroethylene, trans 1,2-	trans-1,2-Dichloroethylene (trans-1,2-Dichloroethene)	156605		ug/L					Organics	VOCs					2013-05-28
Dichlorophenol, 2,4-	2,4-Dichlorophenol	120832		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	Chlorinated Phenols			2007-07-27
Dichlorophenol, 2,6-	2,6-Dichlorophenol	87650		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	Chlorinated Phenols			2016-08-19
Dichlorophenoxyacetic Acid, 2,3-(Surrogate)	Surrogate: 2,3-Dichlorophenoxyacetic Acid (2,3-D)	2976741		% recovery					Organics	VOCs					2016-05-20
Dichlorophenoxyacetic Acid, 2,4-	2,4-Dichlorophenoxyacetic Acid (2,4-D)	94757		ug/L	ug/Kg dw				Organics	Herbicides					2013-05-28
Dichlorophenoxyacetic Acid, 2,4-(Surrogate)	Surrogate: 2,4-Dichlorophenoxyacetic Acid (2,4-D)	94757		ug/L					Organics	VOCs					2016-05-20
Dichlorophenoxybutyric Acid Methyl Ester, 2,4-	2,4-Dichlorophenoxybutyric Acid Methyl Ester (2,4-DB Methyl Ester)	0		ug/L					Organics	Herbicides					2013-05-20
Dichlorophenoxybutyric Acid, 2,4-	2,4-Dichlorophenoxybutyric Acid (2,4-DB)	94826		ug/L	ug/kg				Organics	Herbicides					2013-05-28
Dichlorophenyl Urea, 3,4-	3,4-Dichlorophenyl Urea (DCPU)	2327028		ug/L					Pesticides						2013-05-31
Dichlorophenyl-3-methyl Urea, 3,4-	3,4-Dichlorophenyl-3-methyl Urea (DCPMU)	3567622		ug/L					Pesticides						2013-05-31
Dichlorophenylacetic Acid, 2,4-	2,4-Dichlorophenylacetic Acid	19719289		% recovery					Organics	Herbicides					2016-05-20
Dichlorophenylacetic Acid, 2,4- (Surrogate)	Surrogate: 2,4-Dichlorophenylacetic Acid	19719289		ug/L	% recovery				Organics	Herbicides					2013-05-28
Dichloroprop	Dichlorprop (2-(2,4-Dichlorophenoxy)propanoic Acid)	120365		ug/L	ug/kg				Organics	Herbicides					2013-05-28
Dichloropropane, 1,2-	1,2-Dichloropropane	78875		ug/L					Organics	VOCs	Insecticides	Nematocides			2007-07-27
Dichloropropane, 1,3-	1,3-Dichloropropane	142289		ug/L					Organics	VOCs					2007-07-27
Dichloropropane, 2,2-	2,2-Dichloropropane	594207		ug/L					Organics	VOCs					2007-07-27
Dichloropropene, 1,1-	1,1-Dichloropropene	563586		ug/L					Organics	VOCs					2007-07-27
Dichloropropene, 1,3-	1,3-Dichloropropene	0		ug/L	ng/g dw										2016-12-23
Dichloropropene, cis 1,3-	cis-1,3-Dichloropropene	10061015		ug/L					Organics	VOCs					2007-07-27
Dichloropropene, Total 1,3-	Total 1,3-Dichloropropene	0		ug/L					Organics	VOCs					2016-05-20
Dichloropropene, trans 1,3-	trans-1,3-Dichloropropene	10061026		ug/L					Organics	VOCs					2007-07-27
Dichloropropionic Acid, 2,2-	2,2-Dichloropropionic Acid (Dalapon)	75990		ug/L	ug/kg				Organics	Herbicides					2013-05-28
Dichloro-pyridine-2-carboxylic Acid, 3,6-	3,6-Dichloro-pyridine-2-carboxylic Acid (Clopyralid)	1702176		ug/L					Organics	Herbicides					2013-05-28
Dichlorotrifluoroethane	Dichlorotrifluoroethane (Freon 123)	306832		ug/L					Organics	VOCs					2017-04-12
Dichlorotrifluoromethane	Dichlorotrifluoromethane	0		ug/L					Organics	VOCs					2016-01-26
Dichlorvos	Dichlorvos	62737		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Dichrotophos	Dichrotophos	0		ug/L					Organics	Pesticides					2016-05-20
Diclofenac	Diclofenac (2-(2-(2,6-Dichlorophenylamino)phenyl)acetic Acid)	15307865		ng/L					Organics	PPCPs					2013-05-27
Dicofol	Dicofol	115322		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs				2007-07-27
Dicrotophos	Dicrotophos	141662		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Dicyclohexylurea, 1,3-	1,3-Dicyclohexylurea (N,N'-Dicyclohexylurea)	2387237		ng/L					Organics	Tire- and Vehicle-derived Contaminants					2026-02-10
Di-dechlorinated Dechlorane Plus	Di-dechlorinated Dechlorane Plus (C10-DP)	0			ng/g dw				Organics	FlameRetardants					2014-03-13
Dieldrin	Dieldrin	60571		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors		2007-07-27
Dieldrin(Surrogate)	Surrogate: Dieldrin	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2008-11-17
Dieldrin-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Dieldrin-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-03
Diesel Fuel	Diesel Fuel	0		ug/L					Organics						2015-06-25
Diethatyl-Ethyl	Diethatyl-Ethyl	38727558		ug/L	ng/g dw				Organics	Pesticides	Herbicides				2007-07-27
Diethyl Phosphate	Diethyl Phosphate (DEP)	598027			ng/g dw				Organics	FlameRetardants					2015-07-16
Diethyl phthalate	Diethyl phthalate	84662		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2007-07-27
Diethyl-3-methyl-benzamide, N,N-	N,N-Diethyl-3-methyl-benzamide	134623		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Diethyl-3-methyl-benzamide-d7, N,N-(Surrogate)	Surrogate: N,N-Diethyl-3-methyl-benzamide-d7	0			% recovery		% recovery	% recovery	Organics	PPCPs					2016-10-31
Diethylstilbestrol	Diethylstilbestrol	0		ng/L			ug/Kg ww	ug/Kg dw	Organics	PPCPs					2014-01-28
Difenoconazole	Difenoconazole	119446683		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Diflubenzuron	Diflubenzuron (Difluron)	35367385		ug/L					Organics	Pesticides					2013-06-27
Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether, 5,6-(Surrogate)	Surrogate: 5,6-Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether	886748330		% recovery	% recovery		% recovery	% recovery	Organics	PBDEs					2013-05-28
Difluoro-2,2’,3,3’,4,5,5’,6’-Octabromodiphenyl Ether 4’,6-(Surrogate)	Surrogate: 4’,6-Difluoro-2,2’,3,3’,4,5,5’,6’-Octabromodiphenyl Ether	0			% recovery				Organics	PBDEs					2013-05-28
Digoxigenin	Digoxigenin	1672464		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Digoxin	Digoxin	20830755		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Diisopropyl Ether	Diisopropyl Ether	108203		ug/L					Organics	SVOCs					2013-05-20
Dike/Levee Extent	Dike/Levee Extent	0	none						Habitat						2019-05-07
Dike/Levee Intensity	Dike/Levee Intensity	0	none						Habitat						2019-05-07
Dike/Levee Proximity	Dike/Levee Proximity	0	none						Habitat						2019-05-07
Diltiazem	Diltiazem	42399417		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Dimethipin	Dimethipin	55290647		ug/L											2023-08-15
Dimethoate	Dimethoate	60515		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides		2007-07-27
Dimethomorph	Dimethomorph	110488705		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Dimethyl phosphate	Dimethyl Phosphate (DMP)	813785			ng/g dw				Organics	FlameRetardants					2015-07-16
Dimethyl phthalate	Dimethyl phthalate	131113		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2007-07-27
Dimethyl-2-nitrobenzene, 1,3-	1,3-Dimethyl-2-nitrobenzene	81209		ug/L					Organics						2011-10-25
Dimethyl-2-nitrobenzene, 1,3-(Surrogate)	Surrogate: 1,3-Dimethyl-2-nitrobenzene (2,6-Dimethylnitrobenzene)	81209		ug/L	% recovery				Organics	VOCs					2016-03-02
Dimethylarsinic Acid	Dimethylarsinic Acid	0					ug/g ww	ug/g dw	Organics	Herbicides					2014-01-28
Dimethylchrysene, 5,9-	5,9-Dimethylchrysene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Dimethyldibenzothiophene, 2,4-	2,4-Dimethyldibenzothiophene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Dimethyldibenzothiophene, 4,6-	4,6-Dimethyldibenzothiophene	1207121		ng/L					Organics	PAHs					2024-03-13
Dimethylfluorene, 1,7-	1,7-Dimethylfluorene	442660		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Semi-VOAs				2010-07-08
Dimethylnaphthalene, 1,2-	1,2-Dimethylnaphthalene	573988		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Semi-VOAs				2010-07-08
Dimethylnaphthalene, 2,6-	2,6-Dimethylnaphthalene	581420		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Dimethylnaphthalene, 2,6-(Surrogate)	Surrogate: 2,6-Dimethylnaphthalene	0		% recovery	% recovery		% recovery	% recovery	Organics	PAHs					2014-01-28
Dimethylnaphthalene-d12, 2,6-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,6-Dimethylnaphthalene-d12	350820121		% recovery					Organics	PAHs	IDA				2023-11-14
Dimethylnaphthalene-d12, 2,6-(Surrogate)	Surrogate: 2,6-Dimethylnaphthalene-d12	350820121		% recovery	% recovery		% recovery	% recovery	Organics	PAHs					2025-08-25
Dimethylphenanthrene, 1,5/1,7-	1,5-Dimethylphenanthrene/1,7-Dimethylphenanthrene	0		ng/L					Organics	PAHs					2014-01-28
Dimethylphenanthrene, 1,7-	1,7-Dimethylphenanthrene	483874		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs					2010-09-23
Dimethylphenanthrene, 1,8-	1,8-Dimethylphenanthrene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	LMW_PAH				2018-07-24
Dimethylphenanthrene, 2,6-	2,6-Dimethylphenanthrene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	LMW_PAH				2018-07-24
Dimethylphenanthrene, 3,6-	3,6-Dimethylphenanthrene	1576676		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Dimethylphenol, 2,4-	2,4-Dimethylphenol	105679		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	non-Chlorinated Phenols			2007-07-27
Dimethylxanthine, 1,7-	1,7-Dimethylxanthine	611596		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Di-n-butyl Phthalate	Di-n-butyl Phthalate	84742		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs	Endocrine Disruptors				2013-05-28
Di-n-butyl Phthalate-d4(Surrogate)	Surrogate: Di-n-butyl Phthalate-d4	0		% recovery					Organics	SVOCs					2014-01-29
Dinitro-2-methylphenol, 4,6-	4,6-Dinitro-2-methylphenol	534521		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols		2007-07-27
Dinitrophenol, 2,4-	2,4-Dinitrophenol	51285		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols		2007-07-27
Dinitrotoluene, 2,4-	2,4-Dinitrotoluene	121142		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2007-07-27
Dinitrotoluene, 2,6-	2,6-Dinitrotoluene	606202		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2007-07-27
Di-n-octyl Phthalate	Di-n-octyl Phthalate	117840		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2013-05-28
Dinonyl-Diphenylamine	Dinonyl-Diphenylamine (ar-Nonyl-N-(Nonylphenyl)-Benzenamine) (SDPA-C9C9)	36878203		ng/L					Organics	Substituted Diphenylamines (SDPAs)					2026-02-10
Dinoseb	Dinoseb (2,4-Dinitro-6-sec-butylphenol)	88857		ug/L	ug/kg				Organics	Herbicides					2013-07-01
Dinotefuran	Dinotefuran	165252700		ug/L	ng/g dw				Organics	Pesticides	Insecticides				2016-03-10
Dinotefuran-d3(Surrogate)	Surrogate: Dinotefuran-d3	0		% recovery					Organics	Pesticides	Insecticides	Neonicotinoids			2025-12-15
Di-n-propylnitrosamine	Di-n-propylnitrosamine	0					ug/Kg ww	ug/Kg dw	Organics	SVOCs					2014-01-29
Dioctyl-Diphenylamine, 4,4'-	4,4'-Dioctyl-Diphenylamine (SDPA-C8C8)	101677		ng/L					Organics	Substituted Diphenylamines (SDPAs)					2026-02-10
Dioxa-3H-Perfluorononanoic Acid, 4,8-	4,8-Dioxa-3H-Perfluorononanoic Acid (ADONA)	919005144		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-04-04
Dioxane, 1,4-	1,4-Dioxane	0		ug/L											2016-12-23
Dioxathion	Dioxathion	78342		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2025-08-25
Diphenamid	Diphenamid	957517		ug/L					Organics	Pesticides	Herbicides				2007-07-27
Diphenamid(Surrogate)	Surrogate: Diphenamid	957517		% recovery					Organics	Pesticides					2016-03-02
Diphenhydramine	Diphenhydramine	58731		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Diphenyl Ether	Diphenyl Ether	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	VOCs					2014-02-05
Diphenyl phosphate	Diphenyl phosphate (DPP)	838857			ng/g dw				Organics	FlameRetardants					2014-03-13
Diphenylamine	Diphenylamine	122394		ug/L			ug/Kg ww	ug/Kg dw	Organics	Pesticides					2014-01-28
Diphenylanthracene, 9,10-	9,10-Diphenylanthracene	0			ng/g dw										2019-06-11
Diphenylguanidine,1,3-	1,3-diphenylguanidine	102067		ng/L					Organics	Amidines					2019-12-11
Diphenylhydrazine, 1,2-	1,2-Diphenylhydrazine	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	PPCPs					2014-01-28
Diphenylphthalate(Surrogate)	Surrogate: Diphenylphthalate	0					% recovery	% recovery	Organics	VOCs					2014-02-05
Dipropetryn	Dipropetryn	4147517		ug/L					Organics	Pesticides	Pest-Triazines				2009-01-12
Diquat	Diquat	85007		ug/L	ug/Kg dw				Organics	Pesticides					2008-11-17
Direct Septic/Sewage Discharge Extent	Direct Septic/Sewage Discharge Extent	0	none						Habitat						2019-05-07
Direct Septic/Sewage Discharge Intensity	Direct Septic/Sewage Discharge Intensity	0	none						Habitat						2019-05-07
Direct Septic/Sewage Discharge Proximity	Direct Septic/Sewage Discharge Proximity	0	none						Habitat						2019-05-07
Discharge	Discharge from a calculation	0		MGD					WaterQualityMeasurements						2007-07-27
Discharge Direct Measurement	Discharge Direct Measurement	0		cfs					WaterQualityMeasurements	Ancillary					2014-02-05
DischargeMeasurementMethod	Method used to collect discharge (velocity) measurement	0	none						WaterQualityMeasurements						2012-05-22
DischargeMeasurementRating	Code qualifying the stream discharge measurement quality in relation to the actual flow	0	none						WaterQualityMeasurements						2012-05-22
Dissolved Inorganic Carbon	Dissolved Inorganic Carbon (DIC)	7440440		mg/L					Inorganics	Conventionals					2016-05-20
Dissolved Organic Carbon	Dissolved Organic Carbon (DOC)	0		ug/L					Inorganics	Conventionals					2007-07-27
Distance from Bank	Distance from Bank	0	m						Habitat						2009-08-20
Distance to Bankfull	Distance from the wetted edge to the Bankfull mark	0	m						Habitat						2012-09-13
Distance, Float	Float distance of observed object	0	m						Habitat						2009-08-20
Distance, Sampled	Distance sampled within a given waterbody	0	m						Habitat						2012-09-13
Disulfoton	Disulfoton	298044		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Disulfoton Sulfone	Disulfoton Sulfone	0		pg/L			ug/Kg ww	ug/Kg dw	Organics	Pesticides					2014-01-28
Ditches/Canals Extent	Ditches/Canals Extent	0	none						Habitat						2019-05-07
Ditches/Canals Intensity	Ditches/Canals Intensity	0	none						Habitat						2019-05-07
Ditches/Canals Proximity	Ditches/Canals Proximity	0	none						Habitat						2019-05-07
Dithiopyr	Dithiopyr	97886458		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides				2016-03-10
Diuron	Diuron	330541		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Diuron-d6(Surrogate)	Surrogate: Diuron-d6	1007536675		% recovery					Organics	Pesticides	Pest-Carbamates	Herbicides			2021-10-19
Docohexaenoic Acid	Docohexaenoic Acid	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid					2016-05-20
Docosahexaenoic Acid	Docosahexaenoic Acid	6217545					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid					2012-09-12
Docosane, n-	n-Docosane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes					2014-01-28
Docosapentaenoic Acid	Docosapentaenoic Acid	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid					2013-05-28
Dodecamethylcyclohexasiloxane	Dodecamethylcyclohexasiloxane	540976			ug/Kg dw										2021-05-19
Dodecane, 2-phenyl-	2-Phenyl-dodecane	0			ng/g dw				Organics	VOCs					2016-05-20
Dodecane, 3-phenyl-	3-Phenyl-dodecane	0			ng/g dw				Organics	VOCs					2016-05-20
Dodecane, 4-phenyl-	4-Phenyl-dodecane	0			ng/g dw				Organics	VOCs					2016-05-20
Dodecane, 5-phenyl-	5-Phenyl-dodecane	0			ng/g dw				Organics	VOCs					2016-05-20
Dodecane, 6-phenyl-	6-Phenyl-dodecane	0			ng/g dw				Organics	VOCs					2016-05-20
Dodecane, n-	n-Dodecane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes					2014-01-28
Dodine	Dodine	0		ug/L					Organics	Pesticides	Fungicides				2017-04-04
Dog_DG37	Dog_DG37	0		copies/100mL					Microbiological						2018-03-07
Dominant Benthic Substrate	Dominant Benthic Substrate - Specific to EMAP BA	0	none						Habitat						2009-08-20
Dominant Land Use	Dominant Land Use	0	none						Habitat						2009-08-20
DominantSubstrate	DominantSubstrate	0	none						FieldObservations	Habitat					2009-08-20
Domoic Acid	Domoic Acid	14277975		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2013-05-28
Dotriacontane, n-	n-Dotriacontane	544854					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Doxycycline	Doxycycline	564250		ug/L					Organics	PPCPs					2012-05-22
Dredging	Dredging	0	none						Habitat						2009-08-20
Dry	Dry	0	none						Habitat						2009-08-20
Dry Weight	Dry Weight	0			g		g ww	g dw	Tissue	Ancillary					2014-02-05
Dry Weight Standard Error	Dry Weight Standard Error	0					g ww	g dw	Tissue	Ancillary					2014-02-05
Dumping	Dumping using Trash Protocol	0	score						Trash						2011-05-04
E. coli	Escherichia coli	0		MPN/g dw	MPN/g dw		MPN/100 mL	MPN/100 mL	Microbiological	Pathogens	Conventionals				2007-07-27
E. Coli O157:H7	Escherichia Coli O157:H7 strain	0		none	none				Microbiological	Pathogens	Conventionals				2013-05-28
Eicosane, n-	n-Eicosane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes					2014-01-28
Eicosapentaenoate	Eicosapentaenoate	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid					2012-09-12
ElectricalConductivity	Electrical Conductivity	0		uS/cm					WaterQualityMeasurements	Conventionals					2007-07-27
Elevation Difference	Elevation Difference	0	cm						Habitat						2009-08-20
Embeddedness	Embeddedness	0	%						Habitat						2009-08-20
Enalapril	Enalapril	75847733		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Enalapril-d5(Surrogate)	Surrogate: Enalapril-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
End Time	Time (hh:mm) when a given event ended	0	none						Habitat						2012-09-13
Endosulfan I	Endosulfan I (alpha-Endosulfan)	959988		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endosulfans		2013-05-28
Endosulfan I(Surrogate)	Surrogate: Endosulfan I (alpha-Endosulfan)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2014-01-28
Endosulfan I-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Endosulfan I-13C9	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-03
Endosulfan I-d4(Surrogate)	Surrogate: Endosulfan I-d4 (alpha-Endosuflan-d4)	0		% recovery					Organics	Pesticides					2013-05-27
Endosulfan II	Endosulfan II (beta-Endosulfan)	33213659		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endosulfans		2013-05-28
Endosulfan II(Surrogate)	Surrogate: Endosulfan II (beta-Endosulfan)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2014-01-28
Endosulfan II-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Endosulfan I-13C9	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-03
Endosulfan II-d4(Surrogate)	Surrogate: Endosulfan II-d4	0		% recovery					Organics						2017-03-06
Endosulfan Sulfate	Endosulfan Sulfate	1031078		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endosulfans		2013-05-28
Endosulfan Sulfate-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Endosulfan Sulfate-13C9	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-11-27
Endothall	Endothall	0		ug/L					Organics	Pesticides	Herbicides				2017-04-04
Endrin	Endrin	72208		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endrins		2007-07-27
Endrin Aldehyde	Endrin Aldehyde	7421934		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endrins		2007-07-27
Endrin Aldehyde(Surrogate)	Surrogate: Endrin Aldehyde	0			% recovery		% recovery	% recovery	Organics	Pesticides	OrganochlorinePesticides	Semi-VOAs	Insecticides	Endrins	2012-09-07
Endrin Aldehyde-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Endrin Aldehyde-13C12	0			% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-03
Endrin Ketone	Endrin Ketone	53494705		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endrins		2007-07-27
Endrin Ketone-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Endrin Ketone-13C12	2483736076		% recovery	% recovery		% recovery	% recovery							2025-09-04
Endrin Ketone-13C12(Surrogate)	Surrogate: Endrin Ketone-13C12	2483736076			% recovery				Organics	Pesticides					2025-09-04
Endrin(Surrogate)	Surrogate: Endrin	72208		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2016-03-02
Endrin-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Endrin-13C12	475274998		% recovery	% recovery		% recovery	% recovery							2025-09-04
Endrin-13C12(Surrogate)	Surrogate: Endrin-13C12	475274998			% recovery				Organics	Pesticides					2025-09-04
Enrofloxacin	Enrofloxacin	93106606		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Enterococcus	Enterococcus	0		TSC/100mL	MPN/g dw		MPN/g ww	MPN/g dw	Microbiological	Pathogens	Conventionals				2007-07-27
Enterococcus casseliflavus, Prokaryotic DNA (16S)	Enterococcus casseliflavus, Prokaryotic DNA, Target gene: 16S, 5’-GGAGCTTGCTCCACCGAA-3’, 5’-TTTCTTCCATGCGGAAAATAGT-3’	0		gc/mL					Microbiological						2026-04-20
Enterococcus faecalis, Prokaryotic DNA (16S)	Enterococcus faecalis, Prokaryotic DNA, Target gene: 16S, 5’-CGCTTCTTTCCTCCCGAGT-3’, 5’-GCCATGCGGCATAAACTG-3’	0		gc/mL					Microbiological						2026-04-20
Enterococcus faecium, Prokaryotic DNA (16S)	Enterococcus faecium, Prokaryotic DNA, Target gene: 16S, 5’-TTCTTTTTCCACCGGAGCTT-3’, 5’-AACCATGCGGTTTYGATTG-3’	0		gc/mL					Microbiological						2026-04-20
Enterovirus		0		copies/100 mL											2018-02-13
Epitestosterone	Epitestosterone	481301		ng/L											2018-08-31
EPN	EPN	2104645		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
EPN(Surrogate)	Surrogate: EPN	2104645		% recovery					Organics	Pesticides	OrganophosphatePest.	Semi-VOAs	Insecticides	Endrins	2013-01-31
EPTC	EPTC	759944		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides				2007-07-27
EPTC(Surrogate)	Surrogate: EPTC	759944		% recovery					Organics	Pesticides	Herbicides				2016-03-02
Erythromycin	Erythromycin	114078		ng/L											2021-05-07
Erythromycin-H2O	Erythromycin-H2O	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Erythromycin-H2O-13C2(Surrogate)	Surrogate: Erythromycin-H2O-13C2	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Esfenvalerate	Esfenvalerate	66230044		ug/L	ug/Kg dw				Organics	Pesticides					2016-05-20
Esfenvalerate/Fenvalerate, Total	Total Esfenvalerate/Fenvalerate, sum peaks 1 & 2	51630581		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Esfenvalerate/Fenvalerate-1	Esfenvalerate/Fenvalerate peak 1	51630581		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Esfenvalerate/Fenvalerate-2	Esfenvalerate/Fenvalerate peak 2	66230404		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Esfenvalerate-d6, Total(Surrogate)	Surrogate: Total Esfenvalerate-d6, sum peaks 1 & 2	0		% recovery	% recovery				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Esfenvalerate-d6-1(Surrogate)	Surrogate: Esfenvalerate-d6 peak 1	0		% recovery	% recovery				Organics	Pesticides	Insecticides	Pyrethroids			2012-12-13
Esfenvalerate-d6-2(Surrogate)	Surrogate: Esfenvalerate-d6 peak 2	0		% recovery	% recovery				Organics	Pesticides	Insecticides	Pyrethroids			2013-10-29
Estradiol, 17beta-	17beta-Estradiol	50282		ug/L					Organics	PPCPs					2013-05-28
Estradiol-d3, 17beta-(IsoDilAnalogue)	Isotope Dilution Analogue: 17beta-Estradiol-d3	79037379		% recovery					Organics						2022-07-22
Estriol	Estriol	50271		ng/L											2018-08-31
Estriol-d2(Surrogate)	Surrogate: Estriol-d2	53866323		% recovery											2022-05-24
Estrone	Estrone	53167		ng/L					Organics	PPCPs					2012-08-15
Ethaboxam	Ethaboxam	162650773		ng/L					Organics	Pesticides	Fungicides				2016-03-10
Ethafluralin	Ethalfluralin	55283686		ug/L			ug/Kg ww	ug/Kg dw	Organics	Pesticides	Herbicides				2013-05-30
Ethalfluralin	Ethalfluralin	55283686		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Herbicides				2007-07-27
Ethanol	Ethanol (Ethyl Alcohol)	0		ug/L					Organics	Pesticides					2017-04-04
Ethion	Ethion	563122		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Ethion(Surrogate)	Surrogate: Ethion	563122		% recovery					Organics	Pesticides	OrganophosphatePest.	OrganochlorinePesticides	Semi-VOAs	Insecticides	2016-03-02
Ethiprole(Surrogate)	Ethiprole(Surrogate)	181587019		% recovery					Organics	Pesticides	Insecticides	Phenylpyrazoles			2024-06-05
Ethoprop	Ethoprop (Prophos)	13194484		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides		2007-07-27
Ethyl Ether	Ethyl Ether	60297		ug/L					Organics	VOCs					2013-05-20
Ethyl Perfluorooctane Sulfonamido Acetic Acid, N-	N-Ethyl Perfluorooctane Sulfonamido Acetic Acid (Et-PFOSA-AcOH)	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS	PFC Precursor				2014-10-20
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5 (N-EtFOSAA-d5)	1265205977		% recovery					Organics	PFAS	IDA				2025-04-03
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(Surrogate)	Surrogate: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5	0					% recovery	% recovery	Organics	PFAS	PFC Precursor				2014-11-03
Ethyl Perfluorooctanesulfonamide, N-	N-Ethyl Perfluorooctanesulfonamide (NEtFOSA)	4151502		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Ethyl Perfluorooctanesulfonamide-d5, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctanesulfonamide-d5 (NEtFOSA-d5)	936109409		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Ethyl Perfluorooctanesulfonamidoacetic Acid, N-	N-Ethyl Perfluorooctanesulfonamidoacetic Acid (NEtFOSAA)	2991506		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-03-12
Ethyl Perfluorooctanesulfonamidoacetic Acid-d5, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctanesulfonamidoacetic Acid-d5 (NEtFOSAA-d5)	1265205977		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Ethyl Perfluorooctanesulfonamidoethanol, N-	N-Ethyl Perfluorooctanesulfonamidoethanol (NEtFOSE)	1691992		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Ethyl Perfluorooctanesulfonamidoethanol-d9, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctanesulfonamidoethanol-d9 (NEtFOSE-d9)	1265205966		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Ethyl Tert-butyl Ether	Ethyl Tert-butyl Ether (ETBE)	637923		ug/L					Organics	VOCs					2013-05-28
Ethylbenzene	Ethylbenzene	100414		ug/L					Organics	VOCs	MTBE_BTEX				2007-07-27
Ethylene bis(tetrabromophthalimide)	Ethylene bis(tetrabromophthalimide) (EBTEBPI)	32588764			ng/g dw				Organics	FlameRetardants					2014-03-13
Ethylene Glycol	Ethylene Glycol	107211		mg/L											2016-10-21
Ethyl-perfluorooctanesulfonamide, N-	N-Ethyl-perfluorooctanesulfonamide	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2010-02-23
Ethyl-perfluorooctanesulfonamide-d5, N-(Surrogate)	Surrogate: Ethyl-perfluorooctanesulfonamide-d5, N- (N-EtFOSA)	0					% recovery	% recovery	Organics	PFAS					2021-06-02
Ethyl-Perfluorooctanesulfonamidoacetic Acid, N-	N-Ethyl-Perfluorooctanesulfonamidoacetic Acid (NEtFOSAA)	2991506			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-02-04
Ethyl-perfluorooctanesulfonamidoethanol, N-	N-Ethyl-perfluorooctanesulfonamidoethanol	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2010-02-23
Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(Surrogate)	Surrogate: Ethyl-perfluorooctanesulfonamidoethanol-d9, N- (N-EtFOSE)	0					% recovery	% recovery	Organics	PFAS					2021-06-02
Ethynylestradiol, 17alpha-	17alpha-Ethynylestradiol	57636		ng/L											2018-08-31
Ethynylestradiol-d4, 17alpha-(IsoDilAnalogue)	Isotope Dilution Analogue: 17alpha-Ethynylestradiol-d4	350820063		% recovery					Organics						2022-07-22
Ethynylestradiol-d4, 17alpha-(Surrogate)	Surrogate: 17alpha-Ethynylestradiol-d4	350820063		% recovery											2022-05-24
Etofenprox	Etofenprox	80844071		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroids	Insecticides			2026-06-19
Ev_FlowHab	Evenness of flow habitat types physical-habitat metric	0	none						Bioassessment						2021-01-28
Evidence of Fire	Evidence of Fire	0	none						Habitat						2009-08-20
Evidence of Fire Intensity	Evidence of Fire Intensity - Specific to EMAP BA	0	none						Habitat						2009-08-27
Evidence of Illegal Connection	Evidence of Illegal Connection	0	none												2016-06-13
Evidence of Illegal Dumping	Evidence of Illegal Dumping	0	none												2016-06-13
Evidence of Recent Rainfall	Evidence of Recent Rainfall	0	none						Habitat						2009-08-20
Evidence of Scour	Site is affected by recent scouring event	0	none						Habitat	FieldObservations					2016-02-24
E-waste	E-waste	0	pieces						Debris	Trash	Plastics	Toxic			2014-11-04
Excavation Extent	Excavation Extent	0	none						Habitat						2019-05-07
Excavation Intensity	Excavation Intensity	0	none						Habitat						2019-05-07
Excavation Proximity	Excavation Proximity	0	none						Habitat						2019-05-07
Excess Animal Waste Extent	Excess Animal Waste Extent	0	none						Habitat						2019-05-07
Excess Animal Waste Intensity	Excess Animal Waste Intensity	0	none						Habitat						2019-05-07
Excess Animal Waste Proximity	Excess Animal Waste Proximity	0	none						Habitat						2019-05-07
Excess Sediment Input Other Extent	Excess Sediment Input Other Extent	0	none						Habitat						2019-05-07
Excess Sediment Input Other Intensity	Excess Sediment Input Other Intensity	0	none						Habitat						2019-05-07
Excess Sediment Input Other Proximity	Excess Sediment Input Other Proximity	0	none						Habitat						2019-05-07
Excessive Human Visitation Extent	Excessive Human Visitation Extent	0	none						Habitat						2019-05-07
Excessive Human Visitation Intensity	Excessive Human Visitation Intensity	0	none						Habitat						2019-05-07
Excessive Human Visitation Proximity	Excessive Human Visitation Proximity	0	none						Habitat						2019-05-07
Fabric	Fabric	0	pieces						Debris	Trash	Non-Plastics	Biodegradable			2014-11-04
Fallow Fields Extent	Fallow Fields Extent	0	none						Habitat						2019-05-07
Fallow Fields Intensity	Fallow Fields Intensity	0	none						Habitat						2019-05-07
Fallow Fields Proximity	Fallow Fields Proximity	0	none						Habitat						2019-05-07
Famoxadone	Famoxadone	131807573		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Famphur	Famphur	52857		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
FBDE 069	Fluorobrominated Diphenyl Ether (FBDE) 069 (4′-Fluoro-2,3′,4,6-tetrabromodiphenyl ether)	863314878			ng/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2023-10-20
FBDE 160	Fluorobrominated Diphenyl Ether (FBDE) 160 (4′-Fluoro-2,3,3′,4,5,6-hexabromodiphenyl ether)	863314889			ng/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2023-10-20
Fecal Streptococcus	Fecal Streptococcus	0		MPN/100 mL											2017-12-15
Fenamidone	Fenamidone	161326347		ng/L					Organics	Pesticides	Fungicides				2016-03-10
Fenamiphos	Fenamiphos (Phosphoramidic acid, Isopropyl-, 4-(methylthio)-m-tolyl Ethyl Ester)	22224926		ug/L					Organics	Pesticides	Pest-Ops	Insecticides			2013-05-28
Fenarimol	Fenarimol	60168889		ug/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Fenbuconazole	Fenbuconazole	114369436		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Fenchlorphos	Fenchlorphos (Ronnel)	299843		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Fenhexamid	Fenhexamid	126833178		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Fenitrothion	Fenitrothion	122145		ug/L	ng/g dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Fenoxycarb	Fenoxycarb	0		ug/L					Organics	Pesticides	Insecticides				2017-04-04
Fenpropathrin	Fenpropathrin (Danitol)	39515418		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Fenpropathrin-d6(Surrogate)	Surrogate: Fenpropathrin-d6	0			% recovery				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Fenpyroximate	Fenpyroximate	134098616		ng/L	ug/Kg dw				Organics	Pesticides	Insecticides				2016-03-10
Fensulfothion	Fensulfothion	115902		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides		2007-07-27
Fenthion	Fenthion (Mercaptophos)	55389		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Fenuron	Fenuron	101428		ug/L					Organics	Pesticides	Herbicides				2007-07-27
Fenvalerate	Fenvalerate	51630581		ug/L	ug/Kg ww				Organics	Pesticides					2016-05-20
Fenvalerate-d5(Surrogate)	Surrogate: Fenvalerate-d5	0		% recovery	% recovery				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Fenvalerate-d6, Total(Surrogate)	Surrogate: Total Fenvalerate-d6	82523668		% recovery					Organics	Pesticides	Pyrethroids	Insecticides			2026-06-04
Feral Pig Disturbance Extent	Feral Pig Disturbance Extent	0	none						Habitat						2019-05-07
Feral Pig Disturbance Intensity	Feral Pig Disturbance Intensity	0	none						Habitat						2019-05-07
Feral Pig Disturbance Proximity	Feral Pig Disturbance Proximity	0	none						Habitat						2019-05-07
Fertilization	Fertilization (%)	0				%			Toxicity						2007-07-27
Filling Time	Time to fill a collection device with water	0	seconds						Habitat						2009-08-27
FinalSampleExtVolume	Final post-processing volume	0			mL				Laboratory	Ancillary					2014-02-05
Fine	Fine	0		mg/L	% ww				Inorganics	Conventionals	GrainSize				2011-09-08
Fine_AS (<0.075 mm)	Fine_ASTM Scale (<0.075 mm)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Fipronil	Fipronil	120068373		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Insecticides				2009-08-19
Fipronil Amide	Fipronil Amide	0		ug/L	ng/g dw				Organics	Pesticides	Insecticides				2014-11-03
Fipronil Desulfinyl	Fipronil Desulfinyl	205650653		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Insecticides				2013-05-28
Fipronil Desulfinyl Amide	Fipronil Desulfinyl Amide	1115248093		ug/L	ug/Kg dw				Organics	Pesticides	Insecticides				2014-11-03
Fipronil Desulfinyl-13C4 15N2(Surrogate)	Surrogate: Fipronil Desulfinyl-13C4 15N2	0			% recovery				Organics	Pesticides	Fipronils				2019-06-03
Fipronil desulfinyl-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil desulfinyl-13C4,15N2	0			% recovery				Organics	Pesticides	Insecticides	Fipronils	IDA		2023-10-25
Fipronil DetrifluoroMethylsulfinyl	Fipronil DetrifluoroMethylsulfinyl	120068793			ug/Kg dw				Organics	Pesticides	Fipronils				2018-07-26
Fipronil Detrifluoromethylsulfinyl-13C4 15N2(Surrogate)	Surrogate: Fipronil Detrifluoromethylsulfinyl-13C4 15N2	0			% recovery				Organics	Pesticides	Fipronils				2019-06-03
Fipronil detrifluoromethylsulfinyl-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil detrifluoromethylsulfinyl-13C4,15N2	0			% recovery				Organics	Pesticides	Insecticides	Fipronils	IDA		2023-10-25
Fipronil Sulfide	Fipronil Sulfide	120067836		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Insecticides				2009-08-19
Fipronil Sulfide-13C4 15N2(Surrogate)	Surrogate: Fipronil Sulfide-13C4 15N2	0			% recovery				Organics	Pesticides	Fipronils				2019-06-03
Fipronil sulfide-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil sulfide-13C2,15N2	0			% recovery				Organics	Pesticides	Insecticides	Fipronils	IDA		2023-10-25
Fipronil Sulfone	Fipronil Sulfone	120068362		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Insecticides				2013-05-28
Fipronil Sulfone-13C4 15N2(Surrogate)	Surrogate: Fipronil Sulfone-13C4 15N2	0			% recovery				Organics	Pesticides	Fipronils				2019-06-03
Fipronil sulfone-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil sulfone-13C4,15N2	0			% recovery				Organics	Pesticides	Insecticides	Fipronils	IDA		2023-10-25
Fipronil-13C4 15N2(Surrogate)	Surrogate: Fipronil-13C4 15N2	0		% recovery	% recovery		% recovery	% recovery	PESTICIDES	Fipronils					2016-10-05
Fipronil-13C4(Surrogate)	Surrogate: Fipronil-13C4	0		% recovery	% recovery										2021-02-12
Fipronil-13C4,15N2(IsoDilAnalogue)	Isotope Dilution Analogue: Fipronil-13C2,15N2	0			% recovery				Organics	Pesticides	Insecticides	Fipronils	IDA		2023-10-25
Fipronil-C13(Surrogate)	Surrogate: Fipronil-C13	0		% recovery					Organics	Pesticides					2018-03-04
Fire Breaks Extent	Fire Breaks Extent	0	none						Habitat						2019-05-07
Fire Breaks Intensity	Fire Breaks Intensity	0	none						Habitat						2019-05-07
Fire Breaks Proximity	Fire Breaks Proximity	0	none						Habitat						2019-05-07
Fireworks	Fireworks	0	pieces						Debris	Trash	Non-Plastics	Toxic			2014-11-04
Fish Cover Artificial Structures	Fish Cover/Instream Habitat Complexity – Other Artificial Structures	0	none						Habitat						2009-08-20
Fish Cover Boulders	Fish Cover/Instream Habitat Complexity – Other Boulders	0	none						Habitat						2009-08-20
Fish Cover Filamentous Algae	Fish Cover/Instream Habitat Complexity - Other Filamentous Algae	0	none						Habitat						2009-08-20
Fish Cover Live Trees/Roots	Fish Cover/Instream Habitat Complexity – Other Live Trees or Roots	0	none						Habitat						2009-08-20
Fish Cover Macrophytes	Fish Cover/Instream Habitat Complexity - Macrophytes	0	none						Habitat						2009-08-20
Fish Cover Overhang.Veg	Fish Cover/Instream Habitat Complexity – Other Overhanging Vegetation =<1 m of surface	0	none						Habitat						2009-08-20
Fish Cover Undercut Banks	Fish Cover/Instream Habitat Complexity – Other Undercut Banks	0	none						Habitat						2009-08-20
Fish Cover Woody Debris <0.3 m	Fish Cover/Instream Habitat Complexity – Other Woody Debris <0.3 m	0	none						Habitat						2009-08-20
Fish Cover Woody Debris >0.3 m	Fish Cover/Instream Habitat Complexity – Other Woody Debris >0.3 m	0	none						Habitat						2009-08-20
Fish Stocking	Fish Stocking	0	none						Habitat						2009-08-20
Fishing Line/Net	Fishing Line/Net	0	pieces						Debris	Trash	Plastics	Miscellaneous			2014-11-04
Float Time	Float time of observed object	0	seconds						Habitat						2009-12-10
Floatables	Floatables	0	none	none					Habitat						2014-04-17
Flonicamid	Flonicamid	158062670		ng/L					Organics	Pesticides	Insecticides				2016-03-10
Flow Diversions Extent	Flow Diversions Extent	0	none						Habitat						2019-05-07
Flow Diversions Intensity	Flow Diversions Intensity	0	none						Habitat						2019-05-07
Flow Diversions Proximity	Flow Diversions Proximity	0	none						Habitat						2019-05-07
Fluazinam	Fluazinam	79622596		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Flucythrinate	Flucythrinate	70124775		pg/L	ug/Kg ww				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Fludioxonil	Fludioxonil	131341861		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Flufenacet	Flufenacet	142459583		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides				2016-03-10
Flumequine	Flumequine	42835256		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Flumetralin	Flumetralin	62924703		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides				2016-03-10
Flumetsulam	Flumetsulam	98967409		ug/L					Organics	Herbicides					2013-05-20
Flumioxazin	Flumioxazin	103361097		ug/L					Organics	Pesticides					2018-03-21
Fluocinonide	Fluocinonide	356127		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Fluometuron	Fluometuron	2164172		ug/L					Organics	Pesticides	Herbicides				2007-07-27
Fluopicolide	Fluopicolide	239110157		ng/L					Organics	Pesticides	Fungicides				2016-03-10
Fluopyram	Fluopyram	658066354		ng/L					Organics	Pesticides	Fungicides				2017-06-07
Fluoranthene	Fluoranthene	206440		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Fluoranthene/Pyrenes, C1-	C1-Fluoranthene/Pyrenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH			2010-06-21
Fluoranthene-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Fluoranthene-d10	93951690		% recovery					Organics	PAHs	IDA				2023-11-14
Fluoranthene-d10(Surrogate)	Surrogate: Fluoranthene-d10	93951690		% recovery	% recovery		% recovery	% recovery	Organics	PAHs					2025-08-25
Fluoranthenes/Pyrenes, C2-	C2-Fluoranthenes/Pyrenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Fluoranthenes/Pyrenes, C3-	C3-Fluoranthenes/Pyrenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Fluoranthenes/Pyrenes, C4-	C4-Fluoranthenes/Pyrenes	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Alkylated PAHs				2018-07-24
Fluorene	Fluorene	86737		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Fluorene-d10(Surrogate)	Surrogate: Fluorene-d10	0			% recovery		% recovery	% recovery	Organics	PAHs					2014-01-28
Fluorenes, C1-	C1-Fluorenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Fluorenes, C2-	C2-Fluorenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Fluorenes, C3-	C3-Fluorenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Fluorescence	Fluorescence	0		ug/L					WaterQualityMeasurements						2012-05-22
Fluorescence, Daily Mean	Daily Mean Fluorescence (Calculated)	0		ug/L					WaterQualityMeasurements	Conventionals					2024-09-06
Fluoride	Fluoride	16984488		mg/L					Inorganics	Conventionals					2007-07-27
Fluoro-2,3,3',4,5,6-Hexabromodiphenyl Ether, 4'-(Surrogate)	Surrogate: 4'-Fluoro-2,3,3',4,5,6-Hexabromodiphenyl Ether (FBDE 160)	863314889			ng/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2025-11-25
Fluoro-2,3',4,6-Tetrabromodiphenyl Ether, 4'-(Surrogate)	Surrogate: 4'-Fluoro-2,3',4,6-Tetrabromodiphenyl Ether (FBDE 069)	863314878			ng/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2025-11-25
Fluoro-2,3',6-Tribromodiphenyl Ether, 4'-(Surrogate)	Surrogate: 4'-Fluoro-2,3',6-tribromodiphenyl Ether	863314867		% recovery	% recovery		% recovery	% recovery	Organics	PBDEs					2013-05-28
Fluorobiphenyl, 2-	2-Fluorobiphenyl	321608		ug/L			ng/g ww	ng/g dw	Organics	SVOCs					2016-05-20
Fluorobiphenyl, 2-(Surrogate)	Surrogate: 2-Fluorobiphenyl	321608		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs					2016-03-02
Fluorophenol, 2-	2-Fluorophenol	367124		ug/L					Organics	VOCs					2016-05-20
Fluorophenol, 2-(Surrogate)	Surrogate: 2-Fluorophenol	367124		ug/L	% recovery		% recovery	% recovery	Organics	VOCs	Phenols	non-Chlorinated Phenols			2016-03-02
Fluorotelomer Carboxylic Acid, 3:3-	3:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorohexanoic acid) (3:3 FTCA)	356025		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2021-06-02
Fluorotelomer Carboxylic Acid, 5:3-	5:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorooctanoic acid) (5:3 FTCA)	914637493		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2021-06-02
Fluorotelomer Carboxylic Acid, 7:3-	7:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorodecanoic acid) (7:3 FTCA)	812704		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2021-06-02
Fluorotelomer Sulfonate, 10:2-	10:2-Fluorotelomer Sulfonate (10:2 FTS)	120226600			ng/g dw				Organics	PFAS					2023-10-12
Fluorotelomer Sulfonate, 4:2-	4:2-Fluorotelomer Sulfonate (4:2 FTS)	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2014-10-20
Fluorotelomer Sulfonate, 6:2-	6:2-Fluorotelomer Sulfonate (6:2 FTS)	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2014-10-20
Fluorotelomer Sulfonate, 8:2-	8:2-Fluorotelomer Sulfonate (8:2 FTS)	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2014-10-20
Fluorotelomer Sulfonate-13C, 6:2-(Surrogate)	Surrogate: 6:2-Fluorotelomer Sulfonate-13C	0					% recovery	% recovery	Organics	PFAS	PFC Precursor				2014-11-03
Fluorotelomer Sulfonate-13C2, 4:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 4:2-Fluorotelomer Sulfonate-13C2 (4:2 FTS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-03-04
Fluorotelomer Sulfonate-13C2, 4:2-(Surrogate)	Surrogate: Fluorotelomer Sulfonate-13C2, 4:2- (4:2 FTS)	0					% recovery	% recovery	Organics	PFAS					2021-06-02
Fluorotelomer Sulfonate-13C2, 6:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 6:2-Fluorotelomer Sulfonate-13C2 (6:2 FTS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-03-11
Fluorotelomer Sulfonate-13C2, 8:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 8:2-Fluorotelomer Sulfonate-13C2 (8:2 FTS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-03-04
Fluorotelomer Sulfonate-13C2, 8:2-(Surrogate)	Surrogate: Fluorotelomer Sulfonate-13C2, 8:2- (8:2 FTS)	0					% recovery	% recovery	Organics	PFAS					2021-06-02
Fluoxastrobin	Fluoxastrobin	361377299		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2025-08-25
Fluoxetine	Fluoxetine	54910893		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Fluoxetine-d5(Surrogate)	Surrogate: Fluoxetine-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Fluridone	Fluridone	59756604		ug/L	ug/Kg dw		ug/Kg nr	ug/Kg nr	Organics	Pesticides					2008-11-17
Fluridone(Surrogate)	Surrogate: Fluridone	59756604		% recovery	% recovery				Organics	Pesticides	Herbicides				2026-05-08
Flusilazole	Flusilazole	85509199		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Fluticasone Propionate	Fluticasone Propionate	80474142		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2013-05-29
Flutolanil	Flutolanil	66332965		ug/L	ug/Kg dw				Organics	Fungicides					2016-05-20
Flutriafol	Flutriafol	76674210		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Fluvalinate	Fluvalinate	0		ug/L	ug/Kg dw				Organics	Pesticides					2016-05-20
Fluxapyroxad	Fluxapyroxad	907204313		ng/L					Organics	Pesticides	Fungicides				2016-03-10
Foam Ball	Foam Ball	0	pieces						Debris	Trash	Plastics	Miscellaneous			2014-11-04
Foliose Algae	Foliose Algae	0	pieces						Debris	Trash	Non-Plastics	Marine Origin			2014-11-04
Folpet	Folpet	133073		ug/L					Organics	Pesticides	Fungicides				2016-10-25
Fonofos	Fonofos (Dyfonate)	944229		ug/L	ng/g dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Fonofos(Surrogate)	Surrogate: Fonofos	0		% recovery					Organics	Pesticides	OrganophosphatePest.	Insecticides			2011-07-15
Fonofos-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Fonofos-13C6	0					% recovery	% recovery	Organics	Pest-OPs	IDA				2023-10-03
Food Service	Food Service	0	L						Debris	Trash	Plastics				2014-11-05
Food Service, Other	Food Service, Other	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
Forest Dominant Age Class	Forest Dominant Age Class	0	none						Habitat						2009-08-20
Formaldehyde	Formaldehyde (Methanal)	0		ug/L					Organics	Pesticides					2017-04-04
Formate(Surrogate)	Surrogate: Formate	0		% recovery					Organics						2017-08-10
Furniture	Furniture	0	pieces						Debris	Trash	Plastics	Non-Plastics	Household	Large	2014-11-04
Furosemide	Furosemide	54319		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Gadolinium	Gadolinium	7440542			mg/Kg dw				Inorganics	Metals					2018-08-28
Gage Height	Water surface level measured against a staff gage within a given waterbody	0		ft					Habitat						2012-12-04
Galaxolide	Galaxolide	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides					2008-06-27
Galaxolide-d6(Surrogate)	Galaxolide-d6(Surrogate)	0		% recovery					Organics	PPCPs					2022-01-04
Garbage Bag of Trash	Garbage Bag of Trash	0	pieces						Debris	Trash	Non-Plastics	Large			2014-11-04
Gasoline	Gasoline	0		ug/L					Organics						2010-08-10
Gasoline Range Hydrocarbons	Gasoline Range Hydrocarbons	0		ug/L											2018-05-15
Gemfibrozil	Gemfibrozil	25812300		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Gemfibrozil-d6(IsoDilAnalogue)	Isotope Dilution Analogue: Gemfibrozil-d6	1184986455		% recovery					Organics						2022-07-22
Gemfibrozil-d6(Surrogate)	Surrogate: Gemfibrozil-d6	1184986455		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2025-09-04
Geosmin	Geosmin	19700211		ng/L					Organics	Terpenes/Terpinoids					2025-11-05
Germination	Germination (%)	0				%			Toxicity						2007-07-27
Giardia	Giardia	0		oocysts/L					Microbiological	Pathogens	Conventionals				2013-05-28
Giardia Cysts Fluorescence Antibody	Giardia Cysts Fluorescence Antibody	0		cysts/L					Microbiological	Pathogens					2017-03-27
Giardia Cysts Negative	Giardia Cysts Negative	0		cysts/L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/Amorphous Structure	Giardia Cysts/Amorphous Structure	0		IFA+/100L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/DAPI & DIC Positive	Giardia Cysts/DAPI & DIC Positive	0		cysts/L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/Empty	Giardia Cysts/Empty	0		IFA+/100L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/Flourescence Antibody	Giardia Cysts/Flourescence Antibody	0		cysts/L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/Internal Structure	Giardia Cysts/Internal Structure	0		cysts/L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/Internal Structure (>One)	Giardia Cysts/Internal Structure (>One)	0		cysts/L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/Internal Structure (One)	Giardia Cysts/Internal Structure (One)	0		IFA+/100L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/Internal Structures (>One)	Giardia Cysts/Internal Structures (>One)	0		IFA+/100L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/Negative	Giardia Cysts/Negative	0		cysts/L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/Positive	Giardia Cysts/Positive	0		cysts/L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/Positive (Internal Staining)	Giardia Cysts/Positive (Internal Staining)	0		cysts/L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/Positive (Stained Nuclei)	Giardia Cysts/Positive (Stained Nuclei)	0		cysts/L					Microbiological	Pathogens					2017-03-27
Giardia Cysts/Total IFA Count	Giardia Cysts/Total IFA Count	0		IFA+/100L					Microbiological	Pathogens					2017-03-27
Glass	Glass using Trash Protocol	0	pieces						Trash						2011-05-04
Glass Servicewear	Glass Servicewear	0	pieces						Debris	Trash	Non-Plastics	Household			2014-11-04
Glass Shard	Glass Shard	0	pieces						Debris	Trash	Non-Plastics	Household			2014-11-04
Glide	Glide	0	%						Habitat						2009-08-20
Glide/Pool Bank Stability	Glide/Pool Bank Stability (used for EMAP RBP 20-score habitat characterization)	0	none						Habitat						2009-08-20
Glide/Pool Channel Alteration	Glide/Pool Channel Alteration	0	none						Habitat						2009-08-20
Glide/Pool Channel Flow Status	Glide/Pool Channel Flow Status	0	none						Habitat						2009-08-20
Glide/Pool Channel Sinuosity	Glide/Pool Channel Sinuosity	0	none						Habitat						2009-08-20
Glide/Pool Epifaunal Substrate	Glide/Pool Epifaunal Substrate	0	none						Habitat						2009-08-20
Glide/Pool Pool Substrate	Glide/Pool Pool Substrate	0	none						Habitat						2009-08-20
Glide/Pool Pool Variability	Glide/Pool Pool Variability	0	none						Habitat						2009-08-20
Glide/Pool Riparian Zone Width	Glide/Pool Riparian Zone Width	0	none						Habitat						2009-08-20
Glide/Pool Sediment Deposition	Glide/Pool Sediment Deposition	0	none						Habitat						2009-08-20
Glide/Pool Vegetative Protection	Glide/Pool Vegetative Protection	0	none						Habitat						2009-08-20
Glipizide	Glipizide	29094619		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Glipizide-d11(Surrogate)	Surrogate: Glipizide-d11	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Glyburide	Glyburide	10238218		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Glyburide-d3(Surrogate)	Surrogate: Glyburide-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Glyphosate	Glyphosate	1071836		ug/L					Organics	Pesticides	Herbicides				2007-07-27
Gold	Gold	0			mg/Kg dw				Inorganics	Metals					2014-01-29
Golf Course/Parks/Sports Fields Extent	Golf Course/Parks/Sports Fields Extent	0	none						Habitat						2019-05-07
Golf Course/Parks/Sports Fields Intensity	Golf Course/Parks/Sports Fields Intensity	0	none						Habitat						2019-05-07
Golf Course/Parks/Sports Fields Proximity	Golf Course/Parks/Sports Fields Proximity	0	none						Habitat						2019-05-07
Gonad Index CI Mean	Gonad Index CI Mean	0					g/mL	g/mL	Tissue	Condition					2014-02-05
Gonad Index Standard Error	Gonad Index Standard Error	0					g/mL	g/mL	Tissue	Condition					2014-02-05
Grading/Compaction Extent	Grading/Compaction Extent	0	none						Habitat						2019-05-07
Grading/Compaction Intensity	Grading/Compaction Intensity	0	none						Habitat						2019-05-07
Grading/Compaction Proximity	Grading/Compaction Proximity	0	none						Habitat						2019-05-07
Granule	Granule	0		%	%				Inorganics	Conventionals	GrainSize				2011-09-08
Granule + Pebble	Granule + Pebble	0		mg/L	% vol				Inorganics	Conventionals	GrainSize				2011-09-08
Granule_WS (2.0 to <4.0 mm_Phi -1 to >-2)	Granule_Wentworth Scale (2.0 to <4.0 mm_Phi -1 to >-2)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Gravel	Gravel	0			% ww				Inorganics	Conventionals	GrainSize				2011-09-08
Gravel_AS (4.75 to <75 mm)	Gravel_ASTM Scale (4.75 to <75 mm)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Gravel_WS (2 to <64 mm_Phi -1 to >-6)	Gravel_Wentworth Scale (2 to <64 mm_Phi -1 to >-6)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Grazing_Recent	Evidence of grazing activiy by cattle within the past year	0	none						Habitat						2012-09-13
Gross Alpha	Gross Alpha	12587461		pCi/L					Radiochemistry						2013-05-20
Gross Beta	Gross Beta	12587472		pCi/L					Radiochemistry						2013-05-20
Groundwater Extraction Extent	Groundwater Extraction Extent	0	none						Habitat						2019-05-07
Groundwater Extraction Intensity	Groundwater Extraction Intensity	0	none						Habitat						2019-05-07
Groundwater Extraction Proximity	Groundwater Extraction Proximity	0	none						Habitat						2019-05-07
Growth (ash-free dry wt/surv indiv)	Growth (ash-free dry weight/surviving individual)	0				mg/ind			Toxicity	Endpoint					2014-02-05
Growth (Chlorophyll a fluorescence)	Growth (Chlorophyll a fluorescence)	0		RFU		RFU			Toxicity						2022-11-15
Growth (Chlorophyll a)	Growth (Chlorophyll a)	0				mg/m3			Toxicity						2017-12-15
Growth (length)	Growth (length)	0				mm			Toxicity						2007-07-27
Growth (weight)	Growth (weight)	0					g	g	Tissue	Condition					2014-02-05
Growth (wt/surv indiv)	Growth (weight/surviving individual)	0				mg/ind			Toxicity						2007-07-27
Growth Ratio	Growth Ratio (final measurement / initial measurement)	0				Num/Rep			Toxicity						2011-12-22
Growth Standard Error	Growth Standard Error	0					g	g	Tissue	Condition					2014-02-05
Gull_Gull2TM	Gull_Gull2TM	0		copies/100mL					Microbiological						2018-03-07
H_AqHab	Shannon diversity of natural instream cover types physical-habitat metric	0	none						Bioassessment						2021-01-28
H_SubNat	Shannon diversity of natural substrate types physical-habitat metric	0	none						Bioassessment						2021-01-28
HabitatType	HabitatType	0	none						FieldObservations	Habitat					2009-08-20
Halosulfuron Methyl	Halosulfuron Methyl	100784201		ug/L					Organics	Pesticides	Herbicides				2016-10-25
Hard Plastic Piece, non-specific	Hard Plastic Piece, non-specific	0	pieces						Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Hardened Features Other Extent	Hardened Features Other Extent	0	none						Habitat						2019-05-07
Hardened Features Other Intensity	Hardened Features Other Intensity	0	none						Habitat						2019-05-07
Hardened Features Other Proximity	Hardened Features Other Proximity	0	none						Habitat						2019-05-07
Hardness as CaCO3	Hardness as CaCO3	0		ug/L	% recovery				Inorganics	Conventionals	WaterQualityMeasurements				2007-07-27
Hay Extent	Hay Extent	0	none						Habitat						2019-05-07
Hay Intensity	Hay Intensity	0	none						Habitat						2019-05-07
Hay Proximity	Hay Proximity	0	none						Habitat						2019-05-07
HCH, alpha-	alpha-Hexachlorocyclohexane (HCH) (alpha-BHC)	319846		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Rodenticides		2013-05-28
HCH, alpha-(Surrogate)	Surrogate: alpha-Hexachlorocyclohexane (HCH) (alpha-BHC)	0			% recovery				Organics	Pesticides					2014-01-28
HCH, beta-	beta-Hexachlorocyclohexane (HCH) (beta-BHC)	319857		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Rodenticides		2013-05-28
HCH, beta-(Surrogate)	Surrogate: beta-Hexachlorocyclohexane (HCH) (beta-BHC)	319857		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2016-03-02
HCH, delta-	delta-Hexachlorocyclohexane (HCH) (delta-BHC)	319868		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Rodenticides		2013-05-28
HCH, delta-(Surrogate)	Surrogate: delta-Hexachlorocyclohexane (HCH) (delta-BHC)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2013-05-27
HCH, gamma-	gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane)	58899		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors	Rodenticides	2013-05-28
HCH, gamma-(Surrogate)	Surrogate: gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2013-05-29
HCH, gamma-/PCB 015/18	gamma-HCH/PCB 15/18	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/20	gamma-HCH/PCB 15/20	0			ug/Kg dw				Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/21	gamma-HCH/PCB 15/21	0			ug/Kg dw				Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/22	gamma-HCH/PCB 15/22	0			ug/Kg dw				Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/23	gamma-HCH/PCB 15/23	0			ug/Kg dw				Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/24	gamma-HCH/PCB 15/24	0			ug/Kg dw				Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/25	gamma-HCH/PCB 15/25	0			ug/Kg dw				Organics	Pesticides/PCBs					2014-02-01
HCH, gamma-/PCB 015/26	gamma-HCH/PCB 15/26	0			ug/Kg dw				Organics	Pesticides/PCBs					2014-02-01
HCH-13C6, alpha-(IsoDilAnalogue)	Isotope Dilution Analogue: alpha-Hexachlorocyclohexane-13C6 (HCH) (alpha-BHC)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-26
HCH-13C6, alpha-(IsoDilAnalogues)	Isotope Dilution Analogue: alpha-Hexachlorocyclohexane-13C6 (HCH) (alpha-BHC)	222966667					% recovery	% recovery	Organics	Pest-OCHs	IDA				2025-06-18
HCH-13C6, beta-(IsoDilAnalogues)	Isotope Dilution Analogue: beta-Hexachlorocyclohexane-13C6 (HCH) (beta-BHC)	222966689		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
HCH-13C6, delta-(IsoDilAnalogue)	Isotope Dilution Analogue: delta-Hexachlorocyclohexane-13C6 (HCH) (delta-BHC)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-19
HCH-13C6, gamma-(IsoDilAnalogue)	Isotope Dilution Analogue: gamma-Hexachlorocyclohexane-13C6 (HCH) (gamma-BHC) (Lindane)	104215852		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
HCH-d6, gamma-(IsoDilAnalogue)	Isotope Dilution Analogue: HCH-d6, gamma-	0		% recovery											2023-10-27
HCH-d6, gamma-(Surrogate)	Surrogate: gamma-Hexachlorocyclohexane-d6 (HCH-d6) (gamma-BHC-d6) (Lindane-d6)	0			% recovery				Organics	Pesticides					2013-06-20
Heavy Urban Other Extent	Heavy Urban Other Extent	0	none						Habitat						2019-05-07
Heavy Urban Other Intensity	Heavy Urban Other Intensity	0	none						Habitat						2019-05-07
Heavy Urban Other Proximity	Heavy Urban Other Proximity	0	none						Habitat						2019-05-07
Helicobacter, Avian (GFD)	Avian Helicobacter, Assay name: GFD, 5'-TCGGCTGAGCACTCTAGGG-3', 5'-GCGTCTCTTTGTACATCCCA-3'	0		gc/mL	none				Microbiological						2023-01-27
Heneicosane, n-	n-Heneicosane	629947					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Hentriacontane, n-	n-Hentriacontane	630046					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Hepatitis A Virus	Hepatitis A Virus	0		copies/100 mL					Microbiological	Pathogens					2020-10-29
Heptachlor	Heptachlor	76448		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors		2007-07-27
Heptachlor Epoxide	Heptachlor Epoxide	1024573		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors		2013-05-28
Heptachlor Epoxide(Surrogate)	Surrogate: Heptachlor Epoxide	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2008-11-17
Heptachlor Epoxide/Oxychlordane	Heptachlor Epoxide/Oxychlordane	0		pg/L					Organics	Pesticides					2014-02-01
Heptachlor Epoxide-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Heptachlor Epoxide-13C10	0		% recovery	% recovery		% recovery	% recovery							2023-10-27
Heptachlor Epoxide-13C10(Surrogate)	Surrogate: Heptachlor Epoxide-13C10	0			% recovery				Organics	Pesticides					2013-06-17
Heptachlor(Surrogate)	Surrogate: Heptachlor	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2008-11-17
Heptachlor-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Heptachlor-13C10	0		% recovery	% recovery		% recovery	% recovery							2023-10-27
Heptachlor-13C10(Surrogate)	Surrogate: Heptachlor-13C10	0			% recovery				Organics	Pesticides					2013-06-17
Heptachlorobenzene	Heptachlorobenzene	0			ug/Kg dw				Organics	Pesticides					2014-01-28
Heptacosane, n-	n-Heptacosane	593497					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Heptadecane, n-	n-Heptadecane	629787					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Hexa(Methoxymethyl)Melamine	Hexa(Methoxymethyl)Melamine (HMMM)	3089110		ng/L					Organics	Tire- and Vehicle-derived Contaminants					2026-02-10
Hexabromobenzene	Hexabromobenzene (HBBZ)	87821			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-01-04
Hexabromobenzene-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Hexabromobenzene-13C6 (HBB-13C6)	2483735506					% recovery	% recovery	Organics	FlameRetardants	IDA				2024-10-31
Hexabromocyclododecane, alpha-	alpha-Hexabromocyclododecane (alpha-HBCDD)	0			ng/g dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2011-05-11
Hexabromocyclododecane, beta-	beta-Hexabromocyclododecane (beta-HBCDD)	0			ng/g dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2011-05-11
Hexabromocyclododecane, gamma-	gamma-Hexabromocyclododecane (gamma-HBCDD)	0			ng/g dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2011-05-11
Hexabromocyclododecane-13C12(Surrogate)	Surrogate: Hexabromocyclododecane-13C12 (HBCDD)	0					% recovery	% recovery	Organics	FlameRetardants					2014-01-28
Hexachloro(phenyl)norbornene	Hexachloro(phenyl)norbornene (HCPN)	0			ng/g dw				Organics	FlameRetardants					2015-07-16
Hexachlorobenzene	Hexachlorobenzene	118741		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors	Fungicides		2007-07-27
Hexachlorobenzene(Surrogate)	Surrogate: Hexachlorobenzene	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2008-11-17
Hexachlorobenzene-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Hexachlorobenzene-13C6	0		% recovery	% recovery		% recovery	% recovery							2023-10-27
Hexachlorobenzene-13C6(Surrogate)	Surrogate: Hexachlorobenzene-13C6	0			% recovery				Organics	Pesticides					2013-06-17
Hexachlorobutadiene	Hexachlorobutadiene	87683		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs	SVOCs	Fungicides			2007-07-27
Hexachlorocyclopentadiene	Hexachlorocyclopentadiene (HCCPD)	77474		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2007-07-27
Hexachlorocyclopentadienyldibromocyclooctane	Hexachlorocyclopentadienyldibromocyclooctane (HCDBCO)	51936551			ng/g dw				Organics	FlameRetardants					2014-03-13
Hexachloroethane	Hexachloroethane	67721		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2007-07-27
Hexacosane, n-	n-Hexacosane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes					2014-01-28
Hexadecane, n-	n-Hexadecane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes					2014-01-28
Hexafluoropropylene Oxide Dimer Acid	Hexafluoropropylene Oxide Dimer Acid (HFPO-DA)	13252136		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Hexafluoropropylene Oxide Dimer Acid-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Hexafluoropropylene Oxide Dimer Acid-13C3 (HFPO-DA-13C3)	3030247970		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Hexahydro-1,3,5-trinitro-1,3,5-triazine	Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX)	121824		ug/L	ug/Kg dw				Organics						2019-12-18
Hexanone, 2-	2-Hexanone	591786		ug/L					Organics	VOCs					2007-07-27
Hexazinone	Hexazinone	51235042		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
HF183TMSIPP	HF183TMSIPP	0		copies/100mL					Microbiological						2018-03-15
High Concentration of Salts Extent	High Concentration of Salts Extent	0	none						Habitat						2019-05-07
High Concentration of Salts Intensity	High Concentration of Salts Intensity	0	none						Habitat						2019-05-07
High Concentration of Salts Proximity	High Concentration of Salts Proximity	0	none						Habitat						2019-05-07
Highway >2 lanes Extent	Highway >2 lanes Extent	0	none						Habitat						2019-05-07
Highway >2 lanes Intensity	Highway >2 lanes Intensity	0	none						Habitat						2019-05-07
Highway >2 lanes Proximity	Highway >2 lanes Proximity	0	none						Habitat						2019-05-07
Hiking Trails	Hiking Trails	0	none						Habitat						2009-08-20
Holmium	Holmium	7440600		ug/L					Inorganics						2013-05-20
Homeless Encampment, Distance from Transect	Homeless Encampment, Distance from Transect	0	m						Habitat	Debris					2014-11-04
Homeless Encampment, Distance from Transect Downstream	Homeless Encampment, Distance from Transect Downstream	0	m						Habitat	Debris					2014-11-04
Homeless Encampment, Distance from Transect Upstream	Homeless Encampment, Distance from Transect Upstream	0	m						Habitat	Debris					2014-11-04
Homeless Encampment, Within Transect	Homeless Encampment, Within Transect	0	none						Habitat	Debris					2014-11-04
Homoanatoxin-a	Homoanatoxin-a	142926861		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2026-03-26
Hopane, C29-	C29-Hopane	0					ng/g ww	ng/g dw	Organics	Hopanes					2014-01-28
Hopane, C30-	C30-Hopane	0					ng/g ww	ng/g dw	Organics	Hopanes					2014-01-28
Horses Extent	Horses Extent	0	none						Habitat						2019-05-07
Horses Intensity	Horses Intensity	0	none						Habitat						2019-05-07
Horses Proximity	Horses Proximity	0	none						Habitat						2019-05-07
Hose Piece	Hose Piece	0	pieces						Debris	Trash	Non-Plastics	Household			2014-11-04
Household	Household	0	L						Debris	Trash	Plastics				2014-11-05
Household, Other	Household, Other	0	pieces						Debris	Trash	Plastics	Non-Plastics	Household		2014-11-04
HpCDD, 1,2,3,4,6,7,8-	1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD)	35822469		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HPCDD, 1,2,3,4,6,7,8- (TEQ ND=0)	1,2,3,4,6,7,8-HPCDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
HPCDD, 1,2,3,4,6,7,8- (TEQ ND=1/2 DL)	1,2,3,4,6,7,8-HPCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
HpCDD, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD)	35822469		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HpCDD-13C, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin-13C (HpCDD)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-07-02
HpCDD-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin-13C12 (HpCDD-13C12)	109719837		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
HpCDF, 1,2,3,4,6,7,8-	1,2,3,4,6,7,8-Heptachlorodibenzofuran (HpCDF)	67562394		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HPCDF, 1,2,3,4,6,7,8- (TEQ ND=0)	1,2,3,4,6,7,8-HPCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
HPCDF, 1,2,3,4,6,7,8- (TEQ ND=1/2 DL)	1,2,3,4,6,7,8-HPCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
HpCDF, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran	0		% recovery			% recovery	% recovery	Organics	DioxinsDibenzofurans					2015-06-22
HpCDF, 1,2,3,4,7,8,9-	1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF)	55673897		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HPCDF, 1,2,3,4,7,8,9- (TEQ ND=0)	1,2,3,4,7,8,9-HPCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
HPCDF, 1,2,3,4,7,8,9- (TEQ ND=1/2 DL)	1,2,3,4,7,8,9-HPCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
HpCDF, 1,2,3,4,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF)	67562394		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HpCDF-13C, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran-13C (HpCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-07-02
HpCDF-13C, 1,2,3,4,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran-13C (HpDDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-07-02
HpCDF-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,6,7,8-Heptachlorodibenzofuran-13C12 (HpCDF-13C12)	109719848		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
HpCDF-13C12, 1,2,3,4,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,7,8,9-Heptachlorodibenzofuran-13C12 (HpCDF-13C12)	109719940		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
Human Adenovirus		0		copies/100 mL	copies/g dw										2018-02-13
Human Marker (HF183)	Human Marker (HF183)	0		gc/mL	copies/g dw										2018-02-16
Human Norovirus GI		0		copies/100 mL											2018-02-13
Human Norovirus GII		0		copies/100 mL											2018-02-13
Human Waste/Diaper	Human Waste/Diaper	0	pieces						Debris	Trash	Non-Plastics	Toxic			2014-11-04
Human_HF183TMCaMan	Human_HF183TMCaMan	0		copies/100mL					Microbiological						2018-03-07
HumanHealth	HumanHealth using Trash Protocol	0	score						Trash						2011-05-04
HxCDD, 1,2,3,4,7,8-	1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	39227286		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HXCDD, 1,2,3,4,7,8- (TEQ ND=0)	1,2,3,4,7,8-HXCDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
HXCDD, 1,2,3,4,7,8- (TEQ ND=1/2 DL)	1,2,3,4,7,8-HXCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
HxCDD, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	39227286		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HxCDD, 1,2,3,6,7,8-	1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	57653857		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HXCDD, 1,2,3,6,7,8- (TEQ ND=0)	1,2,3,6,7,8-HXCDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
HXCDD, 1,2,3,6,7,8- (TEQ ND=1/2 DL)	1,2,3,6,7,8-HXCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
HxCDD, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	57653857		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HxCDD, 1,2,3,7,8,9-	1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin (HxCDD)	19408743		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HXCDD, 1,2,3,7,8,9- (TEQ ND=0)	1,2,3,7,8,9-HXCDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
HXCDD, 1,2,3,7,8,9- (TEQ ND=1/2 DL)	1,2,3,7,8,9-HXCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
HxCDD-13C, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin-13C (HxCDD)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-07-02
HxCDD-13C, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin-13C (HxCDD)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-07-02
HxCDD-13C12, 1,2,3,4,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD-13C12)	109719804		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
HxCDD-13C12, 1,2,3,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD-13C12)	109719815		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
HxCDD-13C12, 1,2,3,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD)	109719826		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans				2024-11-13
HxCDF, 1,2,3,4,7,8-	1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF)	70648269		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HXCDF, 1,2,3,4,7,8- (TEQ ND=0)	1,2,3,4,7,8-HXCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
HXCDF, 1,2,3,4,7,8- (TEQ ND=1/2 DL)	1,2,3,4,7,8-HXCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
HxCDF, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF)	70648269		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HxCDF, 1,2,3,6,7,8-	1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF)	57117449		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HXCDF, 1,2,3,6,7,8- (TEQ ND=0)	1,2,3,6,7,8-HXCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
HXCDF, 1,2,3,6,7,8- (TEQ ND=1/2 DL)	1,2,3,6,7,8-HXCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
HxCDF, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF)	57117449		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HxCDF, 1,2,3,7,8,9-	1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF)	72918219		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HXCDF, 1,2,3,7,8,9- (TEQ ND=0)	1,2,3,7,8,9-HXCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
HXCDF, 1,2,3,7,8,9- (TEQ ND=1/2 DL)	1,2,3,7,8,9-HXCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
HxCDF, 1,2,3,7,8,9-(Surrogate)	Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF)	72918219		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HxCDF, 2,3,4,6,7,8-	2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF)	60851345		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
HXCDF, 2,3,4,6,7,8- (TEQ ND=0)	2,3,4,6,7,8-HXCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
HXCDF, 2,3,4,6,7,8- (TEQ ND=1/2 DL)	2,3,4,6,7,8-HXCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
HXCDF, 2,3,4,6,7,8-(Surrogate)	Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF)	60851345		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
HxCDF-13C, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran-13C (HxCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-07-02
HxCDF-13C, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran-13C (HxCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-07-02
HxCDF-13C, 1,2,3,7,8,9-(Surrogate)	Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran-13C (HxCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-07-02
HxCDF-13C, 2,3,4,6,7,8-(Surrogate)	Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran-13C (HxCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-07-02
HxCDF-13C12, 1,2,3,4,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,7,8-Hexachlorodibenzofuran-13C12 (HxCDF-13C12)	114423982		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
HxCDF-13C12, 1,2,3,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,6,7,8-Hexachlorodibenzofuran-13C12 (HxCDF-13C12)	116843039		% recovery					Organics	Dioxins/DibenzofuransDioxins/Dibenzofurans	IDA				2025-08-25
HxCDF-13C12, 1,2,3,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8,9-Hexachlorodibenzofuran-13C12 (HxCDF-13C12)	116843040		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
HxCDF-13C12, 2,3,4,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,4,6,7,8-Hexachlorodibenzofuran-13C12 (HxCDF-13C12)	116843051		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
Hydramethylnon	Hydramethylnon	0		ug/L					Organics	Pesticides	Insecticides				2017-04-04
Hydraulic Height	Height from bottom of stream to top of bankfull height or the summation of station water depth and bankfull height	0	m						Habitat						2013-05-17
Hydrochlorothiazide	Hydrochlorothiazide	58935		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Hydrocodone	Hydrocodone	125291		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Hydrocodone-d3(Surrogate)	Surrogate: Hydrocodone-d3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Hydrocortisone	Hydrocortisone	50237		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Hydrocortisone-d4(Surrogate)	Surrogate: Hydrocortisone-d4	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Hydrolyzable Phosphorus + Orthophosphate as P	Hydrolyzable Phosphorus + Orthophosphate as P	0		mg/L					Inorganics	Conventionals					2013-05-20
Hydroperiod	Hydroperiod of the waterbody	0	none						Habitat						2012-09-13
Hydroxide	Hydroxide	14280309		ug/L	mg/Kg dw				Inorganics	Conventionals					2012-09-13
Hydroxide Alkalinity as CaCO3	Hydroxide Alkalinity as CaCO3	471341		mg/L					Inorganics	Conventionals	WaterQualityMeasurements				1900-01-01
Hydroxy-amitriptyline, 10-	10-Hydroxy-amitriptyline	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Hydroxyatrazine, 2-	2-Hydroxyatrazine	2163680		ug/L					Organics	Pesticides	Pest-Triazines				2010-05-18
Hydroxycarbofuran, 3-	3-Hydroxycarbofuran	16655826		ug/L	ug/Kg dw				Organics	Pesticides	Insecticides	Carbamates			2014-01-28
Hydroxy-ibuprofen, 2-	2-Hydroxy-ibuprofen	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Hydroxy-Imidacloprid, 5-	5-Hydroxy-Imidacloprid	380912094		ug/L					Organics	Pesticides					2018-08-07
Hydroxypropanal, 3-	3-Hydroxypropanal	2134294		ug/L					Organics	Pesticides					2008-11-17
Ibuprofen	Ibuprofen	15687271		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Ibuprofen-13C3(Surrogate)	Surrogate: Ibuprofen-13C3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Ibuprofen-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Ibuprofen-d3	121662144		% recovery					Organics						2022-07-22
Imazalil	Imazalil	35554440		ug/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Imazamox	Imazamox	114311329		ug/L					Organics						2020-06-26
Imazapyr	Imazapyr	0		ug/L					Organics	Pesticides	Herbicides				2017-04-04
Imazaquin	Imazaquin	81335377		ug/L					Organics	Herbicides					2013-05-20
Imazethapyr	Imazethapyr	81335775		ug/L					Organics	Herbicides					2013-05-20
Imidacloprid	Imidacloprid	138261413		ug/L	ng/g dw				Organics	PPCPs					2012-09-13
Imidacloprid guanidine	Imidacloprid guanidine	0		ug/L					Organics	Pesticides					2017-04-20
Imidacloprid guanidine olefin	Imidacloprid guanidine olefin	0		ug/L					Organics	Pesticides					2017-04-20
Imidacloprid olefin	Imidacloprid olefin	115086549		ug/L					Organics	Pesticides					2017-04-20
Imidacloprid urea	Imidacloprid urea	120868668		ug/L					Organics	Pesticides					2017-04-20
Imidacloprid-d4(Surrogate)	Surrogate: Imidacloprid-d4	0		% recovery					Organics	Pesticides	Insecticides				2018-01-31
Incised Height	Incised Height	0	m						Habitat						2009-08-20
Increment	Increment	0	m						Habitat						2009-08-20
Indeno(1,2,3-c,d)pyrene	Indeno(1,2,3-c,d)pyrene	193395		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors		2007-07-27
Indeno(1,2,3-c,d)pyrene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Indeno(1,2,3-c,d)pyrene-d12	203578330		% recovery					Organics	PAHs	IDA				2023-11-14
Indeno(1,2,3-c,d)pyrene-d12(Surrogate)	Surrogate: Indeno(1,2,3-c,d)pyrene-d12	0		% recovery	% recovery		% recovery	% recovery	Organics	PAHs					2012-04-04
Indole	Indole	120729			ug/Kg dw				Organics						2018-07-16
Indoxacarb	Indoxacarb	173584446		ug/L	ug/Kg dw				Organics	Pesticides	Ozadiazine	Insecticides			2015-09-11
Industrial Extent	Industrial Extent	0	none						Habitat						2019-05-07
Industrial Intensity	Industrial Intensity	0	none						Habitat						2019-05-07
Industrial Plants	Industrial Plants	0	none						Habitat						2009-08-20
Industrial Proximity	Industrial Proximity	0	none						Habitat						2019-05-07
Industrial Water Quality Other Extent	Industrial Water Quality Other Extent	0	none						Habitat						2019-05-07
Industrial Water Quality Other Intensity	Industrial Water Quality Other Intensity	0	none						Habitat						2019-05-07
Industrial Water Quality Other Proximity	Industrial Water Quality Other Proximity	0	none						Habitat						2019-05-07
Instream Plant Cover	Instream Plant Cover	0	none						Habitat						2011-11-01
IntertidalSubstrateCharacteristics_Mud	IntertidalSubstrateCharacteristics_Mud	0	none						Habitat	Debris					2014-11-04
IntertidalSubstrateCharacteristics_Rocky	IntertidalSubstrateCharacteristics_Rocky	0	none						Habitat	Debris					2014-11-04
IntertidalSubstrateCharacteristics_Sand	IntertidalSubstrateCharacteristics_Sand	0	none						Habitat	Debris					2014-11-04
IntertidalSubstrateCharacteristics_Vegetated	IntertidalSubstrateCharacteristics_Vegetated	0	none						Habitat	Debris					2014-11-04
Invasive Plants Extent	Invasive Plants Extent	0	none						Habitat						2019-05-07
Invasive Plants Intensity	Invasive Plants Intensity	0	none						Habitat						2019-05-07
Invasive Plants Proximity	Invasive Plants Proximity	0	none						Habitat						2019-05-07
Iodomethane	Iodomethane	74884		ug/L											2016-07-29
Iohexol	Iohexol	66108950		ng/L											2018-08-31
Iopromide	Iopromide	73334073		ng/L											2018-08-31
Iopromide-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Iopromide-d3	1189947736		% recovery					Organics						2024-02-15
Iopromide-d3(Surrogate)	Surrogate: Iopromide-d3	1189947736		% recovery					Organics	PPCPs					2026-06-12
Ipconazole	Ipconazole	125225287		ng/L					Organics	Pesticides	Fungicides				2016-07-27
IPI	Score for the Index of Physical-habitat Integrity (IPI)	0	score						Bioassessment						2021-01-28
IPI_Ev_FlowHab_qa	Quality assurance metric for the evenness of flow habitat types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment						2021-01-28
IPI_Ev_FlowHab_score	Scored evenness of flow habitat types physical-habitat metric	0	score						Bioassessment						2021-01-28
IPI_H_AqHab_pred	Predicted Shannon diversity of natural instream cover types physical-habitat metric	0	none						Bioassessment						2021-01-28
IPI_H_AqHab_qa	Quality assurance metric for the Shannon diversity of natural instream cover types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment						2021-01-28
IPI_H_AqHab_score	Scored Shannon diversity of natural instream cover types physical-habitat metric	0	score						Bioassessment						2021-01-28
IPI_H_SubNat_qa	Quality assurance metric for the Shannon diversity of natural substrate types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment						2021-01-28
IPI_H_SubNat_score	Scored Shannon diversity of natural substrate types physical-habitat metric	0	score						Bioassessment						2021-01-28
IPI_IPI_qa	Quality assurance metric for the Index of Physical-habitat Integrity score, calculated as the minimum of other quality assurance metric values	0	count						Bioassessment						2021-01-28
IPI_PCT_SAFN_pred	Predicted percent sands and fines streambed substrate physical-habitat metric	0	%						Bioassessment						2021-01-28
IPI_PCT_SAFN_qa	Quality assurance metric for the percent sands and fines physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment						2021-01-28
IPI_PCT_SAFN_score	Scored percent sands and fines streambed substrate physical-habitat metric	0	score						Bioassessment						2021-01-28
IPI_XCMG_pred	Predicted riparian cover as sum of three layers physical-habitat metric	0	%						Bioassessment						2021-01-28
IPI_XCMG_qa	Quality assurance metric for the riparian cover metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment						2021-01-28
IPI_XCMG_score	Scored riparian cover as sum of three layers physical-habitat metric	0	score						Bioassessment						2021-01-28
Iprodione	Iprodione	36734197		ug/L	ug/Kg dw				Organics	Fungicides					2016-05-20
Iron	Iron	7439896		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Conventionals	Metals				2007-07-27
Irrigation Equipment	Irrigation Equipment	0	none						Habitat						2009-08-20
Isoborneol	Isoborneol	124765			ug/Kg dw				Organics						2018-07-16
Isodrin	Isodrin	0					ug/Kg ww	ug/Kg dw	Organics	Pesticides					2008-11-07
Isodrin-13C12(Surrogate)	Surrogate: Isodrin-13C12	0			% recovery				Organics	Pesticides					2013-06-17
Isofenphos	Isofenphos	25311711		ug/L					Organics	Pesticides					2016-10-25
Isophorone	Isophorone	78591		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2007-07-27
Isopropyl Alcohol	Isopropyl Alcohol (2-propanol)	67630		ug/L											2017-01-12
Isopropylbenzene	Isopropylbenzene (Cumene)	98828		ug/L	ug/Kg dw				Organics	VOCs					2013-05-28
Isopropyltoluene, p-	p-Isopropyltoluene	99876		ug/L					Organics	VOCs					2007-07-27
Isoquinoline	Isoquinoline	119653			ug/Kg dw				Organics						2018-07-16
Isoxaben	Isoxaben (Flexidor) (Gallery)	82558507		ug/L					Organics	Pesticides					2016-05-20
Isoxaben(Surrogate)	Surrogate: Isoxaben (Flexidor) (Gallery)	82558507		% recovery					Organics	Herbicides					2013-05-28
ITEQ	International Toxic Equivalent (ITEQ)	0					pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans					2010-07-15
Jasmolin-1	Jasmolin-1 (Jasmolin I)	4466142		ug/L	ng/g dw				Organics	Pesticides	Pyrethrins	Insecticides			2026-05-08
Jasmolin-2	Jasmolin-2 (Jasmolin II)	1172630		ug/L	ng/g dw				Organics	Pesticides	Pyrethrins	Insecticides			2026-05-08
Kelp holdfast	Kelp holdfast	0	pieces						Debris	Natural	Non-Plastics	Marine Origin			2014-11-04
Kelp Stipe/Blade	Kelp Stipe/Blade	0	pieces						Debris	Natural	Non-Plastics	Marine Origin			2014-11-04
Kepone	Kepone (Chlordecone)	143500		ug/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs				2013-05-28
Ketocarbofuran, 3-	3-Ketocarbofuran	16709301		ug/L					Organics	Pesticides	Pest-Carbamates				2013-05-20
Keyboard	Keyboard	0	pieces						Debris	Trash	Plastics	Toxic			2014-11-04
Kresoxim-methyl	Kresoxim-methyl	143390890		ug/L	ug/Kg dw				Organics	Fungicides					2016-05-20
Lachnospiraceae, Canine (DG37)	Canine Lachnospiraceae, Assay name: DG37, 5'-TTTTCTCCCACGGTCATCTG-3', 5'-CTTGGTTATGGGCGACATTG-3'	0		copies/100 mL					Microbiological						2023-01-27
Landfill Extent	Landfill Extent	0	none						Habitat						2019-05-07
Landfill Intensity	Landfill Intensity	0	none						Habitat						2019-05-07
Landfill Proximity	Landfill Proximity	0	none						Habitat						2019-05-07
Lanthanum	Lanthanum	7439910		ug/L	ug/g dw				Inorganics						2013-05-20
Large/Unmovable, Other	Large/Unmovable, Other	0	pieces						Debris	Trash	Non-Plastics	Large			2014-11-04
Lead	Lead	7439921		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals				2007-07-27
Length	Length	0	m						Tissue	Habitat	WaterQualityMeasurements	Conventionals			2012-06-01
Length Downstream	Length Downstream from X location	0	m						Habitat						2013-05-28
Length Pool	Length Pool	0	m						Habitat						2012-05-22
Length Reach	Length Reach	0	m						Habitat						2013-05-28
Length Riffle	Length Riffle	0	m						Habitat						2012-05-22
Length Root	Length Root	0				mm			Toxicity						2013-05-28
Length Shoot	Length Shoot	0				mm			Toxicity						2013-05-28
Length Upstream	Length Upstream from X location	0	m						Habitat						2013-05-28
Length, Segment	Segment Length	0	m						Habitat						2009-08-20
Leptophos	Leptophos	21609905		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Level Of Trash	Level Of Trash using Trash Protocol	0	score						Trash						2011-05-04
Lid	Lid	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
Light Urban Other Extent	Light Urban Other Extent	0	none						Habitat						2019-05-07
Light Urban Other Intensity	Light Urban Other Intensity	0	none						Habitat						2019-05-07
Light Urban Other Proximity	Light Urban Other Proximity	0	none						Habitat						2019-05-07
Lighter	Lighter	0	pieces						Debris	Trash	Plastics	Toxic			2014-11-04
Liming	Liming	0	none						Habitat						2009-08-20
Limonene, d-	d-Limonene	0			ug/Kg dw				Organics						2018-07-16
Lincomycin	Lincomycin	154212		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Linuron	Linuron	330552		ug/L					Organics	Pesticides	Herbicides				2007-07-27
Linuron-d6(Surrogate)	Surrogate: Linuron-d6	1219804768		% recovery					Organics	Pesticides	Herbicides				2021-10-19
Lipid	Lipid	0		% recovery			NR ww	NR dw	Organics	Inorganics	Conventionals				2007-07-27
Lithium	Lithium	7439932		ug/L			ug/g ww	ug/g dw	Inorganics	Metals					2009-08-05
Littering	Littering using Trash Protocol	0	score						Trash						2011-05-04
Livestock Use	Livestock Use	0	none						Habitat						2009-08-20
Logging	Logging	0	none						Habitat						2009-08-20
Lomefloxacin	Lomefloxacin	98079517		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Loss On Ignition	Loss On Ignition (LOI)	0			% dw				Inorganics	Conventionals					2009-04-21
LWD >0.8 DLE, Length >15m	LWD >0.8 DLE, Length >15m	0	count						Habitat						2009-08-20
LWD >0.8m DLE, Length 1.5-5m	LWD >0.8m DLE, Length 1.5-5m	0	count						Habitat						2009-08-20
LWD >0.8m DLE, Length 5-15m	LWD >0.8m DLE, Length 5-15m	0	count						Habitat						2009-08-20
LWD 0.1-<0.3m DLE, Length >15m	LWD 0.1-<0.3m DLE, Length >15m	0	count						Habitat						2009-08-20
LWD 0.1-<0.3m DLE, Length 1.5-5m	LWD 0.1-<0.3m DLE, Length 1.5-5m	0	count						Habitat						2009-08-20
LWD 0.1-<0.3m DLE, Length 5-15m	LWD 0.1-<0.3m DLE, Length 5-15m	0	count						Habitat						2009-08-20
LWD 0.3-<0.6m DLE, Length >15	LWD 0.3-<0.6m DLE, Length >15	0	count						Habitat						2009-08-20
LWD 0.3-<0.6m DLE, Length 1.5-5m	LWD 0.3-<0.6m DLE, Length 1.5-5m	0	count						Habitat						2009-08-20
LWD 0.3-<0.6m DLE, Length 5-15m	LWD 0.3-<0.6m DLE, Length 5-15m	0	count						Habitat						2009-08-20
LWD 0.6-<0.8m DLE, Length >15m	LWD 0.6-<0.8m DLE, Length >15m	0	count						Habitat						2009-08-20
LWD 0.6-<0.8m DLE, Length 1.5-5m	LWD 0.6-<0.8m DLE, Length 1.5-5m	0	count						Habitat						2009-08-20
LWD 0.6-<0.8m DLE, Length 5-15	LWD 0.6-<0.8m DLE, Length 5-15	0	count						Habitat						2009-08-20
LWD A	Large Woody Debris in the A class of corresponding Diameter and Length categories	0	count						Habitat						2012-05-22
LWD L	Large Woody Debris in the L class of corresponding Diameter and Length categories	0	count						Habitat						2012-05-22
LWD M	Large Woody Debris in the M class of corresponding Diameter and Length categories	0	count						Habitat						2012-05-22
LWD S	Large Woody Debris in the S class of corresponding Diameter and Length categories	0	count						Habitat						2012-05-22
LWD T	Large Woody Debris in the T class of corresponding Diameter and Length categories	0	count						Habitat						2012-05-22
Lyngbyatoxin-a	Lyngbyatoxin-a	0		ug/L					Microbiological	Cyanotoxins					2012-05-22
Macroalgae Cover, Attached	Presence/Absence of attached macroalgae at a point along a transect	0	none						Habitat						2008-12-04
Macroalgae Cover, Unattached	Presence/Absence of unattached macroalgae at a point along a transect	0	none						Habitat						2008-12-04
Macroinvertebrate Habitat Patch Richness Metric	Metric assesses macroinvertebrate habitat patch richness along the channel edge and bank within the assessment area.	0	score						Habitat						2019-05-13
Macrophyte Cover	Presence/Absence of macrophytes at a point along a transect	0	none						Habitat						2008-12-04
Magnesium	Magnesium	7439954		ug/L	mg/Kg dw		ug/g ww	ug/g dw	Inorganics	Conventionals	Metals	AlkalineEarthMetals			2007-07-27
Maintained Lawns	Maintained Lawns	0	none						Habitat						2009-08-20
Malachite Green	Malachite Green	569642		ug/L					Organics						2017-07-26
Malaoxon	Malaoxon	1634782		ug/L					Organics	Pesticides					2016-03-10
Malathion	Malathion	121755		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Endocrine Disruptors		2007-07-27
Male-specific F+ Coliphage (E. coli Famp)	Male-specific F+ coliphages, Host Bacterium Strain: E. coli Famp	0		PFU/L											2022-02-11
Malonate(Surrogate)	Surrogate: Malonate	141822		% recovery											2025-12-10
Mancozeb	Mancozeb	0		ug/L					Organics	Pesticides	Fungicides				2017-04-04
Mandipropamid	Mandipropamid	374726622		ng/L					Organics	Pesticides	Fungicides				2016-09-06
Manganese	Manganese	7439965		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals	Conventionals			2007-07-27
Marbon CNB 23010-1	Marbon CNB 23010 (VCH-DP isomer 1)	26595573			ng/g dw				Organics	FlameRetardants					2015-07-16
Marbon CNB 23010-2	Marbon CNB 23010 (VCH-DP isomer 2)	26595573			ng/g dw				Organics	FlameRetardants					2015-07-16
Marine, Other	Marine, Other	0	pieces						Debris	Natural	Non-Plastics	Marine Origin			2014-11-04
MBAS	MBAS (Methylene Blue Active Substances)	0		ug/L	mg/Kg dw				Inorganics	Surfactants					2013-05-28
MCPA	MCPA (2-Methyl-4-chlorophenoxy)Acetic Acid) (2,4-MCPA)	94746		ug/L	ug/kg				Organics	Herbicides					2013-05-28
MCPA, dimethylamine salt	MCPA, dimethylamine salt	2039465		ug/L					Organics	Pesticides					2017-04-20
MCPP	MCPP (2-(2-Methyl-4-chlorophenoxy) Propionic Acid)	93652		ug/L	ug/kg				Organics	Herbicides					2013-05-28
Mean Growth (Ash Free Dry Weight)	Mean Growth (Ash Free Dry Weight)	0				mg			Toxicity	Endpoint					2014-02-05
Mean Percent Normal Alive	The observed number of normal larvae divided by the mean number of live embryos inoculated at the beginning of the test	0				%			Toxicity	Endpoint					2014-02-05
Mechanical Pencil	Mechanical Pencil	0	pieces						Debris	Trash	Plastics	Household			2014-11-04
Median Grain Size	Median Grain Size	0			mm				Inorganics	Conventionals					2016-07-11
Medical Device	Medical Device	0	pieces						Debris	Trash	Plastics	Toxic			2014-11-04
Menthol	Menthol	0			ug/Kg dw				Organics						2018-07-16
Meprobamate	Meprobamate	57534		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Mercury	Mercury	7439976		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals				2007-07-27
Mercury (II)R	Reactive Mercury	0		ug/L					Inorganics	Metals					2014-01-29
Mercury, Acid Labile	Acid Labile Mercury	0		ug/L					Inorganics	Metals					2014-01-29
Mercury, Extract Fraction 1	Mercury selective sequential extraction, Fraction 1	0			ng/g dw				Inorganics						2020-10-27
Mercury, Extract Fraction 2	Mercury selective sequential extraction, Fraction 2	0			ng/g dw				Inorganics						2020-10-27
Mercury, Extract Fraction 3	Mercury selective sequential extraction, Fraction 3	0			ng/g dw				Inorganics						2020-10-27
Mercury, Extract Fraction 4	Mercury selective sequential extraction, Fraction 4	0			ng/g dw				Inorganics						2020-10-27
Mercury, Extract Fraction 5	Mercury selective sequential extraction, Fraction 5	0			ng/g dw				Inorganics						2020-10-27
Mercury, Methyl	Methyl Mercury	22967926		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals				2007-07-27
Merphos	Merphos (Tributylphosphorotrithioite)	150505		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs				2007-07-27
Metabolite B	Metabolite B (metabolite of Benzobicyclon)	0		ug/L											2017-12-12
Metal Object	Metal Object	0	pieces						Debris	Trash	Non-Plastics	Metals			2014-11-04
Metal Pipe/Bar	Metal Pipe/Bar	0	pieces						Debris	Trash	Non-Plastics	Metals			2014-11-04
Metal, Other	Metal, Other	0	pieces						Debris	Trash	Non-Plastics	Metals			2014-11-04
Metalaxyl	Metalaxyl	57837191		ug/L	ug/Kg dw				Organics	Herbicides					2013-05-20
Metconazole	Metconazole	125116236		ug/L	ug/Kg dw				Organics	Fungicides					2016-05-20
MeterAveragingInterval	Time period (seconds) upon which the meter reading is averaged internally to attain a result	0		seconds					WaterQualityMeasurements						2012-05-22
Metformin	Metformin	657249		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Metformin-d6(Surrogate)	Surrogate: Metformin-d6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Methadone	Methadone	76993		ng/L											2018-08-20
Methamidophos	Methamidophos (O,S-Dimethyl thiophosphate)	10265926		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs	Insecticides			2013-05-28
Methidathion	Methidathion	950378		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Methidathion oxon	Methidathion oxon	0		ug/L					Organics	Pesticides					2017-04-20
Methiocarb	Methiocarb	2032657		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
Methiocarb sulfone	Methiocarb sulfone	2179251		ug/L					Organics	Pesticides					2017-04-20
Methiocarb sulfoxide	Methiocarb sulfoxide	2635101		ug/L					Organics	Pesticides					2017-04-20
Methomyl	Methomyl	16752775		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Methoprene	Methoprene	40596698		ug/L	ug/Kg dw				Organics	Pesticides					2008-11-17
Methoxychlor	Methoxychlor	72435		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors		2007-07-27
Methoxychlor(Surrogate)	Surrogate: Methoxychlor	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	OrganochlorinePesticides	Semi-VOAs	Insecticides	Endocrine Disruptors	2011-07-15
Methoxychlor-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Methoxychlor-13C12	0			% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-03
Methoxychlor-d6(Surrogate)	Surrogate: Methoxychlor-d6	0			% recovery				Organics	Pesticides					2013-06-17
Methoxyfenozide	Methoxyfenozide	161050584		ug/L					Organics	Pesticides	Insecticides				2016-03-10
Methoxy-methylsulfanylphosphoryl acetamide, N-	N-Methoxy-methylsulfanylphosphoryl acetamide (Acephate)	0		ug/L					Organics	Pesticides	Insecticides				2017-04-04
Methyl (3,4-dichlorophenyl)carbamate	Methyl (3,4-dichlorophenyl)carbamate (Swep)	1918189		ug/L					Organics	Pesticides	Pest-Carbamates				2013-05-28
Methyl 2,4-dichlorophenylacetate	Methyl 2,4-dichlorophenylacetate (2,4-DCAA)	55954239		ug/L											2017-01-12
Methyl 3-Amino-2,5-dichlorobenzoate	Methyl 3-Amino-2,5-dichlorobenzoate (Chloramben Methyl)	7286840		ug/L					Organics	Herbicides					2013-05-20
Methyl paraoxon	Methyl paraoxon	950356		ug/L					Organics	Pesticides					2017-04-20
Methyl Perfluoroocatanesulfonamidoacetic Acid, N-	N-Methyl Perfluoroocatanesulfonamidoacetic Acid (NMeFOSAA)	2355319		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS					2025-01-27
Methyl Perfluorooctane Sulfonamido Acetic Acid, N-	N-Methyl Perfluorooctane Sulfonamido Acetic Acid (Me-PFOSA-AcOH)	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS	PFC Precursor				2014-10-20
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3 (N-MeFOSAA-d3)	1400690701		% recovery					Organics	PFAS	IDA				2025-04-03
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(Surrogate)	Surrogate: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3	0					% recovery	% recovery	Organics	PFAS	PFC Precursor				2014-11-03
Methyl Perfluorooctanesulfonamide, N-	N-Methyl Perfluorooctanesulfonamide (NMeFOSA)	31506328		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-04-04
Methyl Perfluorooctanesulfonamide-d3, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctanesulfonamide-d3 (NMeFOSA-d3)	936109374		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Methyl Perfluorooctanesulfonamidoacetic Acid, N-	N-Methyl Perfluorooctanesulfonamidoacetic Acid (NMeFOSAA)	2355319		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-04-03
Methyl Perfluorooctanesulfonamidoacetic Acid-d3, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctanesulfonamidoacetic Acid-d3 (NMeFOSAA-d3)	1400690701		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Methyl Perfluorooctanesulfonamidoethanol, N-	N-Methyl Perfluorooctanesulfonamidoethanol (NMeFOSE)	24448097		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-04-25
Methyl Perfluorooctanesulfonamidoethanol-d7, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctanesulfonamidoethanol-d7 (NMeFOSE-d7)	1265205955		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Methyl Tert-butyl Ether	Methyl Tert-butyl Ether (MTBE)	1634044		ug/L					Organics	VOCs	MTBE_BTEX				2013-05-28
Methyl-1(H)-indole, 3-	3-Methyl-1(H)-indole (Skatole)	83341			ug/Kg dw				Organics						2018-07-16
Methyl-1H-benzotriazole, 5-	5-Methyl-1H-benzotriazole	136856		ng/L					Organics						2018-07-16
Methyl-2-pentanone, 4-	4-Methyl-2-pentanone (Methyl Isobutyl Ketone)	108101		ug/L					Organics	VOCs					2013-05-28
Methylanthracene	Methylanthracene	0		pg/L	ug/Kg dw				Organics	PAHs					2014-01-28
Methylanthracene, 2-	2-Methylanthracene	613127			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	Semi-VOAs				2010-07-08
Methylbenzo(a)pyrene, 7-	7-Methylbenzo(a)pyrene	63041770		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs					2013-08-27
Methylchlolanthrene, 3-	Methylchlolanthrene, 3-	0		ng/L					Organics	PAHs					2016-05-20
Methylchrysene, 1-	1-Methylchrysene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Methylchrysene, 5/6-	5-Methylchrysene/6-Methylchrysene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs					2011-06-20
Methyldibenzothiophene, 2-	2-Methyldibenzothiophene	0		ng/L					Organics	PAHs					2014-01-28
Methyldibenzothiophene, 4-	4-Methyldibenzothiophene	7372885		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs				2007-07-27
Methyldibenzothiophenes, 2/3-	2-Methyldibenzothiophene/3-Methyldibenzothiophene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs					2010-09-23
Methylene Chloride	Methylene Chloride (Dichloromethane)	75092		ug/L					Organics	VOCs					2013-05-28
Methylenebis(2-chloroaniline), 4,4'-	4,4'-Methylenebis(2-chloroaniline)	0					ug/Kg ww	ug/Kg dw	Organics	VOCs					2014-01-29
Methylfluoranthene, 2-	2-Methylfluoranthene	33543316		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Methylfluoranthene, 3-	3-Methylfluoranthene	0		ng/L					Organics	PAHs					2014-01-28
Methylfluoranthene, 3-/Benzo(a)fluorene	3-Methylfluoranthene/Benzo(a)fluorene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	HMW_PAH				2018-07-24
Methylfluorene, 1-	1-Methylfluorene	1730376		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs				2007-07-27
Methylfluorene, 2-	2-Methylfluorene	1430973		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Semi-VOAs				2010-07-08
Methylisoborneol, 2-	2-Methylisoborneol	2371428		ng/L					Organics	Terpenes/Terpinoids					2025-11-05
Methylnaphthalene, 1-	1-Methylnaphthalene	90120		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Methylnaphthalene, 2-	2-Methylnaphthalene	91576		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Methylnaphthalene-d10, 2-(IsoDilAnalogue)	Isotope Dilution Analogue: 2-Methylnaphthalene-d10	7297452		% recovery					Organics	PAHs	IDA				2023-11-14
Methylnaphthalene-d10, 2-(Surrogate)	Surrogate: 2-Methylnaphthalene-d10	7297452		% recovery	% recovery		% recovery	% recovery	Organics	PAHs					2025-09-04
Methyl-perfluorooctanesulfonamide-d3, N-(Surrogate)	Surrogate: Methyl-perfluorooctanesulfonamide-d3, N- (N-MeFOSA)	0					% recovery	% recovery	Organics	PFAS					2021-06-02
Methyl-perfluorooctanesulfonamidoethanol, N-	N-Methyl-perfluorooctanesulfonamidoethanol	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2010-02-23
Methyl-perfluorooctanesulfonamidoethanol-d7, N-(Surrogate)	Surrogate: N-Methyl-perfluorooctanesulfonamidoethanol-d7	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2010-02-23
Methylphenanthrene	Methylphenanthrene	0		ng/L					Organics						2017-05-04
Methylphenanthrene, 1-	1-Methylphenanthrene	832699		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Methylphenanthrene, 2-	2-Methylphenanthrene	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs					2014-01-28
Methylphenanthrene, 3-	3-Methylphenanthrene	832713			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2014-12-08
Methylphenanthrene, 3/4-	3/4-Methylphenanthrene	0					ug/Kg ww	ug/Kg dw	Organics	PAHs					2014-12-23
Methylphenanthrene, 9/4-	9/4-Methylphenanthrene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	LMW_PAH			2014-12-08
Methylphenanthrene-d10, 2-(Surrogate)	Surrogate: 2-Methylphenanthrene-d10	0		% recovery					Organics	PAHs					2012-04-04
Methylphenol, 2-	2-Methylphenol	95487		ug/L	ug/Kg dw				Organics	SVOCs	Phenols	non-Chlorinated Phenols			2007-07-27
Methylphenol, 3-	3-Methylphenol	0		ug/L					Organics	SVOCs					2016-05-20
Methylphenol, 3/4-	3-Methylphenol/4-Methylphenol	106445		ug/L	ug/Kg dw				Organics	SVOCs	Phenols	non-Chlorinated Phenols			2007-07-27
Methylphenol, 4-	4-Methylphenol	0		ug/L	ug/Kg dw				Organics	SVOCs					2016-05-20
Methylprednisolone	Methylprednisolone	83432		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Methylprednisolone-d2(Surrogate)	Surrogate: Methylprednisolone-d2	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Methylpyridine, 2-	2-Methylpyridine	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	VOCs					2014-02-05
Metolachlor	Metolachlor	51218452		ug/L	ug/Kg dw				Organics	Herbicides					2007-07-27
Metolachlor ethanesulfonic acid	Metolachlor ethanesulfonic acid	171118095		ug/L					Organics	Pesticides					2017-04-20
Metolachlor oxanilic acid	Metolachlor oxanilic acid	0		ug/L					Organics	Pesticides					2017-04-20
Metolachlor, S-	S-Metolachlor	87392129		ug/L					Organics	Pesticides					2019-06-13
Metoprolol	Metoprolol	51384511		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Metoprolol-d7(Surrogate)	Surrogate: Metoprolol-d7	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Metribuzin	Metribuzin	21087649		ug/L			ng/g ww	ng/g dw	Organics	Herbicides					2007-07-27
Metsulfuron Methyl	Metsulfuron Methyl	74223646		ug/L					Organics	Herbicides					2013-05-20
Mevinphos	Mevinphos (Phosdrin)	7786347		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Mexacarbate	Mexacarbate	315184		ug/L					Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
MGK 264	MGK 264 (N-(2-Ethylhexyl)-5-norbornene-2,3-dicarboximide)	0		ug/L											2017-01-12
Miconazole	Miconazole	22916478		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Microalgae Thickness	Thickness of microalgae (if present) at a point along a transect	0	none						Habitat						2008-12-04
Microcystin-[Dha7]LR	Microcystin-[dehydroalanine7]LR	0		ug/L											2019-03-21
Microcystin-[DLeu1]LR	Microcystin-[deleucine1]LR	0		ug/L											2019-03-21
Microcystin-HilR	Microcystin- homoisoleucineR	0		ug/L											2019-03-21
Microcystin-HtyR	Microcystin-homotyrosineR	0		ug/L											2019-03-21
Microcystin-LA	Microcystin-LA (MCY-LA)	96180799		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2013-05-28
Microcystin-LF	Microcystin-LF (MCY-LF)	154037704		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2013-05-28
Microcystin-LR	Microcystin-LR (MCY-LR)	101043372		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2013-05-28
Microcystin-LW	Microcystin-LW (MCY-LW)	157622021		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2013-05-28
Microcystin-LY	Microcystin-LY (MCY-LY)	123304109		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2013-05-28
Microcystin-RR	Microcystin-RR (MCY-RR)	111755374		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2013-05-28
Microcystins gene, Prokaryotic DNA (mcyE)	Microcystins gene, Prokaryotic DNA, Target Gene: mcyE, Proprietary primer sequences from Bend Genetics LLC	0		gc/mL					Microbiological	Cyanotoxins	Gene Marker				2026-05-27
Microcystins, Total	Total Microcystins	0		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2014-03-07
Microcystin-WR	Microcystin-WR (MCY-WR)	0		ug/L			ng/g ww	ng/g dw							2019-03-21
Microcystin-YR	Microcystin-YR (MCY-YR)	101064486		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2013-05-28
Military Land Extent	Military Land Extent	0	none						Habitat						2019-05-07
Military Land Intensity	Military Land Intensity	0	none						Habitat						2019-05-07
Military Land Proximity	Military Land Proximity	0	none						Habitat						2019-05-07
Milk Carton	Milk Carton	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
Mines, Quaries	Mines, Quaries	0	none						Habitat						2009-08-20
Mining Extent	Mining Extent	0	none						Habitat						2019-05-07
Mining Intensity	Mining Intensity	0	none						Habitat						2019-05-07
Mining Proximity	Mining Proximity	0	none						Habitat						2019-05-07
Mirex	Mirex	2385855		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors		2007-07-27
Mirex(Surrogate)	Surrogate: Mirex	2385855		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2013-06-17
Mirex-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Mirex-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
Mirex-13C10(Surrogate)	Surrogate: Mirex-13C10	0			% recovery				Organics	Pesticides					2014-01-28
Miscellaneous	Miscellaneous using Trash Protocol	0	L						Trash						2011-05-04
Miscellaneous, Other	Miscellaneous, Other	0	pieces						Debris	Trash	Plastics	Miscellaneous			2014-11-04
Moisture	Moisture	0		ug/L	mg/Kg dw		NR ww	NR dw	Organics	Inorganics	Conventionals				2007-07-27
Molinate	Molinate (Ordram)	2212671		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OPs				2007-07-27
Molybdenum	Molybdenum	7439987		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals					2007-07-27
Molybdenum, Acid Labile	Acid Labile Molybdenum	0		mg/L					Inorganics	Metals					2010-11-11
Monobromophenyl-hexachloro-norbornene-1	Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 1)	0			ng/g dw				Organics	FlameRetardants					2015-07-16
Monobromophenyl-hexachloro-norbornene-2	Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 2)	0			ng/g dw				Organics	FlameRetardants					2015-07-16
Monobromophenyl-hexachloro-norbornene-3	Monobromophenyl-hexachloro-norbornene (Br-DEC604 isomer 3)	0			ng/g dw				Organics	FlameRetardants					2015-07-16
Monobutyl Monooctyl-Diphenylamine	Monobutyl Monooctyl-Diphenylamine (SDPA-C4C8)	0		ng/L					Organics	Substituted Diphenylamines (SDPAs)					2026-02-10
Monobutyltin as Sn	Monobutyltin as Sn (MBT)	78763549		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Organotins	Biocide				2010-06-21
Monocrotophos	Monocrotophos	6923224		ug/L	mg/Kg ww				Organics	Pesticides	Insecticides	Organophosphorous			2014-01-28
Mono-dechlorinated Dechlorane Plus	Mono-dechlorinated Dechlorane Plus (C11-DP)	0			ng/g dw				Organics	FlameRetardants					2014-03-13
Monomethylarsonic Acid	Monomethylarsonic Acid	0					ug/g ww	ug/g dw	Inorganics	Metals					2014-01-29
Monuron	Monuron	150685		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Monuron(Surrogate)	Surrogate: Monuron	150685		% recovery											2016-12-21
Mortality/Normality	Mortality/Normality (%)	0				%			Toxicity						2007-07-27
Motor Oil	Motor Oil	0		ug/L					Organics	PAHs					2014-01-28
Mountain Bikes Extent	Mountain Bikes Extent	0	none						Habitat						2019-05-07
Mountain Bikes Intensity	Mountain Bikes Intensity	0	none						Habitat						2019-05-07
Mountain Bikes Proximity	Mountain Bikes Proximity	0	none						Habitat						2019-05-07
Mowing/Cutting Extent	Mowing/Cutting Extent	0	none						Habitat						2019-05-07
Mowing/Cutting Intensity	Mowing/Cutting Intensity	0	none						Habitat						2019-05-07
Mowing/Cutting Proximity	Mowing/Cutting Proximity	0	none						Habitat						2019-05-07
Musk Ambrette	Musk Ambrette	0					ng/g ww	ng/g dw	Organics	Musk					2013-05-29
Musk Ketone	Musk Ketone	0					ng/g ww	ng/g dw	Organics	Musk					2013-05-29
Musk Moskene	Musk Moskene	0					ng/g ww	ng/g dw	Organics	Musk					2013-05-29
Musk Xylene	Musk Xylene	0					ng/g ww	ng/g dw	Organics	Musk					2013-05-29
Myclobutanil	Myclobutanil	88671890		ug/L	ug/Kg dw				Organics	Fungicides					2016-05-20
N,N-Diethyl-3-methyl-benzamide-d7(Surrogate)	Surrogate: N,N-Diethyl-3-methyl-benzamide-d7	0		% recovery					Organics	PPCPs					2013-05-30
Nail/Screw/Bolt	Nail/Screw/Bolt	0	pieces						Debris	Trash	Non-Plastics	Metals			2014-11-04
Naled	Naled (Dibrom)	300765		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Rodenticides		2007-07-27
Naphthalene	Naphthalene	91203		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH	VOCs		2007-07-27
Naphthalene-d8(IsoDilAnalogue)	Isotope Dilution Analogue: Naphthalene-d8	1146652		% recovery					Organics	PAHs	IDA				2023-11-07
Naphthalene-d8(Surrogate)	Surrogate: Naphthalene-d8	1146652		% recovery	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	Insecticides			2007-07-27
Naphthalenes, C1-	C1-Naphthalenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Naphthalenes, C2-	C2-Naphthalenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Naphthalenes, C3-	C3-Naphthalenes	0		uS/cm	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Naphthalenes, C4-	C4-Naphthalenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Naphthobenzothiophene	Naphthobenzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Naphthobenzothiophene, C1-	C1-Naphthobenzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Naphthobenzothiophene, C2-	C2-Naphthobenzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Naphthobenzothiophene, C3-	C3-Naphthobenzothiophene	0		ng/L			ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Naphthylamine, 2-	2-Naphthylamine	0		ug/L											2017-11-08
Napropamide	Napropamide	15299997		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides				2013-05-28
Naproxen	Naproxen	22204531		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Naproxen-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Naproxen-d3	958293771		% recovery					Organics						2022-07-22
Naproxen-d3(Surrogate)	Surrogate: Naproxen-d3	958293771		% recovery					Organics	PPCPs	Pharmaceuticals				2026-06-12
Naproxen-d3-13C(Surrogate)	Surrogate: Naproxen-d3-13C	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Napthalene	Napthalene	0		ug/L					Organics						2016-12-21
Natural, cotton/wool	Natural, cotton/wool	0	pieces						Debris	Trash	Non-Plastics	Biodegradable			2014-11-04
Neburon	Neburon	555373		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Neodymium	Neodymium	7440008		ug/L					Inorganics						2013-05-20
Nickel	Nickel	7440020		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals				2007-07-27
Nicosulfuron	Nicosulfuron	111991094		ug/L					Organics	Herbicides					2013-05-20
NID as CTAS	4-Nitro-Inden-1-One (NID) as Cobalt Thiocyanate Active Substances (CTAS)	0		mg/L											2016-12-23
Nitrate + Nitrite as N	Nitrate + Nitrite as N	0		umol/L	ug/g dw				Inorganics	Conventionals	Nutrients				2013-05-28
Nitrate as N	Nitrate as N	14797558		umol/L	mg/Kg ww				Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			2007-07-27
Nitrate as NO3	Nitrate as Nitrate	14797558		mg/L					Inorganics	Conventionals					2016-05-20
Nitrate as NO3, Daily Mean	Daily Mean Nitrate as Nitrate (Calculated)	14797558		umol/L					WaterQualityMeasurements	Conventionals	Inorganics	Nutrients			2024-09-06
Nitrite as N	Nitrite as N	14797650		umol/L	mg/Kg ww				Inorganics	Conventionals	Nutrients				2007-07-27
Nitroaniline, 2-	2-Nitroaniline	88744		ug/L	ug/Kg dw				Organics	SVOCs					2007-07-27
Nitroaniline, 3-	3-Nitroaniline	99092		ug/L	ug/Kg dw				Organics	SVOCs					2007-07-27
Nitroaniline, 4-	4-Nitroaniline	100016		ug/L	ug/Kg dw				Organics	SVOCs					2007-07-27
Nitrobenzene	Nitrobenzene	98953		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs					2007-07-27
Nitrobenzene-d5(Surrogate)	Surrogate: Nitrobenzene-d5	4165600		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs					2016-03-02
Nitrogen Oxide	Nitrogen Oxide	10102439		RPD					Inorganics	Conventionals					2014-01-22
Nitrogen, Inorganic	Inorganic Nitrogen as N	0		mg/L					Inorganics						2012-10-29
Nitrogen, Organic	Organic Nitrogen as N	7727379		ug/L	mg/Kg nr				Inorganics	Conventionals	Nutrients				2012-01-11
Nitrogen, Total	Total Nitrogen	0		ug/L	ug/Kg dw		%	%	Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			2011-11-10
Nitrogen, Total Kjeldahl	Total Kjeldahl Nitrogen (TKN)	7727379		ug/L	ug/g dw				Inorganics	Conventionals	Nutrients				2007-07-27
Nitrogen-15/Nitrogen-14 Ratio	Nitrogen-15/Nitrogen-14 Ratio (Delta 15N nitrate isotope)	0		per mil											2019-03-26
Nitrophenol, 2-	2-Nitrophenol	88755		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols		2007-07-27
Nitrophenol, 4-	4-Nitrophenol	100027		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols		2007-07-27
Nitrosodiethylamine, N-	N-Nitrosodiethylamine	0		ng/L					Organics	VOCs					2017-03-29
Nitrosodimethylamine, N-	N-Nitrosodimethylamine	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	SVOCs					2014-01-29
Nitrosodimethylamine-d6, N-(Surrogate)	Surrogate: N-Nitrosodimethylamine-d6	0		% recovery					Organics	SVOCs					2017-03-29
Nitrosodi-n-propylamine, N-	N-Nitrosodi-n-propylamine	621647		ug/L	ug/Kg dw				Organics	SVOCs					2007-07-27
Nitrosodiphenylamine, N-	N-Nitrosodiphenylamine	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2014-01-29
Nitrosomethylethylamine, N-	N-Nitrosomethylethylamine	0		ng/L					Organics	SVOCs					2017-03-29
No Debris Collected	No Debris Collected	0	pieces						Debris	Trash	Survey				2014-11-04
No Debris Present	No Debris Present	0	pieces						Debris	Trash	Survey				2014-11-04
Nodularin	Nodularin	118399227		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2012-05-22
NoItems	Number of Items using Trash Protocol	0	score						Trash						2011-05-04
Nonachlor, cis-	cis-Nonachlor	5103731		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2007-07-27
Nonachlor, cis-(Surrogate)	Surrogate: cis-Nonachlor	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2008-11-17
Nonachlor, trans-	trans-Nonachlor	39765805		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2007-07-27
Nonachlor, trans-(Surrogate)	Surrogate: trans-Nonachlor	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2008-11-17
Nonachlor-13C10, cis-(IsoDilAnalogue)	Isotope Dilution Analogue: cis-Nonachlor-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
Nonachlor-13C10, trans-(IsoDilAnalogue)	Isotope Dilution Analogue: trans-Nonachlor-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
Nonacosane, n-	n-Nonacosane	630035					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Nonadecane, n-	n-Nonadecane	629925					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Nonafluoro-3,6-Dioxaheptanoic Acid	Nonafluoro-3,6-Dioxaheptanoic Acid (NFDHA)	151772586		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-04-04
Nonane(Surrogate)	Surrogate: Nonane	111842		% recovery					Organics						2017-08-10
None	Used for non-treated samples	0	none						WaterQualityMeasurements	ToxTreatment					2007-07-27
NonPoint Source Discharges Stormwater Extent	NonPoint Source Discharges Stormwater Extent	0	none						Habitat						2019-05-07
NonPoint Source Discharges Stormwater Intensity	NonPoint Source Discharges Stormwater Intensity	0	none						Habitat						2019-05-07
NonPoint Source Discharges Stormwater Proximity	NonPoint Source Discharges Stormwater Proximity	0	none						Habitat						2019-05-07
Nonylphenol	Nonylphenol	25154523		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Surfactants	Phenols	non-Chlorinated Phenols	Endocrine Disruptors		2007-07-27
Nonylphenol Diethoxylate, 4-	4-Nonylphenol Diethoxylate	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2013-05-29
Nonylphenol diethoxylate, tech-	tech-Nonylphenol diethoxylate	0		ug/L											2021-01-14
Nonylphenol Diethoxylate-13C6, 4-(Surrogate)	Surrogate: 4-Nonylphenol Diethoxylates-13C6	0		% recovery			% recovery	% recovery	Organics	PPCPs					2013-05-29
Nonylphenol monoethoxylate	Nonylphenol monoethoxylate	0		ug/L											2021-01-14
Nonylphenol Monoethoxylate, 4-	4-Nonylphenol Monoethoxylate	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2013-05-29
Nonylphenol monoethoxylate, 4-n-	4-n-Nonylphenol monoethoxylate	104358		ug/L											2022-02-11
Nonylphenol Monoethoxylate-13C6, 4-(Surrogate)	Surrogate: 4-Nonylphenol Monoethoxylate-13C6	0					% recovery	% recovery	Organics	PPCPs					2013-05-29
Nonylphenol, 4-n-	4-n-Nonylphenol	104405		ug/L	ug/Kg dw				Organics	Surfactants					2016-05-20
Nonylphenol, p-	p-Nonylphenol	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Surfactants	Phenols				2011-05-11
Nonylphenol, tech-	tech-Nonylphenol (Branched p-nonylphenol)	84852153		ug/L					Organics	Surfactants					2016-05-20
Nonylphenol-13C6, 4-n-(Surrogate)	Surrogate: 4-n-Nonylphenol-13C6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2013-06-25
Nonylphenolethoxylate	Nonylphenolethoxylate	9016459		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Surfactants	Phenols	non-Chlorinated Phenols	Endocrine Disruptors		2007-07-27
Norfloxacin	Norfloxacin	70458967		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Norfluoxetine	Norfluoxetine	83891036		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2025-08-25
Norfluoxetine-d5(Surrogate)	Surrogate: Norfluoxetine-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Norflurazon	Norflurazon (3(2H)-Pyridazinone, 4-chloro-5-(methylamino)-2-[3-(trifluoromethyl)phenyl]-) (Telok)	27314132		ug/L					Organics	Pesticides	Herbicides				2013-05-20
Norgestimate	Norgestimate	35189287		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Normal Development	Normal Development (%)	0		%	%	%			Toxicity						2007-07-27
Norverapamil	Norverapamil	67018853		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Novaluron	Novaluron	116714466		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides				2016-03-10
Noxious Chemical Odors Extent	Noxious Chemical Odors Extent	0	none						Habitat						2019-05-07
Noxious Chemical Odors Intensity	Noxious Chemical Odors Intensity	0	none						Habitat						2019-05-07
Noxious Chemical Odors Proximity	Noxious Chemical Odors Proximity	0	none						Habitat						2019-05-07
Nutrient Related Water Other Extent	Nutrient Related Water Other Extent	0	none						Habitat						2019-05-07
Nutrient Related Water Other Intensity	Nutrient Related Water Other Intensity	0	none						Habitat						2019-05-07
Nutrient Related Water Other Proximity	Nutrient Related Water Other Proximity	0	none						Habitat						2019-05-07
O,O,O-Triethyl phosphorothioate	O,O,O-Triethyl phosphorothioate	0		ug/L											2017-01-12
ObservedChannelFlowLevel	ObservedChannelFlowLevel	0	none	cm					FieldObservations	Habitat					2011-05-31
ObservedFlow	ObservedFlow	0	none	cfs					FieldObservations	Habitat					2009-08-20
Obstructions (culverts, paved stream crossings) Extent	Obstructions (culverts, paved stream crossings) Extent	0	none						Habitat						2019-05-07
Obstructions (culverts, paved stream crossings) Intensity	Obstructions (culverts, paved stream crossings) Intensity	0	none						Habitat						2019-05-07
Obstructions (culverts, paved stream crossings) Proximity	Obstructions (culverts, paved stream crossings) Proximity	0	none						Habitat						2019-05-07
OCDD, 1,2,3,4,6,7,8,9-	1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD)	3268879		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
OCDD, 1,2,3,4,6,7,8,9- (TEQ ND=0)	1,2,3,4,6,7,8,9-OCDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
OCDD, 1,2,3,4,6,7,8,9- (TEQ ND=1/2 DL)	1,2,3,4,6,7,8,9-OCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
OCDD, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD)	3268879		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
OCDD-13C, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin-13C (OCDD)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-06-05
OCDD-13C12, 1,2,3,4,6,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin-13C12 (OCDD-13C12)	114423971		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
OCDF, 1,2,3,4,6,7,8,9-	1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF)	39001020		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
OCDF, 1,2,3,4,6,7,8,9- (TEQ ND=0)	1,2,3,4,6,7,8,9-OCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
OCDF, 1,2,3,4,6,7,8,9- (TEQ ND=1/2 DL)	1,2,3,4,6,7,8,9- OCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
OCDF, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF)	39001020		% recovery					Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
OCDF-13C, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran-13C (OCDF)	0					% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-06-05
Octachlorostyrene	Octachlorostyrene	0		pg/L			ug/Kg ww	ug/Kg dw	Organics	VOCs					2014-01-29
Octachlorostyrene-13C8(Surrogate)	Surrogate: Octachlorostyrene-13C8	0			% recovery				Organics	VOCs					2014-01-29
Octacosane, n-	n-Octacosane	0		ug/L	mg/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Alkanes					2014-01-28
Octacosane, n-(Surrogate)	Surrogate: n-Octacosane	0		% recovery	% recovery				Organics	Alkanes					2016-10-31
Octadecane, n-	n-Octadecane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes					2014-01-28
Octamethylcyclotetrasiloxane	Octamethylcyclotetrasiloxane	556672			ug/Kg dw										2021-05-19
Octylphenol	Octylphenol	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Octylphenol diethoxylate, tert-4-	4-tert-Octylphenol diethoxylate (OP2EO)	2315619		ng/L	ug/Kg dw				Organics	Phenols					2018-07-18
Octylphenol monoethoxylate, 4-	4-Octylphenol monoethoxylate	0		ug/L											2021-01-14
Octylphenol monoethoxylate, 4-n-	4-n-Octylphenol monoethoxylate	51437899		ug/L											2022-02-11
Octylphenol monoethoxylate, tert-4-	4-tert-Octylphenol monoethoxylate (OP1EO)	2315675		ng/L	ug/Kg dw				Organics	Phenols					2018-07-18
Octylphenol, 4-	4-Octylphenol	1806264		ug/L											2018-08-31
Octylphenol, 4-n-	4-n-Octylphenol	1806264		ug/L											2022-02-11
Octylphenol, tert-4-	4-tert-Octylphenol	140669		ug/L	ug/Kg dw				Organics	Phenols					2018-07-18
Odor	Odor	0	none	TON	none				FieldObservations	Habitat					2009-08-20
Odor Intensity	Odor Intensity - Specific to EMAP BA (characterizes intensity of odor)	0	none						Habitat						2009-08-20
Ofloxacin	Ofloxacin	82419361		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Oil, Gas Wells	Oil, Gas Wells	0	none						Habitat						2009-08-20
OilandGrease	Oil & Grease	0		mg/L					Inorganics	Conventionals					2007-07-27
OilandGrease; HEM	Oil and Grease, N-Hexane Extractable Material	0		mg/L	mg/Kg dw				Organics	PAHs					2013-09-24
OilandGrease; SGT-HEM	Oil and Grease, Silica Gel Treated N-Hexane Extractable Material (Non-Polar Material Not Adsorbed by Silica Gel)	0		mg/L	mg/Kg dw				Organics	PAHs					2013-09-24
Okadaic Acid	Okadaic Acid	78111178		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2013-05-28
Open Shell Volume	Open Shell Volume (weight (in grams) of water displaced by each empty bivalve)	0					mL	mL	Organics	Inorganics	Metals	Conventionals	Semi-VOAs	VOAs	2012-11-08
Orchards	Orchards	0	none						Habitat						2009-08-20
Orchards Extent	Orchards Extent	0	none						Habitat						2019-05-07
Orchards Intensity	Orchards Intensity	0	none						Habitat						2019-05-07
Orchards Proximity	Orchards Proximity	0	none						Habitat						2019-05-07
Ormetoprim	Ormetoprim	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
OrthoPhosphate as P	Reactive Phosphorous (PO4)	14265442		umol/L					Inorganics	Conventionals	Nutrients				2007-07-27
Oryzalin	Oryzalin (Rycelan) (Ryzelan) (Surflan)	19044883		ug/L	ug/Kg dw				Organics	Herbicides					2013-05-20
o-Terphenyl(Surrogate)	Surrogate: o-Terphenyl	84151		% recovery	% recovery				Organics	SVOCs					2016-03-02
OtherPresence	OtherPresence	0	none						FieldObservations	Habitat					2009-08-20
Outfall Accessibility	Outfall Accessibility	0	none												2016-06-13
Outfall Structural Cond	Structural condition of the outfall	0	none												2016-06-17
Outfall, Distance from Transect	Outfall, Distance from Transect	0	m						Habitat	Debris					2014-11-04
Outfall, Within Transect	Outfall, Within Transect	0	none						Habitat	Debris					2014-11-04
OverlandRunoffLast24hrs	Influence of overland runoff during last 24 hours	0	none	none					FieldObservations	Habitat					2011-02-09
Oxacillin	Oxacillin	66795		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Oxadiazon	Oxadiazon	19666309		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs				2007-07-27
Oxamyl	Oxamyl	23135220		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides	Nematocides		2007-07-27
Oxidation-Reduction Potential	Oxidation-Reduction Potential (OPR)	0		mV					WaterQualityMeasurements	Conventionals					2016-05-20
Oxolinic Acid	Oxolinic Acid	14698294		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Oxychlordane	Oxychlordane	27304138		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors			2007-07-27
Oxychlordane(Surrogate)	Surrogate: Oxychlordane	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2008-11-17
Oxychlordane-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Oxychlordane-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-27
Oxychlordane-13C10(Surrogate)	Surrogate: Oxychlordane-13C10	0		% recovery	% recovery				Organics	Pesticides					2013-06-17
Oxycodone	Oxycodone	76426		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Oxycodone-d6(Surrogate)	Surrogate: Oxycodone-d6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Oxyfluorfen	Oxyfluorfen (Goal)	42874033		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OCHs				2013-05-28
Oxygen, Dissolved	Dissolved Oxygen (DO)	0		mg/L					WaterQualityMeasurements	Conventionals					2009-08-20
Oxygen, Dissolved, Daily Mean	Daily Mean Dissolved Oxygen (DO) (Calculated)	0		umol/L					WaterQualityMeasurements	Conventionals					2024-09-06
Oxygen, Saturation	Oxygen, Saturation	0		%					WaterQualityMeasurements	Conventionals					2007-07-27
Oxygen, Saturation, Daily Mean	Daily Mean Oxygen Saturation (Calculated)	0		%					WaterQualityMeasurements	Conventionals					2024-09-06
Oxygen-18/Oxygen-16 Ratio	Oxygen-18/Oxygen-16 Ratio (Delta 18O nitrate isotope)	14797718		per mil					Isotopes						2013-05-20
Oxytetracycline	Oxytetracycline	79572		ug/L					Organics	PPCPs					2012-05-22
Paclobutrazol	Paclobutrazol	76738620		ng/L					Organics	Pesticides	Fungicides				2016-03-10
Paper/Cardboard	Paper/Cardboard	0	pieces						Debris	Trash	Non-Plastics	Biodegradable			2014-11-04
PAR	Photosynthetically Active Radiation (PAR)	0		mE/m2/s					WaterQualityMeasurements						2007-07-27
Paraoxon	Paraoxon	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Pesticides	Insecticides				2008-11-07
Paraquat	Paraquat	4685147		ug/L					Organics	Pesticides	Herbicides				2013-03-14
Paraquat Dichloride	Paraquat Dichloride	1910425		ug/L					Organics	Pesticides	Herbicides				2013-05-28
Parathion, Ethyl	Ethyl Parathion (Parathion)	56382		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2013-05-28
Parathion, Methyl	Methyl Parathion	298000		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2013-05-28
Parathion, Total	Total Parathion	0		ug/L											2016-12-23
Parking Lot/Pavement Extent	Parking Lot/Pavement Extent	0	none						Habitat						2019-05-07
Parking Lot/Pavement Intensity	Parking Lot/Pavement Intensity	0	none						Habitat						2019-05-07
Parking Lot/Pavement Proximity	Parking Lot/Pavement Proximity	0	none						Habitat						2019-05-07
Parks, Campgrounds	Parks, Campgrounds	0	none						Habitat						2009-08-20
Paroxetine	Paroxetine	61869087		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Paroxetine-d6(Surrogate)	Surrogate: Paroxetine-d6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Particulate Organic Carbon	Particulate Organic Carbon (POC)	0		ug/L					Inorganics	Conventionals					2013-05-27
Passive Input (Construction/Erosion) Extent	Passive Input (Construction/Erosion) Extent	0	none						Habitat						2019-05-07
Passive Input (Construction/Erosion) Intensity	Passive Input (Construction/Erosion) Intensity	0	none						Habitat						2019-05-07
Passive Input (Construction/Erosion) Proximity	Passive Input (Construction/Erosion) Proximity	0	none						Habitat						2019-05-07
Pasture	Pasture	0	none						Habitat						2009-08-20
Pasture Extent	Pasture Extent	0	none						Habitat						2019-05-07
Pasture Intensity	Pasture Intensity	0	none						Habitat						2019-05-07
Pasture Proximity	Pasture Proximity	0	none						Habitat						2019-05-07
Paved Roads Extent	Paved Roads Extent	0	none						Habitat						2019-05-07
Paved Roads Intensity	Paved Roads Intensity	0	none						Habitat						2019-05-07
Paved Roads Proximity	Paved Roads Proximity	0	none						Habitat						2019-05-07
PBB 001	Polybrominated Biphenyl (PBB) 1	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 002	Polybrominated Biphenyl (PBB) 2	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 003	Polybrominated Biphenyl (PBB) 3	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 004	Polybrominated Biphenyl (PBB) 4	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 007	Polybrominated Biphenyl (PBB) 7	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 009	Polybrominated Biphenyl (PBB) 9	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 010	Polybrominated Biphenyl (PBB) 10	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 015	Polybrominated Biphenyl (PBB) 15	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 015(Surrogate)	Surrogate: PBB 015	92864		% recovery					Organics						2025-08-25
PBB 018	Polybrominated Biphenyl (PBB) 18	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 026	Polybrominated Biphenyl (PBB) 26	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 030	Polybrominated Biphenyl (PBB) 30	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 031	Polybrominated Biphenyl (PBB) 31	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 049	Polybrominated Biphenyl (PBB) 49	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 052	Polybrominated Biphenyl (PBB) 52	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 053	Polybrominated Biphenyl (PBB) 53	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 077	Polybrominated Biphenyl (PBB) 77	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 080	Polybrominated Biphenyl (PBB) 80	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 103	Polybrominated Biphenyl (PBB) 103	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBB 155	Polybrominated Biphenyl (PBB) 155	0					ng/g ww	ng/g dw	Organics	FlameRetardants					2012-03-29
PBDE 001	Polybrominated Diphenyl Ether (PBDE) 1	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2010-07-14
PBDE 001(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 1	0		% recovery					Organics	FlameRetardants					2010-07-14
PBDE 002	Polybrominated Diphenyl Ether (PBDE) 2	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2010-07-14
PBDE 003	Polybrominated Diphenyl Ether (PBDE) 3	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2010-07-14
PBDE 003(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 3	0		% recovery	% recovery				Organics	FlameRetardants					2010-07-14
PBDE 004(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 4	0		% recovery					Organics	FlameRetardants					2010-07-14
PBDE 007	Polybrominated Diphenyl Ether (PBDE) 7	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 008	Polybrominated Diphenyl Ether (PBDE) 8	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 008/11	Polybrominated Diphenyl Ether (PBDE) 8/11	0		pg/L			ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2017-05-04
PBDE 010	Polybrominated Diphenyl Ether (PBDE) 10	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 011	Polybrominated Diphenyl Ether (PBDE) 11	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 012	Polybrominated Diphenyl Ether (PBDE) 12	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 012/13	Polybrominated Diphenyl Ether (PBDE) 12/13	0		pg/L			ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2017-05-04
PBDE 013	Polybrominated Diphenyl Ether (PBDE) 13	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 015	Polybrominated Diphenyl Ether (PBDE) 15	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 015(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 15	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2010-07-14
PBDE 015-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 15-13C12	488710174					% recovery	% recovery	Organics	FlameRetardants	PBDEs				2024-09-13
PBDE 017	Polybrominated Diphenyl Ether (PBDE) 17	147217752		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2025-08-25
PBDE 017/25	Polybrominated Diphenyl Ether (PBDE) 17/25	0		ug/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2013-06-25
PBDE 019(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 19	0		% recovery					Organics	FlameRetardants					2010-07-14
PBDE 025	Polybrominated Diphenyl Ether (PBDE) 25	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 028	Polybrominated Diphenyl Ether (PBDE) 28	41318756		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2025-08-25
PBDE 028(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 28	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2010-07-14
PBDE 028/33	Polybrominated Diphenyl Ether (PBDE) 28/33	0		ug/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2013-06-25
PBDE 028-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 028-13C12	0			% recovery		% recovery	% recovery	Organics						2022-02-24
PBDE 030	Polybrominated Diphenyl Ether (PBDE) 30	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 032	Polybrominated Diphenyl Ether (PBDE) 32	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 033	Polybrominated Diphenyl Ether (PBDE) 33	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 035	Polybrominated Diphenyl Ether (PBDE) 35	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 037	Polybrominated Diphenyl Ether (PBDE) 37	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 037(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 37	0		% recovery					Organics	FlameRetardants					2010-07-14
PBDE 047	Polybrominated Diphenyl Ether (PBDE) 47	5436431		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 047(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 47	5436431		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2010-07-14
PBDE 047-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 047-13C12	0			% recovery		% recovery	% recovery	Organics						2022-02-24
PBDE 049	Polybrominated Diphenyl Ether (PBDE) 49	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 049/71	Polybrominated Diphenyl Ether (PBDE) 49/71	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs					2016-05-20
PBDE 051	Polybrominated Diphenyl Ether (PBDE) 51	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 052(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 52	0			% recovery				Organics	FlameRetardants					2010-07-14
PBDE 054(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 54	0		% recovery					Organics	FlameRetardants					2011-05-11
PBDE 066	Polybrominated Diphenyl Ether (PBDE) 66	189084615		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2025-08-25
PBDE 071	Polybrominated Diphenyl Ether (PBDE) 71	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 075	Polybrominated Diphenyl Ether (PBDE) 75	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 077	Polybrominated Diphenyl Ether (PBDE) 77	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 077(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 77	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2010-07-14
PBDE 077-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 77-13C12	1401355552					% recovery	% recovery	Organics	FlameRetardants	PBDEs				2024-09-12
PBDE 079	Polybrominated Diphenyl Ether (PBDE) 79	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-07-14
PBDE 081(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 81	0		% recovery					Organics	FlameRetardants					2010-07-14
PBDE 085	Polybrominated Diphenyl Ether (PBDE) 85	182346210		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 099	Polybrominated Diphenyl Ether (PBDE) 99	60348609		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 099(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 99	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2010-07-14
PBDE 099-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 099-13C12	0			% recovery		% recovery	% recovery	Organics						2022-02-24
PBDE 100	Polybrominated Diphenyl Ether (PBDE) 100	189084648		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2025-08-25
PBDE 100(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 100	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2008-11-17
PBDE 100-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 100-13C12	0			% recovery		% recovery	% recovery	Organics						2022-02-24
PBDE 100-L(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-Labeled	0		% recovery	% recovery		% recovery	% recovery	Organics	PBDEs	FlameRetardants				2011-11-29
PBDE 104(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 104	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 105	Polybrominated Diphenyl Ether (PBDE) 105	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 105(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 105	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 111(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 111	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 114(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 114	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 116	Polybrominated Diphenyl Ether (PBDE) 116	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 118	Polybrominated Diphenyl Ether (PBDE) 118	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2012-04-03
PBDE 118(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 118	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 119	Polybrominated Diphenyl Ether (PBDE) 119	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 119/120	Polybrominated Diphenyl Ether (PBDE) 119/120	0		pg/L			ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2017-05-04
PBDE 120	Polybrominated Diphenyl Ether (PBDE) 120	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 123(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 123	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 126	Polybrominated Diphenyl Ether (PBDE) 126	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 126(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 126	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2008-11-17
PBDE 126-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 126-13C12	1401355563					% recovery	% recovery	Organics	FlameRetardants	PBDEs				2024-09-12
PBDE 128	Polybrominated Diphenyl Ether (PBDE) 128	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 138	Polybrominated Diphenyl Ether (PBDE) 138	182677301		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2025-08-25
PBDE 138(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 138	0		% recovery	% recovery				Organics	FlameRetardants					2009-08-14
PBDE 138/166	Polybrominated Diphenyl Ether (PBDE) 138/166	0		pg/L			ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2017-05-04
PBDE 139	Polybrominated Diphenyl Ether (PBDE) 139	0					ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2009-01-08
PBDE 139(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 139	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2008-11-17
PBDE 139-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 139-13C12	0			% recovery		% recovery	% recovery	Organics						2022-02-24
PBDE 140	Polybrominated Diphenyl Ether (PBDE) 140	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 140(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 140	0		% recovery			% recovery	% recovery	Organics	FlameRetardants					2008-11-17
PBDE 153	Polybrominated Diphenyl Ether (PBDE) 153	68631492		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2007-07-27
PBDE 153(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 153	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2008-11-17
PBDE 153-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 153-13C12	0			% recovery		% recovery	% recovery	Organics						2022-02-24
PBDE 154	Polybrominated Diphenyl Ether (PBDE) 154	207122154		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2025-08-25
PBDE 154(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 154	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2008-11-17
PBDE 154-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 154-13C12	0			% recovery		% recovery	% recovery	Organics						2022-02-24
PBDE 155	Polybrominated Diphenyl Ether (PBDE) 155	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 155(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 155	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 156(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 156	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 157(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 157	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 160	Polybrominated Diphenyl Ether (PBDE) 160	0			% dw				Organics	SVOCs					2016-05-20
PBDE 166	Polybrominated Diphenyl Ether (PBDE) 166	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 167(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 167	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 169(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 169	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 170(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 170	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 172(Surrogate)	Surrogate: PBDE 172 Surrogate: PBDE 172	0			ng/g dw										2019-06-11
PBDE 178(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 178	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 179	Polybrominated Diphenyl Ether (PBDE) 179	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2010-11-08
PBDE 180(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 180	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 181	Polybrominated Diphenyl Ether (PBDE) 181	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 183	Polybrominated Diphenyl Ether (PBDE) 183	207122165		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2025-08-25
PBDE 183(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 183	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2008-11-17
PBDE 183-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 183-13C12	0			% recovery		% recovery	% recovery	Organics						2022-02-24
PBDE 184	Polybrominated Diphenyl Ether (PBDE) 184	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2010-11-08
PBDE 188	Polybrominated Diphenyl Ether (PBDE) 188	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2010-11-08
PBDE 188(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 188	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 189(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 189	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 190	Polybrominated Diphenyl Ether (PBDE) 190	189084682		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants				2025-08-25
PBDE 194	Polybrominated Diphenyl Ether (PBDE) 194	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2012-04-03
PBDE 195	Polybrominated Diphenyl Ether (PBDE) 195	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2012-04-03
PBDE 196	Polybrominated Diphenyl Ether (PBDE) 196	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2009-08-14
PBDE 197	Polybrominated Diphenyl Ether (PBDE) 197	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2009-01-08
PBDE 197(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 197	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2009-08-14
PBDE 197-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 197-13C12	1367487317					% recovery	% recovery	Organics	FlameRetardants	PBDEs				2024-09-12
PBDE 198	Polybrominated Diphenyl Ether (PBDE) 198	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2012-04-03
PBDE 200	Polybrominated Diphenyl Ether (PBDE) 200	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2010-11-08
PBDE 200/203	Polybrominated Diphenyl Ether (PBDE) 200/203	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	PBDEs	FlameRetardants				2013-06-25
PBDE 201	Polybrominated Diphenyl Ether (PBDE) 201	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2010-11-08
PBDE 202	Polybrominated Diphenyl Ether (PBDE) 202	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	FlameRetardants					2010-11-08
PBDE 202(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 202	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 203	Polybrominated Diphenyl Ether (PBDE) 203	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 204	Polybrominated Diphenyl Ether (PBDE) 204	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2009-01-08
PBDE 205	Polybrominated Diphenyl Ether (PBDE) 205	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2009-01-08
PBDE 205(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 205	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 206	Polybrominated Diphenyl Ether (PBDE) 206	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 206(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 206	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 207	Polybrominated Diphenyl Ether (PBDE) 207	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 207(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 207	0			% recovery				Organics	FlameRetardants					2009-08-14
PBDE 208	Polybrominated Diphenyl Ether (PBDE) 208	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 208(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 208	0		% recovery					Organics	FlameRetardants					2008-11-17
PBDE 209	Polybrominated Diphenyl Ether (PBDE) 209	1163195		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2008-11-17
PBDE 209(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 209	1163195		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants					2010-07-14
PBDE 209-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 209-13C12	0			% recovery		% recovery	% recovery	Organics						2022-02-24
PCB 001	PCB 1 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 001(Surrogate)	Surrogate: PCB 1 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2010-07-14
PCB 001-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 001-13C	0		% recovery											2023-10-27
PCB 001-13C(Surrogate)	Surrogate: PCB 001-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 001-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 001-13C12	234432850		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 002	PCB 2 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 003	PCB 3 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 003(Surrogate)	Surrogate: PCB 3 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2010-07-14
PCB 003-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 003-13C	0		% recovery											2023-10-27
PCB 003-13C(Surrogate)	Surrogate: PCB 003-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 003-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 003-13C12	208263778		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 004	PCB 4 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 004(Surrogate)	Surrogate: PCB 4 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2010-07-14
PCB 004/10	PCB 4/10 Congener	0		ug/L			ng/g ww	ng/g dw	Organics	PCBs					2013-04-04
PCB 004-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 004-13C	0		% recovery											2023-10-27
PCB 004-13C(Surrogate)	Surrogate: PCB 004-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 004-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 004-13C12	234432861		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 005	PCB 5 Congener	16605917		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 005/8	PCB 5/8 Congener	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PCBs	Congeners				2012-05-14
PCB 006	PCB 6 Congener	25569806		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 007	PCB 7 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 007/9	PCB 7/9 Congener	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PCBs					2011-05-11
PCB 008	PCB 8 Congener	34883437		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 008(Surrogate)	Surrogate: PCB 8 Congener	34883400		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	Congeners				2012-10-30
PCB 009	PCB 9 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 009(Surrogate)	Surrogate: PCB 9 Congener	0			% recovery				Organics	PCBs					2010-07-15
PCB 009-13C(Surrogate)	Surrogate: PCB 009-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 009-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 9-13C12	250694894		% recovery					Organics	PCBs	IDA				2024-05-02
PCB 010	PCB 10 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 011	PCB 11 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 011-13C(Surrogate)	Surrogate: PCB 011-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 011-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 11-13C12	0		% recovery					Organics	PCBs	IDA				2025-05-05
PCB 012	PCB 12 Congener	2974927		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 012/13	PCB 12/13 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 013	PCB 13 Congener	2974905		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 014	PCB 14 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 015	PCB 15 Congener	2050682		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 015(Surrogate)	Surrogate: PCB 15 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2010-07-14
PCB 015-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 015-13C12	208263676		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 016	PCB 16 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 016/32	PCB 16/32 Congener	0		ug/L			ng/g ww	ng/g dw	Organics	PCBs					1900-01-01
PCB 017	PCB 17 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 017/18	PCB 17/18 Congener	0					RPD	RPD	Organics	PCBs					2013-05-27
PCB 018	PCB 18 Congener	37680652		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 018/30	PCB 18/30 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 019	PCB 19 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 019(Surrogate)	Surrogate: PCB 19 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2010-07-14
PCB 019-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 019-13C12	234432872		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 020	PCB 20 Congener	38444847		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2011-05-11
PCB 020/21/33	PCB 020/21/33 Congener	0		ug/L					Organics	PCBs	Congeners				2015-03-13
PCB 020/28	PCB 20/28 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 020/33	PCB 20/33 Congener	0					RPD	RPD	Organics	PCBs					2013-05-13
PCB 020/33/53	PCB 20/33/53 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2013-05-13
PCB 021	PCB 21 Congener	55702460		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 021/33	PCB 21/33 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 022	PCB 22 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 022/51	PCB 22/51 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2016-08-10
PCB 023	PCB 23 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 024	PCB 24 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 024/27	PCB 24/27 Congener	0		ug/L			ng/g ww	ng/g dw	Organics	PCBs					2013-05-02
PCB 025	PCB 25 Congener	55712373		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 026	PCB 26 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 026/29	PCB 26/29 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 027	PCB 27 Congener	38444767		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 028	PCB 28 Congener	7012375		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 028(Surrogate)	Surrogate: PCB 28 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2010-07-14
PCB 028/31	PCB 28/31 Congener	0		ug/L	ng/g dw		RPD	RPD	Organics	PCBs					2013-05-13
PCB 028-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 028-13C	0		% recovery											2023-10-27
PCB 028-13C(Surrogate)	Surrogate: PCB 028-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 028-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 028-13C12	208263767		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-19
PCB 029	PCB 29 Congener	15862074		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 030	PCB 30 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 030(Surrogate)	Surrogate: PCB 30 Congener	35693926		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 031	PCB 31 Congener	16606023		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 031(Surrogate)	Surrogate: PCB 31 Congener	0		% recovery			% recovery	% recovery	Organics	PCBs					2010-07-15
PCB 031-13C(Surrogate)	Surrogate: PCB 31-13C Congener	0		% recovery											2018-07-31
PCB 031-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 031-13C12	0		% recovery					Organics	PCBs	IDA				2023-10-26
PCB 032	PCB 32 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 032-13C(Surrogate)	Surrogate: PCB 32-13C Congener	0		% recovery					Organics	PCBs	Congeners				2015-03-13
PCB 032-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 32-13C12	0		% recovery					Organics	PCBs	IDA				2024-05-02
PCB 033	PCB 33 Congener	38444869		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 034	PCB 34 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 035	PCB 35 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 036	PCB 36 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 037	PCB 37 Congener	38444905		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 037(Surrogate)	Surrogate: PCB 37 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2010-07-14
PCB 037/42	PCB 37/42 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2013-05-02
PCB 037/42/59	PCB 37/42/59 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2016-08-10
PCB 037-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 037-13C	0		% recovery											2023-10-27
PCB 037-13C(Surrogate)	Surrogate: PCB 037-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 037-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 037-13C12	208263790		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 038	PCB 38 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 039	PCB 39 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 040	PCB 40 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 040/41	PCB 40/41 Congener	0		pg/L	ug/Kg dw				Organics	PCBs					2017-05-04
PCB 040/41/71	PCB 40/41/71 Congener	0		pg/L	ng/g nr		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 040/71	PCB 40/71 Congener	0		pg/L	ug/Kg dw				Organics	PCBs					2017-05-04
PCB 041	PCB 41 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 041/64	PCB 41/64 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2016-08-10
PCB 041/64/71/72	PCB 041/64/71/72 Congener	0		ug/L					Organics	PCBs					2016-05-20
PCB 041/71/40	PCB 41/71/40 Congener PCB 041/71/40	0		pg/L											2019-02-22
PCB 042	PCB 42 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 042/59	PCB 042/59 Congener	0		ug/L					Organics	PCBs					2016-05-20
PCB 043	PCB 43 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 043/49	PCB 43/49 Congener	0		ug/L					Organics	PCBs	Congeners				2015-03-13
PCB 043/73	PCB 43/73 Congener	0		pg/L					Organics	PCBs					2014-07-03
PCB 044	PCB 44 Congener	41464395		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 044/47	PCB 44/47 Congener	0		pg/L	ug/Kg ww				Organics	PCBs					2017-05-04
PCB 044/47/65	PCB 44/47/65 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 044/65	PCB 44/65 Congener	0		pg/L	ug/Kg ww				Organics	PCBs					2017-05-04
PCB 045	PCB 45 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 045/51	PCB 45/51 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 046	PCB 46 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 047	PCB 47 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 047/48	PCB 47/48 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2013-05-02
PCB 047/48/75	PCB 47/48/75 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2016-08-10
PCB 047-13C(Surrogate)	Surrogate: PCB 47-13C Congener	0		% recovery					Organics	PCBs	Congeners				2015-03-13
PCB 047-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 47-13C12	0		% recovery					Organics	PCBs	IDA				2024-05-02
PCB 048	PCB 48 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 048/75	PCB 048/75 Congener	0		ug/L					Organics	PCBs					2016-05-20
PCB 049	PCB 49 Congener	41464408		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 049/69	PCB 49/69 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 050	PCB 50 Congener	62796650		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 050/53	PCB 50/53 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 051	PCB 51 Congener	68194047		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 052	PCB 52 Congener	35693993		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 052(Surrogate)	Surrogate: PCB 52 Congener	0			% recovery				Organics	PCBs					2010-07-15
PCB 052/69	PCB 52/69 Congener	0		ug/L					Organics	PCBs	Congeners				2015-03-13
PCB 052-13C(Surrogate)	Surrogate: PCB 052-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 052-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 52-13C12	208263803		% recovery					Organics	PCBs	IDA				2024-05-02
PCB 053	PCB 53 Congener	41464419		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 054	PCB 54 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 054(Surrogate)	Surrogate: PCB 54 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2010-07-14
PCB 054-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 054-13C	0		% recovery											2023-10-27
PCB 054-13C(Surrogate)	Surrogate: PCB 054-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 054-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 054-13C12	234432883		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 055	PCB 55 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 056	PCB 56 Congener	41464431		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 056/60	PCB 56/60 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 057	PCB 57 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 058	PCB 58 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 059	PCB 59 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 059/62	PCB 59/62 Congener	0		pg/L	ug/Kg dw				Organics	PCBs					2017-05-04
PCB 059/62/75	PCB 59/62/75 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 059/75	PCB 59/75 Congener	0		pg/L	ug/Kg dw				Organics	PCBs					2017-05-04
PCB 060	PCB 60 Congener	33025411		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 061	PCB 61 Congener	33284536		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 061/70	PCB 61/70 Congener	0		ug/L	ug/Kg dw				Organics	PCBs	Congeners				2015-03-13
PCB 061/70/74/76	PCB 61/70/74/76 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 061/74	PCB 61/74 Congener	0		pg/L			ng/g ww	ng/g dw	Organics	PCBs					2012-11-05
PCB 061/76	PCB 61/76 Congener	0		pg/L					Organics	PCBs					2017-05-04
PCB 062	PCB 62 Congener	54230227		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 063	PCB 63 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 064	PCB 64 Congener	52663588		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2008-02-21
PCB 065	PCB 65 Congener	33284547		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 065(Surrogate)	Surrogate: PCB 65 Congener	33284547			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 066	PCB 66 Congener	32598100		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 066/76	PCB 66/76 Congener	0		ug/L					Organics	PCBs	Congeners				2015-03-13
PCB 067	PCB 67 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 068	PCB 68 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 069	PCB 69 Congener	60233241		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 070	PCB 70 Congener	32598111		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 070/61/74/76	PCB 70/61/74/76 Congener	0		pg/L											2019-02-22
PCB 070/74	PCB 070/74	0			ug/Kg dw				Organics	PCBs					2017-12-04
PCB 070/76	PCB 070/76	0			ug/Kg dw				Organics	PCBs					2017-12-05
PCB 070-13C(Surrogate)	Surrogate: PCB 70-13C Congener	0		% recovery					Organics	PCBs	Congeners				2015-03-13
PCB 070-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 70-13C12	208263814		% recovery					Organics	PCBs	IDA				2024-05-02
PCB 071	PCB 71 Congener	41464464		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 072	PCB 72 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 073	PCB 73 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 074	PCB 74 Congener	32690930		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 075	PCB 75 Congener	32598122		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 076	PCB 76 Congener	70362480		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 076/66	PCB 076/66 Congener	0		ug/L					Organics	PCBs					2016-05-20
PCB 077	PCB 77 Congener	32598133		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 077 (TEQ ND=0)	PCB 077 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 077 (TEQ ND=1/2 DL)	PCB 077 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2017-03-06
PCB 077 (TEQ ND=1/2 DL))	PCB 077 (TEQ ND=1/2 DL)	0		pg/sample					Organics						2017-03-06
PCB 077 (TEQ ND=DL)	PCB 077 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 077(Surrogate)	Surrogate: PCB 77 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2010-07-14
PCB 077/110	PCB 77/110 Congener	0			ng/g dw		ng/g ww	ng/g dw	Organics	PCBs					2012-05-14
PCB 077/85	PCB 77/85 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2014-02-04
PCB 077-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 077-13C	0		% recovery											2023-10-27
PCB 077-13C(Surrogate)	Surrogate: PCB 77-13C Congener	0		% recovery			% recovery	% recovery	Organics	PCBs					2010-07-14
PCB 077-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 077-13C12	105600235		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 078	PCB 78 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 079	PCB 79 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 079-13C(Surrogate)	Surrogate: PCB 79-13C Congener	0		% recovery					Organics	PCBs	Congeners				2015-03-13
PCB 079-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 79-13C12	0		% recovery					Organics	PCBs	IDA				2024-05-02
PCB 080	PCB 80 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 080-13C(Surrogate)	Surrogate: PCB 80-13C Congener	0		% recovery					Organics	PCBs	Congeners				2015-03-13
PCB 080-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 80-13C12	0		% recovery					Organics	PCBs	IDA				2024-05-02
PCB 081	PCB 81 Congener	70362504		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 081 (TEQ ND=0)	PCB 081 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 081 (TEQ ND=1/2 DL)	PCB 081 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 081 (TEQ ND=DL)	PCB 081 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 081(Surrogate)	Surrogate: PCB 81 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2010-07-14
PCB 081-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 081-13C	0		% recovery											2023-10-27
PCB 081-13C(Surrogate)	Surrogate: PCB 081-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 081-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 081-13C12	208461249		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 082	PCB 82 Congener	52663624		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 083	PCB 83 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 083/99	PCB 83/99 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 084	PCB 84 Congener	0		RPD	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 084/92	PCB 084/92 Congener	0		ug/L					Organics	PCBs					2016-05-20
PCB 085	PCB 85 Congener	65510454		RPD	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 085/110/115/116/117	PCB 85/110/115/116/117 Congener	0		pg/L					Organics	PCBs					2016-04-06
PCB 085/116	PCB 85/116 Congener	0		ug/L	ug/Kg dw				Organics	PCBs					2014-07-15
PCB 085/116/117	PCB 85/116/117 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 085/117	PCB 85/117 Congener	0		pg/L	ug/Kg dw				Organics	PCBs					2017-05-04
PCB 086	PCB 86 Congener	55312691		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 086/108	PCB 86/108 Congener	0		pg/L					Organics	PCBs					2017-05-04
PCB 086/119	PCB 86/119 Congener	0		pg/L					Organics	PCBs					2017-05-04
PCB 086/125	PCB 86/125 Congener	0		pg/L					Organics	PCBs					2017-05-04
PCB 086/87	PCB 86/87 Congener	0		pg/L	ug/Kg ww				Organics	PCBs					2017-05-04
PCB 086/87/97/108/119/125	PCB 86/87/97/108/119/125 Congener	0			pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 086/87/97/109/119/125	PCB 86/87/97/109/119/125 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2013-07-02
PCB 086/97	PCB 86/97 Congener	0		pg/L					Organics	PCBs					2017-05-04
PCB 087	PCB 87 Congener	38380028		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 087/108	PCB 087/108	0			ug/Kg ww				Organics	PCBs					2017-12-04
PCB 087/115	PCB 87/115 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2012-11-05
PCB 087/117/125	PCB 87/117/125 Congener	0		ug/L					Organics	PCBs	Congeners				2015-03-13
PCB 087/119	PCB 087/119	0			ug/Kg ww				Organics	PCBs					2017-12-04
PCB 087/125	PCB 087/125	0			ug/Kg ww				Organics	PCBs					2017-12-04
PCB 087/97	PCB 087/97	0			ug/Kg ww				Organics	PCBs					2017-12-04
PCB 088	PCB 88 Congener	55215173		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 088/91	PCB 88/91 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 089	PCB 89 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 090	PCB 90 Congener	68194070		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 090/101	PCB 90/101 Congener	0		ug/L	ug/Kg ww		RPD	RPD	Organics	PCBs					2012-05-14
PCB 090/101/113	PCB 90/101/113 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 090/113	PCB 90/113 Congener	0		pg/L					Organics	PCBs					2017-05-04
PCB 091	PCB 91 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 092	PCB 92 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 093	PCB 93 Congener	73575561		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 093/100	PCB 93/100 Congener	0		pg/L	ug/Kg dw				Organics	PCBs					2014-07-15
PCB 093/102	PCB 93/102 Congener	0		pg/L					Organics	PCBs					2017-05-04
PCB 093/95	PCB 93/95 Congener	0		pg/L	ug/Kg ww				Organics	PCBs					2017-05-04
PCB 093/95/100	PCB 93/95/100 Congener	0		pg/L											2019-02-22
PCB 093/95/98/100/102	PCB 93/95/98/100/102 Congener	0		pg/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 093/95/98/102	PCB 93/95/98/102 Congener	0		pg/L					Organics	PCBs					2025-09-17
PCB 093/98	PCB 93/98 Congener	0		pg/L					Organics	PCBs					2017-05-04
PCB 093/98/100/102	PCB 93/98/100/102 Congener	0		ng/L	ng/g nr										2019-05-17
PCB 094	PCB 94 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 095	PCB 95 Congener	38379996		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 095(Surrogate)	Surrogate: PCB 95 Congener	0		% recovery			% recovery	% recovery	Organics	PCBs					2010-07-15
PCB 095/100	PCB 95/100 Congener	0			ug/Kg ww				Organics	PCBs					2015-06-09
PCB 095/102	PCB 095/102	0			ug/Kg ww				Organics	PCBs					2017-12-04
PCB 095/98	PCB 095/98	0			ug/Kg ww				Organics	PCBs					2017-12-04
PCB 095/98/102	PCB 95/98/102 Congener	0		ug/L					Organics	PCBs	Congeners				2015-03-13
PCB 095-13C(Surrogate)	Surrogate: PCB 095-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 095-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 095-13C12	0		% recovery					Organics	PCBs	IDA				2023-10-26
PCB 096	PCB 96 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 097	PCB 97 Congener	41464511		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 097/154	PCB 97/154 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2013-05-13
PCB 097-13C(Surrogate)	Surrogate: PCB 97-13C Congener	0		% recovery					Organics	PCBs	Congeners				2015-03-13
PCB 097-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 97-13C12	0		% recovery					Organics	PCBs	IDA				2024-05-02
PCB 098	PCB 98 Congener	60233252		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 098/102	PCB 98/102 Congener	0		pg/L	ug/Kg dw				Organics	PCBs					2014-07-15
PCB 099	PCB 99 Congener	38380017		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 100	PCB 100 Congener	39485831		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 101	PCB 101 Congener	37680732		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 101(Surrogate)	Surrogate: PCB 101 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs					2008-11-17
PCB 101/113	PCB 101/113	0			ug/Kg ww				Organics	PCBs					2017-12-04
PCB 101-13C(Surrogate)	Surrogate: PCB 101-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 101-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 101-13C12	104130394		% recovery					Organics	PCBs	IDA				2024-05-02
PCB 102	PCB 102 Congener	68194069		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 103	PCB 103 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-06-27
PCB 103(Surrogate)	Surrogate: PCB 103 Congener	0			% recovery		% recovery	% recovery	Organics	PCBs					2010-02-22
PCB 104	PCB 104 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 104(Surrogate)	Surrogate: PCB 104 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-11-17
PCB 104-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 104-13C	0		% recovery											2023-10-27
PCB 104-13C(Surrogate)	Surrogate: PCB 104-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 104-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 104-13C12	234432894		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 105	PCB 105 Congener	32598144		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 105 (TEQ ND=0)	PCB 105 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 105 (TEQ ND=1/2 DL)	PCB 105 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 105 (TEQ ND=DL)	PCB 105 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 105(Surrogate)	Surrogate: PCB 105 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 105-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 105-13C	0		% recovery											2023-10-27
PCB 105-13C(Surrogate)	Surrogate: PCB 105-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 105-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 105-13C12	208263621		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 106	PCB 106 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 106/118	PCB 106/118 Congener	0		ug/L					Organics	PCBs	Congeners				2015-03-13
PCB 107	PCB 107 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 107/108/144	PCB 107/108/144 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					1900-01-01
PCB 107/109	PCB 107/109 Congener	0		ug/L					Organics	PCBs					2016-05-20
PCB 107/124	PCB 107/124 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 108	PCB 108 Congener	70362413		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 108/112	PCB 108/112 Congener	0		ug/L					Organics	PCBs					2016-05-20
PCB 108/124	PCB 108/124 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2014-07-03
PCB 109	PCB 109 Congener	0		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 110	PCB 110 Congener	38380039		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 110/115	PCB 110/115 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 110/151	PCB 110/151 Congener	0		ug/L					Organics	PCBs	Congeners				2012-11-26
PCB 111	PCB 111 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 111(Surrogate)	Surrogate: PCB 111 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 111/115	PCB 111/115 Congener	0		ug/L					Organics	PCBs					2016-05-20
PCB 111-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 111-13C12	235416292		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-19
PCB 112	PCB 112 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 112(Surrogate)	Surrogate: PCB 112 Congener	74472369		ug/L	ug/Kg dw		% recovery	% recovery	Organics	PCBs	Congeners				2007-07-27
PCB 112/119	PCB 112/119 Congener	0		pg/L					Organics	PCBs					2025-09-05
PCB 113	PCB 113 Congener	68194105		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 114	PCB 114 Congener	74472370		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 114 (TEQ ND=0)	PCB 114 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 114 (TEQ ND=1/2 DL)	PCB 114 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 114 (TEQ ND=DL)	PCB 114 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 114(Surrogate)	Surrogate: PCB 114 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 114/122/131	PCB 114/122/131 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					1900-01-01
PCB 114/153	PCB 114/153 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2012-10-30
PCB 114-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 114-13C	0		% recovery											2023-10-27
PCB 114-13C(Surrogate)	Surrogate: PCB 114-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 114-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 114-13C12	208263632		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 115	PCB 115 Congener	74472381		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 116	PCB 116 Congener	18259057		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 117	PCB 117 Congener	68194116		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 118	PCB 118 Congener	31508006		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 118 (TEQ ND=0)	PCB 118 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 118 (TEQ ND=1/2 DL)	PCB 118 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 118 (TEQ ND=DL)	PCB 118 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 118(Surrogate)	Surrogate: PCB 118 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 118-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 118-13C	0		% recovery											2023-10-27
PCB 118-13C(Surrogate)	Surrogate: PCB 118-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 118-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 118-13C12	104130407		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 119	PCB 119 Congener	56558179		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 120	PCB 120 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 121	PCB 121 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 122	PCB 122 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 123	PCB 123 Congener	65510443		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 123 (TEQ ND=0)	PCB 123 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 123 (TEQ ND=1/2 DL)	PCB 123 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 123 (TEQ ND=DL)	PCB 123 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 123(Surrogate)	Surrogate: PCB 123 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 123/149	PCB 123/149 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2012-04-03
PCB 123-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 123-13C	0		% recovery											2023-10-27
PCB 123-13C(Surrogate)	Surrogate: PCB 123-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 123-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 123-13C12	208263643		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 124	PCB 124 Congener	70424703		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 125	PCB 125 Congener	74472392		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 126	PCB 126 Congener	57465288		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 126 (TEQ ND=0)	PCB 126 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 126 (TEQ ND=1/2 DL)	PCB 126 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 126 (TEQ ND=DL)	PCB 126 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 126(Surrogate)	Surrogate: PCB 126 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 126-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 126-13C	0		% recovery											2023-10-27
PCB 126-13C(Surrogate)	Surrogate: PCB 126-13C Congener	0		% recovery			% recovery	% recovery	Organics	PCBs					2008-06-27
PCB 126-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 126-13C12	208263654		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 127	PCB 127 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 127-13C(Surrogate)	Surrogate: PCB 127-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 127-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 127-13C12	0		% recovery					Organics	PCBs	IDA				2025-05-05
PCB 128	PCB 128 Congener	38380073		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 128/162	PCB 128/162 Congener	0		ug/L					Organics	PCBs	Congeners				2015-03-13
PCB 128/166	PCB 128/166 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 128/167	PCB 128/167 Congener	0		ng/L	ug/Kg dw				Organics	PCBs	Congeners				2007-07-27
PCB 129	PCB 129 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 129/138	PCB 129/138 Congener	0		pg/L	ug/Kg ww				Organics	PCBs					2017-05-04
PCB 129/138/160/163	PCB 129/138/160/163 Congener	0			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 129/138/163	PCB 129/138/163 Congener	0		pg/L	ug/Kg dw				Organics	PCBs					2013-07-02
PCB 129/160	PCB 129/160 Congener	0		pg/L					Organics	PCBs					2017-05-04
PCB 129/163	PCB 129/163 Congener	0		pg/L					Organics	PCBs					2017-05-04
PCB 129/166	PCB 129/166 Congener	0		pg/L					Organics	PCBs					2017-05-04
PCB 130	PCB 130 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 131	PCB 131 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 131/133	PCB 131/133 Congener	0		pg/L					Organics	PCBs					2017-11-09
PCB 132	PCB 132 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-06-27
PCB 132/137	PCB 132/137 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2012-10-30
PCB 132/146	PCB 132/146 Congener	0		pg/L					Organics	PCBs					2025-09-05
PCB 132/153	PCB 132/153 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2012-10-30
PCB 132/153/168	PCB 132/153/168 Congener	0			ng/g dw		ng/g ww	ng/g dw	Organics	PCBs					2012-05-14
PCB 132/161	PCB 132/161 Congener	0		ug/L					Organics	PCBs	Congeners				2015-03-13
PCB 132/168	PCB 132/168 Congener	0		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PCBs	Congeners				2012-01-11
PCB 133	PCB 133 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 133/142	PCB 133/142 Congener	0		ug/L					Organics	PCBs					2016-05-20
PCB 134	PCB 134 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 134/143	PCB 134/143 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 135	PCB 135 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 135/151	PCB 135/151 Congener	0		pg/L	ug/Kg ww				Organics	PCBs					2013-07-02
PCB 135/151/154	PCB 135/151/154 Congener	0		pg/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 135/154	PCB 135/154 Congener	0		pg/L					Organics	PCBs					2015-06-09
PCB 136	PCB 136 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 137	PCB 137 Congener	35694065		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 137/176	PCB 137/176 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2016-08-10
PCB 138	PCB 138 Congener	35065282		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 138(Surrogate)	Surrogate: PCB 138 Congener	0			% recovery				Organics	PCBs					2009-08-14
PCB 138/158	PCB 138/158 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2013-02-28
PCB 138/160	PCB 138/160 Congener	0			ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs					2012-03-29
PCB 138/163	PCB 138/163	0			ug/Kg ww				Organics	PCBs					2017-12-04
PCB 138/163/164	PCB 138/163/164 Congener	0		ug/L					Organics	PCBs	Congeners				2015-03-13
PCB 138-13C(Surrogate)	Surrogate: PCB 138-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 138-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 138-13C12	208263665		% recovery					Organics	PCBs	IDA				2024-05-02
PCB 139	PCB 139 Congener	56030569		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-02-02
PCB 139/140	PCB 139/140 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 139/149	PCB 139/149 Congener	0		ug/L	ug/Kg dw				Organics	PCBs	Congeners				2015-03-13
PCB 140	PCB 140 Congener	59291644		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 141	PCB 141 Congener	52712046		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 141/179	PCB 141/179 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2012-10-30
PCB 141-13C(Surrogate)	Surrogate: PCB 141-13C Congener	0		% recovery					Organics	PCBs	Congeners				2015-03-13
PCB 141-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 141-13C12	0		% recovery					Organics	PCBs	IDA				2024-04-22
PCB 142	PCB 142 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 143	PCB 143 Congener	68194150		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 144	PCB 144 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 145	PCB 145 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 146	PCB 146 Congener	51908168		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 146/165	PCB 146/165 Congener	0		ug/L					Organics	PCBs					2016-05-20
PCB 147	PCB 147 Congener	68194138		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 147/149	PCB 147/149 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 148	PCB 148 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 149	PCB 149 Congener	38380040		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 150	PCB 150 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 151	PCB 151 Congener	52663635		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 151/154	PCB 151/154	0			ug/Kg ww				Organics	PCBs					2017-12-04
PCB 152	PCB 152 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 153	PCB 153 Congener	35065271		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 153(Surrogate)	Surrogate: PCB 153 Congener	0		% recovery			% recovery	% recovery	Organics	PCBs					2009-08-14
PCB 153/168	PCB 153/168 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 153-13C(Surrogate)	Surrogate: PCB 153-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 153-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 153-13C12	185376583		% recovery					Organics	PCBs	IDA				2023-11-14
PCB 154	PCB 154 Congener	60145224		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 155	PCB 155 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 155(Surrogate)	Surrogate: PCB 155 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-11-17
PCB 155-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 155-13C	0		% recovery											2023-10-27
PCB 155-13C(Surrogate)	Surrogate: PCB 155-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 155-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 155-13C12	34432907		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 156	PCB 156 Congener	38380084		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 156 (TEQ ND=0)	PCB 156 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 156 (TEQ ND=1/2 DL)	PCB 156 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 156 (TEQ ND=DL)	PCB 156 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 156(Surrogate)	Surrogate: PCB 156 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 156/157	PCB 156/157 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 156/157 (TEQ ND=0)	PCB 156/157 (TEQ ND=0)	0		pg/sample	ug/Kg dw				Organics	PCBs					2017-05-04
PCB 156/157 (TEQ ND=1/2 DL)	PCB 156/157 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw				Organics	PCBs					2017-05-04
PCB 156/157 (TEQ ND=DL)	PCB 156/157 (TEQ ND=DL)	0		pg/sample	ug/Kg dw				Organics	PCBs					2017-05-04
PCB 156/157(Surrogate)	Surrogate: PCB 156/157 Congener	0		% recovery	ug/Kg dw				Organics	PCBs					2013-07-02
PCB 156/171	PCB 156/171 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2013-02-13
PCB 156/171/202	PCB 156/171/202 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2012-03-29
PCB 156/177/200	PCB 156/177/200 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2012-10-30
PCB 156-13C(Surrogate)	Surrogate: PCB 156-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 156-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 156-13C12	208263687		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-31
PCB 156-13C12/157-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 156-13C12/157-13C12	0			% recovery		% recovery	% recovery	Organics	PCBs	IDA	Coelution			2023-10-27
PCB 157	PCB 157 Congener	69782907		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 157 (TEQ ND=0)	PCB 157 (TEQ ND=0)	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 157 (TEQ ND=1/2 DL)	PCB 157 (TEQ ND=1/2 DL)	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 157 (TEQ ND=DL)	PCB 157 (TEQ ND=DL)	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 157(Surrogate)	Surrogate: PCB 157 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 157/173	PCB 157/173 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2013-02-13
PCB 157/173/201	PCB 157/173/201 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2012-03-29
PCB 157/180	PCB 157/180 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2012-10-30
PCB 157-13C(Surrogate)	Surrogate: PCB 157-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 157-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 157-13C12	235416305		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-31
PCB 158	PCB 158 Congener	74472427		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 158/160	PCB 158/160 Congener	0		ug/L					Organics	PCBs	Congeners				2015-03-13
PCB 159	PCB 159 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 159(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 159	0		% recovery											2023-02-24
PCB 159(Surrogate)	Surrogate: PCB 159 Congener	39635353		% recovery	% recovery		% recovery	% recovery	Organics	PCBs					2016-05-20
PCB 159/182/187	PCB 159/182/187 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					1900-01-01
PCB 159-13C(Surrogate)	Surrogate: PCB 159-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 159-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 159-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Toxaphene	IDA				2023-10-03
PCB 160	PCB 160 Congener	41411625		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 161	PCB 161 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 162	PCB 162 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 163	PCB 163 Congener	74472449		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 164	PCB 164 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 165	PCB 165 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 166	PCB 166 Congener	41411636		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 166/167	PCB 166/167 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					1900-01-01
PCB 167	PCB 167 Congener	52663726		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 167 (TEQ ND=0)	PCB 167 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 167 (TEQ ND=1/2 DL)	PCB 167 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 167 (TEQ ND=DL)	PCB 167 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 167(Surrogate)	Surrogate: PCB 167 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 167-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 167-13C	0		% recovery											2023-10-27
PCB 167-13C(Surrogate)	Surrogate: PCB 167-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 167-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 167-13C12	208263698		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 168	PCB 168 Congener	59291655		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 168/132	PCB 168/132 Congener	0		ug/L					Organics	PCBs					2016-05-20
PCB 169	PCB 169 Congener	32774166		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 169 (TEQ ND=0)	PCB 169 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 169 (TEQ ND=1/2 DL)	PCB 169 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 169 (TEQ ND=DL)	PCB 169 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 169(Surrogate)	Surrogate: PCB 169 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 169-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 169-13C	0		% recovery											2023-10-27
PCB 169-13C(Surrogate)	Surrogate: PCB 169-13C Congener	0		% recovery			% recovery	% recovery	Organics	PCBs					2008-06-27
PCB 169-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 169-13C12	208263701		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 170	PCB 170 Congener	35065306		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 170(Surrogate)	Surrogate: PCB 170 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 170/190	PCB 170/190 Congener	0			ng/g dw		RPD	RPD	Organics	PCBs					2012-05-14
PCB 170-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 170-13C	0		% recovery											2023-10-27
PCB 170-13C(Surrogate)	Surrogate: PCB 170-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 170-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 170-13C12	160901804		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 171	PCB 171 Congener	52663715		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-17
PCB 171/173	PCB 171/173 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 171/202	PCB 171/202 Congener	0					ng/g ww	ng/g dw	Organics	PCBs					2013-02-13
PCB 172	PCB 172 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 173	PCB 173 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 174	PCB 174 Congener	38411255		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 175	PCB 175 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 176	PCB 176 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 177	PCB 177 Congener	52663704		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 178	PCB 178 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 178(Surrogate)	Surrogate: PCB 178 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 178-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 178-13C	0		% recovery											2023-10-27
PCB 178-13C(Surrogate)	Surrogate: PCB 178-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 178-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 178-13C12	232919674		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-19
PCB 179	PCB 179 Congener	52663646		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 180	PCB 180 Congener	35065293		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 180(Surrogate)	Surrogate: PCB 180 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 180/193	PCB 180/193 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 180-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 180-13C	0		% recovery											2023-10-27
PCB 180-13C(Surrogate)	Surrogate: PCB 180-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 180-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 180-13C12	160901826		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 181	PCB 181 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 182	PCB 182 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 182/187	PCB 182/187 Congener	0		ug/L					Organics	PCBs	Congeners				2015-03-13
PCB 183	PCB 183 Congener	52663691		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 183/185	PCB 183/185 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 184	PCB 184 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 185	PCB 185 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 186	PCB 186 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 187	PCB 187 Congener	52663680		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 188	PCB 188 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 188(Surrogate)	Surrogate: PCB 188 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-11-17
PCB 188-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 188-13C	0		% recovery											2023-10-27
PCB 188-13C(Surrogate)	Surrogate: PCB 188-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 188-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 188-13C12	234432918		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 189	PCB 189 Congener	39635319		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 189 (TEQ ND=0)	PCB 189 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 189 (TEQ ND=1/2 DL)	PCB 189 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 189 (TEQ ND=DL)	PCB 189 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB 189(Surrogate)	Surrogate: PCB 189 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-09-05
PCB 189-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 189-13C	0		% recovery											2023-10-27
PCB 189-13C(Surrogate)	Surrogate: PCB 189-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 189-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 189-13C12	208263734		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 190	PCB 190 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 191	PCB 191 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 191(Surrogate)	Surrogate: PCB 191 Congener	0			ug/Kg dw				Organics	PCBs	Congeners				2012-04-23
PCB 19-13C(Surrogate)	Surrogate: PCB 19-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 192	PCB 192 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 193	PCB 193 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-06-27
PCB 194	PCB 194 Congener	35694087		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 194(Surrogate)	Surrogate: PCB 194 Congener	0			% recovery				Organics	PCBs					2009-08-14
PCB 194-13C(Surrogate)	Surrogate: PCB 194-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 194-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 194-13C12	208263745		% recovery					Organics	PCBs	IDA				2024-04-22
PCB 195	PCB 195 Congener	52663782		ug/mL	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 195/208	PCB 195/208 Congener	0			ng/g dw		ng/g ww	ng/g dw	Organics	PCBs	Congeners				2012-05-14
PCB 196	PCB 196 Congener	0		RPD	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 196/203	PCB 196/203 Congener	0		ug/L			RPD	RPD	Organics	PCBs					2012-10-30
PCB 197	PCB 197 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 197/200	PCB 197/200 Congener	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2010-07-14
PCB 198	PCB 198 Congener	68194172		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-06-27
PCB 198(Surrogate)	Surrogate: PCB 198 Congener	68194172		ug/L	ug/Kg dw		% recovery	% recovery	Organics	PCBs	Congeners				2007-07-27
PCB 198/199	PCB 198/199 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2008-02-21
PCB 199	PCB 199 Congener	52663759		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-06-27
PCB 199/200	PCB 199/200 Congener	0		ug/L	ug/g dw				Organics	PCBs					2016-05-20
PCB 200	PCB 200 Congener	52663737		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 201	PCB 201 Congener	40186718		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 202	PCB 202 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 202(Surrogate)	Surrogate: PCB 202 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-11-17
PCB 202-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 202-13C	0		% recovery											2023-10-27
PCB 202-13C(Surrogate)	Surrogate: PCB 202-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 202-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 202-13C12	105600268		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 203	PCB 203 Congener	52663760		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 204	PCB 204 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 205	PCB 205 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 205(Surrogate)	Surrogate: PCB 205 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-11-17
PCB 205-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 205-13C12	234446641		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 206	PCB 206 Congener	40186729		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2007-07-27
PCB 206(Surrogate)	Surrogate: PCB 206 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-11-17
PCB 206-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 206-13C	0		% recovery											2023-10-27
PCB 206-13C(Surrogate)	Surrogate: PCB 206-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 206-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 206-13C12	208263756		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 207	PCB 207 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-06-27
PCB 207(Surrogate)	Surrogate: PCB 207 Congener	52663793		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	Congeners				2007-07-27
PCB 208	PCB 208 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
PCB 208(Surrogate)	Surrogate: PCB 208 Congener	0		% recovery	ug/Kg dw		% recovery	% recovery	Organics	PCBs					2008-11-17
PCB 208-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 208-13C	0		% recovery											2023-10-27
PCB 208-13C(Surrogate)	Surrogate: PCB 208-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 208-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 208-13C12	234432929		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 209	PCB 209 Congener (Decachlorobiphenyl) (DCB)	2051243		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2013-10-14
PCB 209(Surrogate)	Surrogate: PCB 209 Congener (Decachlorobiphenyl) (DCB)	2051243		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners				2013-10-14
PCB 209(Surrogate)DB-608	Surrogate: PCB 209 run on DB-608 (Decachlorobiphenyl) (DCB)	2051243		% recovery	% recovery				Organics	PCBs					2013-08-06
PCB 209(Surrogate)HP-5	Surrogate: PCB 209 run on HP-5 (Decachlorobiphenyl) (DCB)	2051243		% recovery	% recovery				Organics	PCBs					2013-08-06
PCB 209-13C(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 209-13C	0		% recovery											2023-10-27
PCB 209-13C(Surrogate)	Surrogate: PCB 209-13C Congener	0		% recovery					Organics	PCBs					2016-05-20
PCB 209-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 209-13C12	105600279		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA				2023-10-27
PCB 209-L(Surrogate)	Surrogate: PCB 209 Congener (Decachlorobiphenyl) (DCB)-Labeled not defined	2051243		ug/L			% recovery	% recovery	Organics	PCBs					2016-03-29
PCB AROCLOR 1016	PCB Aroclor 1016	12674112		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Aroclors				2007-07-27
PCB AROCLOR 1221	PCB Aroclor 1221	11104282		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Aroclors				2007-07-27
PCB AROCLOR 1232	PCB Aroclor 1232	11141165		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Aroclors				2007-07-27
PCB AROCLOR 1242	PCB Aroclor 1242	53469219		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Aroclors				2007-07-27
PCB AROCLOR 1248	PCB Aroclor 1248	12672296		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors				2007-07-27
PCB AROCLOR 1254	PCB Aroclor 1254	11097691		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors				2007-07-27
PCB AROCLOR 1260	PCB Aroclor 1260	11096825		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors				2007-07-27
PCB AROCLOR 1262	PCB Aroclor 1262	37324235		ug/L	ug/Kg dw				Organics	PCBs	Aroclors				2017-05-17
PCB AROCLOR 1268	PCB AROCLOR 1268	11100144		ug/L	ug/Kg dw				Organics	PCBs	Aroclors				2020-04-17
PCB TEQ (3 PCBs)	PCB TEQ (3 PCBs)	0					ng/g ww	ng/g dw	Organics	DioxinsDibenzofurans					2008-06-27
PCB TEQ (5 PCBs)	PCB TEQ (5 PCBs)	0					NR ww	NR dw	Organics	DioxinsDibenzofurans					2008-06-27
PCB TOTAL (TEQ ND=0)	PCB TOTAL (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB TOTAL (TEQ ND=1/2 DL)	PCB TOTAL (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCB TOTAL (TEQ ND=DL)	PCB TOTAL (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics						2017-03-06
PCNB	PCNB (Pentachloronitrobenzene)	82688		ug/L					Organics	Pesticides	Pest-OCHs	Algaecides	Fungicides	Nematocides	2013-05-28
PCT AROCLOR 5432	Polychlorinated Terphenyl AROCLOR 5432	0			ug/Kg dw										2019-05-17
PCT AROCLOR 5442	Polychlorinated Terphenyl AROCLOR 5442	0			ug/Kg dw										2019-05-17
PCT AROCLOR 5460	Polychlorinated Terphenyl AROCLOR 5460	0			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2014-01-28
PCT_DR	Percent dry channel	0	%						Bioassessment						2021-01-28
PCT_FAST	Percent fast-water habitat of reach	0	%						Bioassessment						2021-01-28
PCT_POOL	Percent pool habitat of reach	0	%						Bioassessment						2021-01-28
PCT_RC	Percent concrete or asphalt streambed substrate physical-habitat metric	0	%						Bioassessment						2021-01-28
PCT_SAFN	Percent sands and fines streambed substrate physical-habitat metric	0	%						Bioassessment						2021-01-28
PCT_SLOW	Percent slow-water habitat of reach	0	%						Bioassessment						2021-01-28
Pebble	Pebble	0			%				Inorganics	Conventionals	GrainSize				2011-09-08
Pebble, Large_WS (16 to <32 mm_Phi -4 to >-5)	Large Pebble_Wentworth Scale (16 to <32 mm_Phi -4 to >-5)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Pebble, Medium_WS (8 to <16 mm_Phi -3 to >-4)	Medium Pebble_Wentworth Scale (8 to <16 mm_Phi -3 to >-4)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Pebble, Small_WS (4 to <8 mm_Phi -2 to >-3)	Small Pebble_Wentworth Scale (4 to <8 mm_Phi -2 to >-3)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Pebble, Very Large_WS (32 to <64 mm_Phi -5 to >-6)	Very Large Pebble_Wentworth Scale (32 to <64 mm_Phi -5 to >-6)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Pebulate	Pebulate (PEBC)	1114712		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates				2013-05-28
PeCDD, 1,2,3,7,8-	1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD)	40321764		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
PECDD, 1,2,3,7,8- (TEQ ND=0)	1,2,3,7,8-PECDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
PECDD, 1,2,3,7,8- (TEQ ND=1/2 DL)	1,2,3,7,8-PECDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
PeCDD, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD)	40321764		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
PeCDD-13C, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin-13C (PeCDD)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-06-05
PeCDD-13C12, 1,2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin-13C12 (PeCDD-13C12)	109719791		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
PeCDF, 1,2,3,7,8-	1,2,3,7,8-Pentachlorodibenzofuran (PeCDF)	57117416		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
PECDF, 1,2,3,7,8- (TEQ ND=0)	1,2,3,7,8-PECDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
PECDF, 1,2,3,7,8- (TEQ ND=1/2 DL)	1,2,3,7,8-PECDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
PeCDF, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzofuran (PeCDF)	57117416		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
PeCDF, 2,3,4,7,8-	2,3,4,7,8-Pentachlorodibenzofuran (PeCDF)	57117314		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
PECDF, 2,3,4,7,8- (TEQ ND=0)	2,3,4,7,8-PECDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
PECDF, 2,3,4,7,8- (TEQ ND=1/2 DL)	2,3,4,7,8-PECDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
PeCDF, 2,3,4,7,8-(Surrogate)	Surrogate: 2,3,4,7,8-Pentachlorodibenzofuran (PeCDF)	57117314		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
PeCDF-13C, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzofuran-13C (PeCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-06-05
PeCDF-13C, 2,3,4,7,8-(Surrogate)	Surrogate: 2,3,4,7,8-Pentachlorodibenzofuran-13C (PeCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-06-05
PeCDF-13C12, 1,2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8-Pentachlorodibenzofuran-13C12 (PeCDF-13C12)	109719779		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
PeCDF-13C12, 2,3,4,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,4,7,8-Pentachlorodibenzofuran-13C12 (PeCDF-13C12)	116843028		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
Pen/Marker	Pen/Marker	0	pieces						Debris	Trash	Plastics	Toxic			2014-11-04
Pendimethalin	Pendimethalin (Prowl)	40487421		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Herbicides				2013-05-28
Penicillin G	Penicillin G	61336		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Penicillin V	Penicillin V	87081		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2025-08-25
Penoxsulam	Penoxsulam	219714962		ug/L					Organics	Pesticides	Herbicides				2011-10-13
Pentabromobenzene	Pentabromobenzene (PBBZ)	608902			ng/g dw				Organics	FlameRetardants					2015-07-16
Pentabromobenzyl acrylate	Pentabromobenzyl acrylate (PBBA)	59447551			ng/g dw				Organics	FlameRetardants					2014-03-13
Pentabromobenzyl Bromide-1/Pentabromotoluene	Pentabromobenzyl Bromide (isomer 1)/Pentabromotoluene (PBBB-1/PBT coeluants)	0			ng/g dw				Organics	FlameRetardants					2015-07-16
Pentabromobenzyl Bromide-2/Polybrominated Biphenyl 101	Pentabromobenzyl bromide (isomer 2)/Polybrominated Biphenyl 101 (PBBB-2/BB-101 coeluants)	0			ng/g dw				Organics	FlameRetardants					2015-07-16
Pentabromoethylbenzene	Pentabromoethylbenzene (PBEB)	85223			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2010-01-04
Pentachloroanisole	Pentachloroanisole	1825214		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs					2014-01-29
Pentachlorobenzene	Pentachlorobenzene	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs					2014-02-05
Pentachlorobenzene(Surrogate)	Surrogate: Pentachlorobenzene	0					% recovery	% recovery	Organics	VOCs					2014-02-05
Pentachlorobenzene-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Pentachlorobenzene-13C6	2483735540			% recovery		% recovery	% recovery							2024-01-19
Pentachloroethane	Pentachloroethane	76017		ug/L					Organics						2018-02-13
Pentachloronitrobenzene	Pentachloronitrobenzene (PCNB)	82688		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Algaecides	Fungicides	Nematocides	2014-02-05
Pentachlorophenol	Pentachlorophenol	87865		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	Chlorinated Phenols	Insecticides	Fungicides	2007-07-27
Pentacosane, n-	n-Pentacosane	629992					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Pentadecane, n-	n-Pentadecane	629629					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Perchlorate	Perchlorate	14797730		ug/L	ug/Kg dw				Inorganics	Conventionals					2007-07-27
Perfluoro(2-ethoxyethane)sulfonic Acid	Perfluoro(2-ethoxyethane)sulfonic acid (PFEESA)	113507827		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2021-06-02
Perfluoro-2-propoxypropanoate	Perfluoro-2-propoxypropanoate (Hexafluoropropylene oxide dimer acid; HFPO-DA)	122499176			ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2023-11-02
Perfluoro-2-propoxypropanoate-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoro-2-propoxypropanoate-13C3 (HFPO-DA)	0			% recovery		% recovery	% recovery	Organics	PFAS					2023-11-02
Perfluoro-2-Propoxypropanoic Acid	Perfluoro-2-Propoxypropanoic Acid	13252136		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS					2019-08-28
Perfluoro-2-Propoxypropanoic Acid-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoro-2-Propoxypropanoic Acid-13C3 (HFPO-DA-13C3)	3030247970		% recovery					Organics	PFAS	IDA				2025-04-03
Perfluoro-2-Propoxypropanoic Acid-13C3(Surrogate)	Surrogate: Perfluoro-2-Propoxypropanoic Acid-13C3 (HFPO-DA)	0					% recovery	% recovery	Organics	PFAS					2021-06-02
Perfluoro-3,6-dioxaheptanoate	Perfluoro-3,6-dioxaheptanoate (Nonafluoro-3,6-dioxaheptanoic acid) (NFDHA)	151772586		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2021-06-02
Perfluoro-3-methoxypropanoate	Perfluoro-3-methoxypropanoate (Perfluoro-3-methoxypropanoic acid) (PFMPA)	377731		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2021-06-02
Perfluoro-3-methoxypropanoic Acid	Perfluoro-3-methoxypropanoic Acid (PFMPA)	377731		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluoro-4-methoxybutanoate	Perfluoro-4-methoxybutanoate (Perfluoro-4-methoxybutanoic acid) (PFMBA)	863090895		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2021-07-20
Perfluoro-4-methoxybutanoic Acid	Perfluoro-4-methoxybutanoic Acid (PFMBA)	863090895		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorobutanesulfonate	Perfluorobutanesulfonate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2008-06-27
Perfluorobutanesulfonate-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorobutanesulfonate-13C3 (PFBS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluorobutanesulfonate-13C3(Surrogate)	Surrogate: Perfluorobutanesulfonate-13C3 (PFBS)	0					% recovery	% recovery	Organics	PFAS					2021-06-02
Perfluorobutanesulfonic Acid	Perfluorobutanesulfonic Acid (PFBS)	375735		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorobutanesulfonic Acid-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorobutanesulfonic Acid-13C3 (PFBS-13C3)	2708218840		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-10
Perfluorobutanoate	Perfluorobutanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2008-06-27
Perfluorobutanoate(Surrogate)	Surrogate: Perfluorobutanoic Acid (PFBTA), (PFBA)	375224		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2016-05-20
Perfluorobutanoate-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorobutanoate-13C4 (PFBTA) (PFBA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluorobutanoate-13C4(Surrogate)	Surrogate: Perfluorobutanoate-13C4	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2009-08-31
Perfluorobutanoic Acid	Perfluorobutanoic Acid (PFBA)	375224		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorobutanoic Acid-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorobutanoic Acid-13C4 (PFBA-13C4)	1017281296		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluorodecane Sulfonic acid, 1H,1H,2H,2H-	1H,1H,2H,2H-Perfluorodecane Sulfonic Acid (8:2FTS)	39108344		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorodecane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue)	Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorodecane Sulfonic Acid-13C2 (8:2FTS-13C2)	2708218908		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluorodecanesulfonate	Perfluorodecanesulfonate	126105348		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2019-08-28
Perfluorodecanesulfonic Acid	Perfluorodecanesulfonic Acid (PFDS)	335773		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorodecanoate	Perfluorodecanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2008-06-27
Perfluorodecanoate(Surrogate)	Surrogate: Perfluorodecanoic Acid (PFDA)	335762		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2016-05-20
Perfluorodecanoate-13C2(Surrogate)	Surrogate: Perfluorodecanoate-13C2	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2009-01-08
Perfluorodecanoate-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorodecanoate-13C6 (PFDA)	0		ng/L	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluorodecanoic Acid	Perfluorodecanoic Acid (PFDA)	335762		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-23
Perfluorodecanoic Acid-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorodecanoic Acid-13C6 (PFDA-13C6)	2328024560		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluorodecylphosphate, 1H,1H,2H,2H-	1H,1H,2H,2H-perfluorodecylphosphate (8:2 monoPAP)	0			ng/g dw				Organics	PFAS	PFC Precursor				2014-10-20
Perfluorodecylphosphate-13C2, 1H,1H,2H,2H-(Surrogate)	Surrogate: 1H,1H,2H,2H-perfluorodecylphosphate-13C2	0			% recovery				Organics	PFAS					2014-10-02
Perfluorodecylphosphonate	Perfluorodecylphosphonate (PFDPA)	0			ng/g dw				Organics	PFAS					2014-10-20
Perfluorododecanesulfonate	Perfluorododecanesulfonate	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2019-08-28
Perfluorododecanesulfonic Acid	Perfluorododecanesulfonic Acid (PFDoS)	79780395		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorododecanoate	Perfluorododecanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2008-06-27
Perfluorododecanoate(Surrogate)	Surrogate: Perfluorododecanoic Acid (PFDoA)	307551		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2016-05-20
Perfluorododecanoate-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorododecanoate-13C2 (PFDoA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluorododecanoate-13C2(Surrogate)	Surrogate: Perfluorododecanoate-13C2	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2009-08-31
Perfluorododecanoic Acid	Perfluorododecanoic Acid (PFDoA)	307551		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-23
Perfluorododecanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorododecanoic Acid-13C2 (PFDoA-13C2)	960315520		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluoroheptanesulfonate	Perfluoroheptanesulfonate	375928		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2019-08-28
Perfluoroheptanesulfonic Acid	Perfluoroheptanesulfonic Acid (PFHpS)	375928		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-23
Perfluoroheptanoate	Perfluoroheptanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2008-06-27
Perfluoroheptanoate-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroheptanoate-13C4 (PFHpA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluoroheptanoate-13C4(Surrogate)	Surrogate: Perfluoroheptanoate-13C4 (PFHpA)	0					% recovery	% recovery	Organics	PFAS					2021-06-02
Perfluoroheptanoic Acid	Perfluoroheptanoic Acid (PFHpA)	375859		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluoroheptanoic acid-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroheptanoic Acid-13C4 (PFHpA-13C4)	2328024559		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluoroheptyl Propanoic Acid, 3-	3-Perfluoroheptyl Propanoic Acid (7:3FTCA)	812704		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-02-04
Perfluorohexadecanoic Acid	Perfluorohexadecanoic acid (PFHxDA)	67905195			ng/g dw				Organics	PFAS					2026-02-27
Perfluorohexane Sulfonic Acid, 1H,1H,2H,2H-	1H,1H,2H,2H-Perfluorohexane Sulfonic Acid (4:2FTS)	757124724		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorohexane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue)	Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorohexane Sulfonic Acid-13C2 (4:2FTS-13C2)	2708218884		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluorohexanesulfonate	Perfluorohexanesulfonate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2008-06-27
Perfluorohexanesulfonate-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanesulfonate-13C3 (PFHxS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluorohexanesulfonate-13C3(Surrogate)	Surrogate: Perfluorohexanesulfonate-13C3 (PFHxS)	0					% recovery	% recovery	Organics	PFAS					2021-06-02
Perfluorohexanesulfonate-18O2(Surrogate)	Surrogate: Perfluorohexanesulfonate-18O2	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2012-10-29
Perfluorohexanesulfonic Acid	Perfluorohexanesulfonic Acid (PFHxS)	355464		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorohexanesulfonic Acid-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanesulfonic Acid-13C3 (PFHxS-13C3)	2708218862		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-10
Perfluorohexanoate	Perfluorohexanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2008-06-27
Perfluorohexanoate(Surrogate)	Surrogate: Perfluorohexanoic Acid (PFHxA)	307244		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2016-05-20
Perfluorohexanoate-13C2(Surrogate)	Surrogate: Perfluorohexanoate-13C2	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2009-08-31
Perfluorohexanoate-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanoate-13C5 (PFHxA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluorohexanoic Acid	Perfluorohexanoic Acid (PFHxA)	307244		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorohexanoic Acid-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanoic Acid-13C5 (PFHxA-13C5)	2328024548		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluorohexylperfluorooctylphosphinate	Perfluorohexylperfluorooctylphosphinate (6:8 PFPi)	0			ng/g dw				Organics	PFAS	PFC Precursor				2014-10-20
Perfluorohexylphosphonate	Perfluorohexylphosphonate (PFHxPA)	0			ng/g dw				Organics	PFAS	PFC Precursor				2014-10-20
Perfluorohexylphosphonate-Cl(Surrogate)	Surrogate: Perfluorohexylphosphonate-Cl	0			% recovery				Organics	PFAS	PFC Precursor				2014-10-30
Perfluorononanesulfonate	Perfluorononanesulfonate	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2019-08-28
Perfluorononanesulfonic Acid	Perfluorononanesulfonic Acid (PFNS)	68259121		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorononanoate	Perfluorononanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2008-06-27
Perfluorononanoate(Surrogate)	Surrogate: Perfluorononanoic Acid (PFNA)	375951		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2016-05-20
Perfluorononanoate-13C5(Surrogate)	Surrogate: Perfluorononanoate-13C5	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2009-08-31
Perfluorononanoate-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorononanoate-13C9 (PFNA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluorononanoic Acid	Perfluorononanoic Acid (PFNA)	375951		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorononanoic Acid-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorononanoic Acid-13C9 (PFNA-13C9)	2283397806		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluorooctadecanoic Acid	Perfluorooctadecanoic Acid (PFODA) (PFOcDA)	16517116			ng/g dw				Organics	PFAS					2026-02-27
Perfluorooctane Sulfonamido Acetic Acid	Perfluorooctane Sulfonamido Acetic Acid (FOSAA)	0			ng/g dw				Organics	PFAS	PFC Precursor				2014-10-20
Perfluorooctane Sulfonic Acid, 1H,1H,2H,2H-	1H,1H,2H,2H-Perfluorooctane Sulfonic Acid (6:2FTS)	27619972		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorooctane Sulfonic Acid-13C2, 1H,1H,2H,2H-(IsoDilAnalogue)	Isotope Dilution Analogue: 1H,1H,2H,2H-Perfluorooctane Sulfonic Acid-13C2 (6:2FTS-13C2)	2708218895		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluorooctanesulfonamide	Perfluorooctanesulfonamide (PFOSA)	754916		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-04-04
Perfluorooctanesulfonamide-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanesulfonamide-13C8 (PFOSA-13C8)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluorooctanesulfonamide-13C8(Surrogate)	Surrogate: Perfluorooctanesulfonamide-13C8	0			% recovery		% recovery	% recovery	Organics	PFAS	PFOA				2012-10-29
Perfluorooctanesulfonate	Perfluorooctanesulfonate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2012-09-15
Perfluorooctanesulfonate 080(Surrogate)	Surrogate: Perfluorooctanesulfonate 080 (PFOS)	45298906		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2016-05-20
Perfluorooctanesulfonate-13C4(Surrogate)	Surrogate: Perfluorooctanesulfonate-13C4	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2009-01-08
Perfluorooctanesulfonate-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanesulfonate-13C8 (PFOS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluorooctanesulfonic Acid	Perfluorooctanesulfonic Acid (PFOS)	1763231		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorooctanesulfonic acid (PFOS)	Perfluorooctanesulfonic acid (PFOS)	0		ng/L	ng/g dw		ng/g ww	ng/g dw	PFOS						2020-12-02
Perfluorooctanesulfonic Acid-13C4(Surrogate)	Surrogate: Perfluorooctanesulfonic Acid-13C4 (PFOS-13C4)	960315531		% recovery					Organics	PFAS					2026-01-23
Perfluorooctanesulfonic Acid-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanesulfonic Acid-13C8 (PFOS-13C8)	2522762167		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluorooctanesulfonic Acid-13C8(Surrogate)	Surrogate: Perfluorooctanesulfonic Acid-13C8 (PFOS-13C8)	2522762167		% recovery					Organics	PFAS					2025-08-15
Perfluorooctanoate	Perfluorooctanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2008-06-27
Perfluorooctanoate(Surrogate)	Surrogate: Perfluorooctanoic Acid (PFOA)	335671		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides					2016-05-20
Perfluorooctanoate-13C2(Surrogate)	Surrogate: Perfluorooctanoate-13C2	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2009-01-08
Perfluorooctanoate-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanoate-13C8 (PFOA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluorooctanoate-13C8(Surrogate)	Surrogate: Perfluorooctanoate-13C8	0					% recovery	% recovery	Organics	PFAS					2010-03-10
Perfluorooctanoic Acid	Perfluorooctanoic Acid (PFOA)	335671		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorooctanoic acid (PFOA)	Perfluorooctanoic acid (PFOA)	0		ng/L	ng/g dw		ng/g ww	ng/g dw	PFOA						2020-12-02
Perfluorooctanoic Acid, 2H,2H,3H,3H-	2H,2H,3H,3H-Perfluorooctanoic Acid (5:3FTCA)	914637493		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorooctanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanoic Acid-13C2 (PFOA-13C2)	864071089		% recovery					Organics	PFAS	IDA				2025-04-04
Perfluorooctanoic Acid-13C2(Surrogate)	Surrogate: Perfluorooctanoic Acid-13C2 (PFOA-13C2)	864071089		% recovery					Organics	PFAS					2025-06-11
Perfluorooctanoic Acid-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanoic Acid-13C8 (PFOA-13C8)	1350614844		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluorooctylphosphate, 1H,1H,2H,2H-	1H,1H,2H,2H-perfluorooctylphosphate (6:2 monoPAP)	0			ng/g dw				Organics	PFAS	PFC Precursor				2014-10-20
Perfluorooctylphosphate-13C2, 1H,1H,2H,2H-(Surrogate)	Surrogate: 1H,1H,2H,2H-perfluorooctylphosphate-13C2	0			% recovery				Organics	PFAS					2014-10-02
Perfluorooctylphosphonate	Perfluorooctylphosphonate (PFOPA)	0			ng/g dw				Organics	PFAS	PFC Precursor				2014-10-20
Perfluoropentanesulfonate	Perfluoropentanesulfonate	0		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2019-08-28
Perfluoropentanesulfonic Acid	Perfluoropentanesulfonic Acid (PFPeS)	2706914		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluoropentanoate	Perfluoropentanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2008-06-27
Perfluoropentanoate-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoropentanoate-13C5 (PFPA) (PFPeA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluoropentanoate-13C5(Surrogate)	Surrogate: Perfluoropentanoate-13C5 (PFPA) (PFPeA)	0					% recovery	% recovery	Organics	PFAS					2021-06-02
Perfluoropentanoic Acid	Perfluoropentanoic Acid (PFPeA)	2706903		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluoropentanoic Acid-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoropentanoic Acid-13C5 (PFPeA-13C5)	2283397793		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluoropropyl Propanoic Acid, 3-	3-Perfluoropropyl Propanoic Acid (3:3FTCA)	356025		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorotetradecanoate	Perfluorotetradecanoate	376067		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2019-08-28
Perfluorotetradecanoate-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorotetradecanoate-13C2 (PFTeDA) (PFTA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluorotetradecanoate-13C2(Surrogate)	Surrogate: Perfluorotetradecanoate-13C2 (PFTeDA) (PFTA)	0					% recovery	% recovery	Organics	PFAS					2021-06-02
Perfluorotetradecanoic Acid	Perfluorotetradecanoic Acid (PFTeDA)	376067		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorotetradecanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorotetradecanoic Acid-13C2 (PFTeDA-13C2)	2708218828		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Perfluorotridecanoate	Perfluorotridecanoate	72629948		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2019-08-28
Perfluorotridecanoic Acid	Perfluorotridecanoic Acid (PFTrDA)	72629948		ng/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluorotridecanoic Acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorotridecanoic Acid-13C2 (PFTrDA-13C2)	0			% recovery		% recovery	% recovery	Organics	PFAS					2025-04-14
Perfluoroundecanoate	Perfluoroundecanoate	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2008-06-27
Perfluoroundecanoate-13C7(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroundecanoate-13C7 (PFUnDA) (PFUdA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS					2022-02-24
Perfluoroundecanoate-13C7(Surrogate)	Surrogate: Perfluoroundecanoate-13C7 (PFUnDA) (PFUdA)	0					% recovery	% recovery	Organics	PFAS					2021-06-02
Perfluoroundecanoic Acid	Perfluoroundecanoic Acid (PFUnA)	2058948		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PFAS					2025-01-27
Perfluoroundecanoic Acid-13C7(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroundecanoic Acid-13C7 (PFUnA-13C7)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAS	IDA				2025-04-04
Permethrin, cis-	cis-Permethrin, formerly peak 1	61949766		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Permethrin, cis-(Surrogate)	Surrogate: cis-Permethrin	61949766		% recovery	% recovery				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Permethrin, Total	Total Permethrin, sum peaks cis and trans (formerly 1 & 2)	52645531		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Permethrin, trans-	trans-Permethrin formerly peak 2	61949777		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Permethrin, trans-(Surrogate)	Surrogate: trans-Permethrin	61949777		% recovery					Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Permethrin-13C6, cis-(IsoDilAnalogue)	Isotope Dilution Analogue: cis-Permethrin-13C6	0					% recovery	% recovery	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Permethrin-13C6, cis-(Surrogate)	Surrogate: cis-Permethrin-13C6	0		ng/L	% recovery		% recovery	% recovery	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Permethrin-13C6, trans-(IsoDilAnalogue)	Isotope Dilution Analogue: trans-Permethrin-13C6	0					% recovery	% recovery	Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Personal hygiene	Hygiene products	0	pieces						Debris	Trash	Plastics				2022-11-02
Perthane	Perthane	72560		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	OrganochlorinePesticides	Insecticides			2011-07-15
Perylene	Perylene	198550		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Perylene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Perylene-d12	1520963		% recovery					Organics	PAHs	IDA				2023-11-07
Perylene-d12(Surrogate)	Surrogate: Perylene-d12	1520963		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
pH	pH	0		none	none	none			WaterQualityMeasurements	ToxTreatment					2009-08-20
pH, Daily Maximum	Daily Maximum pH	0		none					WaterQualityMeasurements	Conventionals					2024-09-06
pH, Daily Minimum	Daily Minimum pH	0		none					WaterQualityMeasurements	Conventionals					2024-09-06
Phenanthrene	Phenanthrene	85018		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors		2007-07-27
Phenanthrene/Anthracene, C1-	C1-Phenanthrene/Anthracene	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Phenanthrene/Anthracene, C2-	C2-Phenanthrene/Anthracene	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Phenanthrene/Anthracene, C3-	C3-Phenanthrene/Anthracene	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Phenanthrene/Anthracene, C4-	C4-Phenanthrene/Anthracene	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2010-06-21
Phenanthrene-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Phenanthrene-d10	1517222		% recovery					Organics	PAHs	IDA				2023-11-07
Phenanthrene-d10(Surrogate)	Surrogate: Phenanthrene-d10	1517222		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors		2007-07-27
Phenol	Phenol	108952		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	non-Chlorinated Phenols			2007-07-27
Phenol, 2-(2H-Benzotriazol-2-yl)-4,6-bis(1-Methyl-1-Phenylethyl)-	2-(2H-Benzotriazol-2-yl)-4,6-bis(1-methyl-1-phenylethyl)phenol (UV-234)	70321867		ng/L					Organics	Benzotriazoles and Benzothiazoles					2026-02-10
Phenol-d5(Surrogate)	Surrogate: Phenol-d5	4165622		ug/L					Organics	SVOCs					2014-01-29
Phenol-d6(Surrogate)	Surrogate: Phenol-d6	13127883		ug/L					Organics	VOCs	Phenols	non-Chlorinated Phenols			2007-07-27
Phenolics, Total	Total Phenolics, classification of phenols	0		ug/L					Organics	PPCPs					2013-05-28
Phenothrin	Phenothrin	26002802		ug/L	ug/Kg ww				Organics	Pesticides	Insecticides	Pyrethroids			2009-06-22
Phenyl-p-phenylenediamine-quinone, N-Isopropyl-N'-	N-Isopropyl-N'-phenyl-p-phenylenediamine-quinone (IPPD-quinone)	68054739		ng/L					Organics	para-Phenylenediamine (PPD) Derivatives					2025-06-29
Phenylpyrazole, 1-(Surrogate)	Surrogate: 1-Phenylpyrazole	1126007		% recovery					Organics	Pesticides	Insecticides	Phenylpyrazoles			2024-07-23
Phenytoin	Phenytoin	57410		ng/L											2018-08-20
Phenytoin-d10(Surrogate)	Surrogate: Phenytoin-d10	65854979		% recovery					Organics	PPCPs	Pharmaceuticals				2026-06-12
Pheophytin a	Pheophytin a	603178		ug/L					Inorganics	Conventionals	Benthic				2011-11-10
PhiX174	phi X 174 bacteriophage	0		copies/100 mL					Microbiological						2020-10-29
Phone	Phone	0	pieces						Debris	Trash	Plastics	Toxic			2014-11-04
Phorate	Phorate	298022		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides		2007-07-27
Phosalone	Phosalone	2310170		ug/L					Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Phosalone Oxon	Phosalone Oxon	0		ug/L					Organics	Pesticides					2017-04-04
Phosmet	Phosmet	732116		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Phosmet-Oxon	Phosmet-Oxon	3735339		ug/L					Organics	Pesticides					2017-04-20
Phosphamidon	Phosphamidon	13171216		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Phosphate as P	Phosphate as P	14265442		umol/L	mg/Kg dw				Inorganics	Conventionals	Nutrients	WaterQualityMeasurements			2012-10-31
Phosphorus as P	Phosphorus as P	7723140		ug/L	ug/g ww		ug/g ww	ug/g dw	Inorganics	Conventionals	Nutrients				2012-10-31
Phosphorus, Inorganic	Inorganic Phosohorus	0		mg/L					Inorganics	Conventionals					2018-01-18
Phosphorus, Iron Bound	Phosphorus, Iron Bound	0			ug/g dw				Inorganics	Conventional	Nutrients				2022-03-01
Phosphorus, loosely bound	Phosphorus, loosely bound	0			ug/g dw				Inorganics	Conventional	Nutrients				1900-01-01
Phytane	Phytane	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Alkanes					2014-01-28
Picloram	Picloram	1918021		ug/L					Organics	Herbicides					2016-05-20
Picoxystrobin	Picoxystrobin	117428225		ng/L					Organics	Pesticides	Fungicides				2016-03-10
PictureCode	Picture code idenifier	0	none						FieldObservations	Habitat					2009-08-20
Pipe, PVC	Pipe, PVC	0	pieces						Debris	Trash	Plastics	Household			2014-11-04
Piperonyl Butoxide	Piperonyl Butoxide	51036		ug/L	ug/Kg ww				Organics	Pesticides					2026-05-08
Pipes, Drains	Pipes, Drains	0	none						Habitat						2009-08-20
Pirimiphos Methyl	Pirimiphos Methyl	29232937		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	Insecticides				2013-05-29
Plastic	Plastic using Trash Protocol	0	pieces						Trash						2011-05-04
Plastic MicroDebris, > 4.75 mm	Plastic MicroDebris, > 4.75 mm	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, 0.355 mm	Plastic MicroDebris, 0.355 mm	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, 0.500 mm	Plastic MicroDebris, 0.500 mm	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, 1.0 mm	Plastic MicroDebris, 1.0 mm	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, 2.0 mm	Plastic MicroDebris, 2.0 mm	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, 4.75 mm	Plastic MicroDebris, 4.75 mm	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, Black	Plastic MicroDebris, Black	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, Blue	Plastic MicroDebris, Blue	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, Clear	Plastic MicroDebris, Clear	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, Green	Plastic MicroDebris, Green	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, Grey	Plastic MicroDebris, Grey	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, Orange	Plastic MicroDebris, Orange	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, Peach	Plastic MicroDebris, Peach	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, Pink	Plastic MicroDebris, Pink	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, Red	Plastic MicroDebris, Red	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, Tan	Plastic MicroDebris, Tan	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, White	Plastic MicroDebris, White	0	pieces						Debris	Plastics					2014-11-04
Plastic MicroDebris, Yellow	Plastic MicroDebris, Yellow	0	pieces						Debris	Plastics					2014-11-04
Plastic, Other	Plastic, Other	0	pieces						Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Plate, Waxed Paper	Plate, Waxed Paper	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
PMMoV	Pepper mild mottle virus	0		gc/mL					Microbiological						2020-10-29
Point Source Discharges Extent	Point Source Discharges Extent	0	none						Habitat						2019-05-07
Point Source Discharges Intensity	Point Source Discharges Intensity	0	none						Habitat						2019-05-07
Point Source Discharges Proximity	Point Source Discharges Proximity	0	none						Habitat						2019-05-07
Ponded	Ponded water that either evaporates and/or infiltrates and does not flow to a surface receiving water	0	none						Habitat						2014-04-07
Pool	Pool	0	%						Habitat						2009-08-20
Pool Form	Pool Form	0	none						Habitat						2009-08-20
Porosity	Porosity	0			mL/cm3				WaterQualityMeasurements	Ancillary					2014-02-05
Position	Position along transect where sample collected	0	none						Habitat						2012-09-13
Potassium	Potassium	7440097		ug/L	mg/Kg nr		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals	Conventionals			2007-07-27
Potential Non-Stormwater Source	Potential Non-Stormwater Source	0	none												2016-06-13
Poultry	Poultry	0	none						Habitat						2009-08-20
Power Plants	Power Plants	0	none						Habitat						2009-08-20
Prallethrin	Prallethrin	23031369		ug/L	ug/Kg ww				Organics	Pesticides	Insecticides	Pyrethroids			2009-06-22
Precipitation	Precipitation	0	none						FieldObservations	Habitat					2009-08-20
PrecipitationLast24hrs	PrecipitationLast24hrs	0	none						FieldObservations	Habitat					2013-05-28
Precipitationlast72hrs	Precipitation within the last 72 hours	0	none												2016-06-13
Prednisolone	Prednisolone	50248		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Prednisone	Prednisone	53032		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Primidone	Primidone	125337		ng/L											2018-08-20
Primidone-d5(Surrogate)	Surrogate: Primidone-d5	73738064		% recovery					Organics	PPCPs	Pharmaceuticals				2026-06-12
Primitive Parks, Camping	Primitive Parks, Camping	0	none						Habitat						2009-08-20
Pristane	Pristane	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Alkanes					2014-01-28
Procymidone	Procymidone	32809168		ug/L					Organics	Pesticides					2016-10-25
Prodiamine	Prodiamine	29091212		ug/L	ug/Kg dw				Organics	Herbicides					2016-05-20
Profenofos	Profenofos	41198087		ug/L					Organics	Pesticides					2016-10-25
Profluralin	Profluralin	26399360		ug/L					Organics	Pesticides	Herbicides				2016-10-25
Progesterone	Progesterone	57830		ng/L											2018-08-31
Progesterone-d9(IsoDilAnalogue)	Isotope Dilution Analogue: Progesterone-d9	15775743		% recovery					Organics						2022-07-22
Progesterone-d9(Surrogate)	Surrogate: Progesterone-d9	15775743		% recovery					Organics	PPCPs					2026-06-12
Promethazine	Promethazine	60877		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Promethazine-d4(Surrogate)	Surrogate: Promethazine-d4	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Prometon	Prometon	1610180		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Prometryn	Prometryn	7287196		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Pronamide	Pronamide (Propyzamide)	23950585		ug/L					Organics	Herbicides					2013-05-28
Propachlor	Propachlor	1918167		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Propanil	Propanil	709988		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides				2007-07-27
Propargite	Propargite	2312358		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OPs	Acaricides			2007-07-27
Propazine	Propazine	139402		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Propham	Propham	122429		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Propiconazole	Propiconazole	60207901		ug/L	ug/Kg dw				Organics	Herbicides					2013-05-20
Proportion	Proportion	0	%						Habitat						2009-08-20
Propoxur	Propoxur	114261		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides			2007-07-27
Propoxyphene	Propoxyphene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Propoxyphene-d5(Surrogate)	Surrogate: Propoxyphene-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Propranolol	Propranolol	525666		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Propranolol-d7(Surrogate)	Surrogate: Propranolol-d7	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Propylbenzene, n-	n-Propylbenzene	103651		ug/L					Organics	VOCs					2007-07-27
Propyzamide	Propyzamide	23950585		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides				2016-03-10
Pseudo-nitzschia	Pseudo-nitzschia	0		cells/ml					Microbiological	Pathogens					2016-05-20
p-Terphenyl-d14(Surrogate)	Surrogate: p-Terphenyl-d14	0		% recovery	% recovery		ng/g ww	ng/g dw	Organics	SVOCs					2016-05-20
Public Access	Public Access	0	none						Habitat	Debris					2014-11-04
Pymetrozin	Pymetrozin	123312890		ug/L					Organics	Pesticides					2016-10-25
Pyraclostrobin	Pyraclostrobin	175013180		ug/L	ug/Kg dw				Organics	Fungicides					2016-05-20
Pyrene	Pyrene	129000		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Pyrene-d10(Surrogate)	Surrogate: Pyrene-d10	1718521		ug/L	% recovery		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH			2007-07-27
Pyrethrin-1	Pyrethrin-1	121211		ug/L	ng/g dw				Organics	Pesticides	Pyrethrins	Insecticides			2026-05-08
Pyrethrin-2	Pyrethrin-2 (Pyrethrin II)	121299		ug/L	ng/g dw				Organics	Pesticides	Pyrethrins	Insecticides			2026-05-08
Pyridaben	Pyridaben	96489713		ug/L	ug/Kg dw				Organics	Pesticides	Insecticides				2016-03-10
Pyridine	Pyridine	110861		ug/L					Organics	SVOCs					2016-09-06
Pyrimethanil	Pyrimethanil	53112280		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Pyriproxyfen	Pyriproxyfen	95737681		ug/L					Organics	Pesticides					2017-04-04
Quinoxyfen	Quinoxyfen	124495187		ug/L					Organics	Pesticides	Fungicides				2016-03-10
Radium-226	Radium-226	13982633		pCi/L					Radiochemistry						2013-05-20
Radium-228	Radium-228	0		pCi/L					Radiochemistry	NULL					2016-05-20
Railroad Extent	Railroad Extent	0	none						Habitat						2019-05-07
Railroad Intensity	Railroad Intensity	0	none						Habitat						2019-05-07
Railroad Proximity	Railroad Proximity	0	none						Habitat						2019-05-07
Rangeland Extent	Rangeland Extent	0	none						Habitat						2019-05-07
Rangeland Intensity	Rangeland Intensity	0	none						Habitat						2019-05-07
Rangeland Proximity	Rangeland Proximity	0	none						Habitat						2019-05-07
Ranitidine	Ranitidine	66357355		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Rapid	Rapid	0	%						Habitat						2009-08-20
Ratio of SEM/AVS	Ratio of SEM/AVS	0		ug/L	umol/g				Inorganics	Metals					2014-01-29
Rebar	Rebar	0	pieces						Debris	Trash	Non-Plastics	Metals			2014-11-04
Reproduction	Reproduction	0				Num/Rep			Toxicity						2007-07-27
Residences	Residences	0	none						Habitat						2009-08-20
Residential Dumping	Residential Dumping	0	none						Habitat						2009-08-20
Residual Phosphorus	Residual Phosphorus	0			ug/g dw				Inorganics	Conventional	Nutrients				1900-01-01
Resmethrin	Resmethrin	10453868		ug/L	ug/Kg ww				Organics	Pesticides	Insecticides	Pyrethroids			2014-01-28
Retene	Retene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Ribbon, Non-plastic	Ribbon, Non-plastic	0	pieces						Debris	Trash	Non-Plastics	Household			2014-11-04
Ribbon, Packaging	Ribbon, Packaging	0	pieces						Debris	Trash	Plastics	Miscellaneous			2014-11-04
Riffle	Riffle	0	%						Habitat						2009-08-20
Riffle/Run Bank Stability	Riffle/Run Bank Stability (used for EMAP RBP 20-score habitat characterization)	0	none						Habitat						2009-08-20
Riffle/Run Channel Alteration	Riffle/Run Channel Alteration	0	none						Habitat						2009-08-20
Riffle/Run Channel Flow Status	Riffle/Run Channel Flow Status	0	none						Habitat						2009-08-20
Riffle/Run Embeddedness	Riffle/Run Embeddedness	0	none						Habitat						2009-08-20
Riffle/Run Epifaunal Substrate	Riffle/Run Epifaunal Substrate	0	none						Habitat						2009-08-20
Riffle/Run Frequency	Riffle/Run Frequency	0	none						Habitat						2009-08-20
Riffle/Run Riparian Zone Width	Riffle/Run Riparian Zone Width	0	none						Habitat						2009-08-20
Riffle/Run Sediment Deposition	Riffle/Run Sediment Deposition	0	none						Habitat						2009-08-20
Riffle/Run Vegetative Protection	Riffle/Run Vegetative Protection	0	none						Habitat						2009-08-20
Riffle/Run Velocity/Depth Regime	Riffle/Run Velocity/Depth Regime scale data	0	none						Habitat						2009-08-20
Rimsulfuron	Rimsulfuron	0		ug/L					Organics	Pesticides	Herbicides				2017-04-04
Riparian Bridges/Abutments	Riparian Bridges/Abutments	0	none						Habitat						2009-08-20
Riparian Buildings	Riparian Buildings	0	none						Habitat						2009-08-20
Riparian Canopy Big Trees	EMAP BA Specific - Riparian Canopy Big Trees (Trunk > 0.3m DBH)	0	none						Habitat						2009-08-20
Riparian Canopy Small Trees	EMAP BA Specific - Riparian Canopy Small Trees (Trunk < 0.3 m DBH)	0	none						Habitat						2009-08-20
Riparian Canopy Veg Type	Riparian Canopy Vegetation Type	0	none						Habitat						2009-08-20
Riparian Corridor Shading	Percent of stream's water surface upstream of sample location estimated to be shaded if the sun was directly over the stream	0	%						FieldObservations	Habitat					2010-03-03
Riparian Cover Metric	Metric assesses total vegetation cover in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte.	0	score						Habitat						2019-05-13
Riparian Grasses	Riparian Grasses	0	%						Habitat						2019-05-07
Riparian GroundCover Barren	Riparian Ground Cover Barren, Bare Dirt or Duff	0	none						Habitat						2009-08-20
Riparian GroundCover NonWoody Plants	Riparian Ground Cover Non-woody Herbs, Grasses & Forbes	0	none						Habitat						2009-08-20
Riparian GroundCover Woody Shrubs	Riparian Ground Cover Woody Shrubs & Saplings	0	none						Habitat						2009-08-20
Riparian Landfill/Trash	Riparian Landfill/Trash	0	none						Habitat						2009-08-20
Riparian Logging	Riparian Logging Operations	0	none						Habitat						2009-08-20
Riparian Lower Canopy All Vegetation	Riparian Lower Canopy All Vegetation (merge of Riparian Understory Non-Woody Plants and Riparian Understory Woody Shrubs in EMAP BA)	0	none						Habitat						2009-08-20
Riparian Mining	Riparian Mining Activity	0	none						Habitat						2009-08-20
Riparian NonWoody Veg	Riparian NonWoody Veg	0	%						Habitat						2019-05-07
Riparian Orchards/Vineyards	Riparian Orchards/Vineyards	0	none						Habitat						2009-08-20
Riparian Park/Lawn	Riparian Park/Lawn	0	none						Habitat						2009-08-20
Riparian Pasture/Range	Riparian Pasture/Range/Hay field	0	none						Habitat						2009-08-20
Riparian Pavement	Riparian Pavement/Cleared Lot	0	none						Habitat						2009-08-20
Riparian Pipes	Riparian Piles (Inlet/Outlet)	0	none						Habitat						2009-08-20
Riparian Powerline	Human disturbance measure for powerlines	0	none						Habitat						2012-05-22
Riparian Road	Riparian Road/Railroad	0	none						Habitat						2009-08-20
Riparian Row Crops	Riparian Row Crops	0	none						Habitat						2009-08-20
Riparian Sub Condition/Vert Connectivity Metric	Metric assesses riparian substratum condition influencing natural infiltration capacity and vertical connectivity affecting alluvial permeability, subsurface flows and groundwater connectivity.	0	score						Habitat						2019-05-13
Riparian Trail	Human disturbance measure for trails	0	none						Habitat						2012-05-22
Riparian Understory NonWoody Plants	EMAP BA specific - Riparian Understory Non-woody Herbs, Grasses & Forbes	0	none						Habitat						2009-08-20
Riparian Understory Veg Type	Riparian Understory Vegetation Type	0	none						Habitat						2009-08-20
Riparian Understory Woody Shrubs	EMAP BA Specific - Riparian Understory Woody Shrubs & Saplings	0	none						Habitat						2009-08-20
Riparian Upper Canopy All Trees	Riparian Upper Canopy All Trees (merge of Riparian Canopy Big Trees and Small Trees in EMAP BA)	0	none						Habitat						2009-08-20
Riparian Upper Canopy Deciduous	Riparian Upper Canopy Deciduous	0	none						Habitat						2012-05-22
Riparian Upper Canopy Evergreen	Riparian Upper Canopy Evergreen	0	none						Habitat						2012-05-22
Riparian Vegetation Management	Riparian Vegetation Management	0	none						Habitat						2009-08-20
Riparian Vegetation Width Metric	Metric assesses the average width of the defined riparian zone along the assessment area.	0	score						Habitat						2019-05-13
Riparian Wall/Dike	Riparian Wall/Dike/Revetment/Riprap/Dam	0	none						Habitat						2009-08-20
Riparian Woody Veg	Riparian Woody Veg	0	%						Habitat						2019-05-07
RipRAM Index	Riparian Rapid Assessment Method (RAM) for California index score based on the average score of eight component metrics.	0	score						Habitat						2019-05-13
RipRap/Armored Channel bed/bank Extent	RipRap/Armored Channel bed/bank Extent	0	none						Habitat						2019-05-07
RipRap/Armored Channel bed/bank Intensity	RipRap/Armored Channel bed/bank Intensity	0	none						Habitat						2019-05-07
RipRap/Armored Channel bed/bank Proximity	RipRap/Armored Channel bed/bank Proximity	0	none						Habitat						2019-05-07
RisingGroundwater	Rising groundwater (i.e., a spring) that is the source of water in a receiving water and may contribute (or even define) the receiving water quality	0	none						Habitat						2014-04-07
Roads	Roads	0	none						Habitat						2009-08-20
Rope, Polypropylene	Rope, Polypropylene	0	pieces						Debris	Trash	Plastics	Miscellaneous			2014-11-04
Rope/Tie	Rope/Tie	0	pieces						Debris	Trash	Plastics	Miscellaneous			2014-11-04
Roxithromycin	Roxithromycin	80214831		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Rubber Materials (Non-Specific)	Rubber Materials (Non-Specific)	0	pieces						Debris	Trash	Non-Plastics	Construction			2014-11-04
Rubber Piece	Rubber Piece	0	pieces						Debris	Trash	Plastics	Miscellaneous			2014-11-04
Ruminant_Rum2Bac	Ruminant_Rum2Bac	0		copies/100 mL					Microbiological	Pathogens	Conventionals				2018-08-15
Run	Run	0	%						Habitat						2009-08-20
Rural Residential Extent	Rural Residential Extent	0	none						Habitat						2019-05-07
Rural Residential Intensity	Rural Residential Intensity	0	none						Habitat						2019-05-07
Rural Residential Proximity	Rural Residential Proximity	0	none						Habitat						2019-05-07
Sachets, Beverage	Beverage, Sachets/packets, e.g., Caprisuns	0	pieces						Debris	Trash	Non-Plastic				2022-11-02
Safrotin	Safrotin	77491306		ug/L					Organics	Pesticides	Insecticides				2016-10-25
Salicylic Acid	Salicylic Acid	69727		ng/L											2018-08-31
Salicylic Acid-d4(IsoDilAnalogue)	Isotope Dilution Analogue: Salicylic Acid-d4	78646170		% recovery					Organics						2022-07-22
Salicylic Acid-d4(Surrogate)	Surrogate: Salicylic Acid-d4	78646170		% recovery					Organics	PPCPs	Pharmaceuticals				2026-06-12
Salinity	Salinity	0		psu	ppt				WaterQualityMeasurements	Conventionals	Inorganics				2009-08-20
Salinity, Daily Mean	Daily Mean Salinity (Calculated)	0		psu					WaterQualityMeasurements	Conventionals	Inorganics				2024-09-06
Salmonella	Salmonella	0		none					Microbiological	Pathogens	Conventionals				2010-04-21
Salmonella-invA	Salmonella-invA	0		copies/100 mL					Microbiological	Pathogens	Conventionals				2010-04-21
Salmonella-ttr	Salmonella-ttr	0		copies/100 mL					Microbiological	Pathogens	Conventionals				2010-04-21
Sand	Sand	0		mg/L	% ww				Inorganics	Conventionals	GrainSize				2011-09-08
Sand, Coarse_AS (2.0 to <4.75 mm)	Coarse Sand_ASTM Scale (2.0 to <4.75 mm)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Sand, Coarse_WS (0.5 to <1.0 mm_Phi 1 to >0)	Coarse Sand_Wentworth Scale (0.5 to <1.0 mm_Phi 1 to >0)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Sand, Fine_AS (0.075 to <0.425 mm)	Fine Sand_ASTM Scale (0.075 to <0.425 mm)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Sand, Fine_WS (0.125 to <0.25 mm_Phi 3 to >2)	Fine Sand_Wentworth Scale (0.125 to <0.25 mm_Phi 3 to >2)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Sand, Medium_AS (0.425 to <2.0 mm)	Medium Sand_ASTM Scale (0.425 to <2.0 mm)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Sand, Medium_WS (0.25 to <0.5 mm_Phi 2 to >1)	Medium Sand_Wentworth Scale (0.25 to <0.5 mm_Phi 2 to >1)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Sand, Very Coarse_WS (1.0 to <2.0 mm_Phi 0 to -1)	Very Coarse Sand_Wentworth Scale (1.0 to <2.0 mm_Phi 0 to -1)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Sand, Very Fine_WS (0.0625 to <0.125 mm_Phi 4 to >3)	Very Fine Sand_Wentworth Scale (0.0625 to <0.125 mm_Phi 4 to >3)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Sand_AS (0.075 to <4.75 mm)	Sand_ASTM Scale (0.075 to <4.75 mm)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Sand_WS (0.0625 to <2.0 mm_Phi 4 to >-1)	Sand_Wentworth Scale (0.0625 to <2.0 mm_Phi 4 to >-1)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Sarafloxacin	Sarafloxacin	98105998		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Saxitoxins	Saxitoxins	0		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins					2012-05-22
Saxitoxins gene, Prokaryotic DNA (sxtA)	Saxitoxins gene, Prokaryotic DNA, Target Gene: (sxtA), Proprietary primer sequences from Bend Genetics LLC	0		gc/mL					Microbiological	Cyanotoxins	Gene Marker				2026-05-27
Scandium	Scandium	7440202		ug/L					Inorganics						2013-05-20
Seagrass	Seagrass	0	pieces						Debris	Natural	Non-Plastics	Marine Origin			2014-11-04
Sealed Shell Volume	Sealed Shell Volume (weight (in grams) of water displaced by each bivalve)	0					mL	mL	Organics	Inorganics	Metals	Conventionals	Semi-VOAs	VOAs	2012-11-08
SeaState	SeaState	0	none						FieldObservations	Habitat					2009-08-20
Secbumeton	Secbumeton	26259450		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Secchi Depth	Measurement of clarity based on the depth at which the Secchi disk can be differentiated	0		m					WaterQualityMeasurements						2007-07-27
Sedaxane	Sedaxane	874967676		ng/L					Organics	Pesticides	Fungicides				2016-09-06
Sediment Disturbance Other Extent	Sediment Disturbance Other Extent	0	none						Habitat						2019-05-07
Sediment Disturbance Other Intensity	Sediment Disturbance Other Intensity	0	none						Habitat						2019-05-07
Sediment Disturbance Other Proximity	Sediment Disturbance Other Proximity	0	none						Habitat						2019-05-07
Selenate as Se	Selenate as Se (Se VI)	0		ug/L	mg/Kg dw				Inorganics	Conventionals					2012-05-30
Selenite as Se	Selenite as Se (Se IV)	0		ug/L	mg/Kg dw				Inorganics	Conventionals					2012-05-30
Selenium	Selenium	7782492		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals				2007-07-27
Selenomethionine	Selenomethionine	1464422		ug/L					Organics	AminoAcid					2025-08-25
Sertraline	Sertraline	79617962		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Sethoxydim	Sethoxydim	0		ug/L					Organics	Pesticides	Herbicides				2017-04-04
Settleable Solids	Settleable Solids	0		mL/L/hr					Inorganics	Conventionals					2013-11-11
Sewage Treatment	Sewage Treatment	0	none						Habitat						2009-08-20
Shade	Amount of shade within the algae sampling area (1 m2)	0	%						Habitat						2012-09-13
Shoe	Shoe	0	pieces						Debris	Trash	Non-Plastics	Household			2014-11-04
Shopping Cart	Shopping Cart	0	pieces						Debris	Trash	Non-Plastics	Large			2014-11-04
Side Channel	Side Channel present	0	none						Habitat						2009-08-20
Siduron	Siduron	1982496		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides			2007-07-27
Silica as SiO2	Silica as SiO2	14808607		ug/L					Inorganics	Conventionals	Habitat				2010-02-02
Silicate as Si	Silicate as Si (Si(OH)4)	0		umol/L					Inorganics	Conventionals					2013-05-28
Silicon	Silicon	7440213		mg/L			ug/g ww	ug/g dw	Inorganics	Metals					2009-08-05
Silt	Silt	0		mg/L	% ww				Inorganics	Conventionals	GrainSize				2011-09-08
Silt + Clay	Silt + Clay	0			%				Inorganics						2017-04-04
Silt and Clay_WS (<0.0625 mm_Phi >4)	Silt and Clay_Wentworth Scale (<0.0625 mm_Phi >4)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Silt, Coarse_WS (0.031 to <0.0625 mm_Phi 5 to >4)	Coarse Silt_Wentworth Scale (0.031 to <0.0625 mm_Phi 5 to >4)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Silt, Fine_WS (0.0078 to <0.0156 mm_Phi 7 to >6)	Fine Silt_Wentworth Scale (0.0078 to <0.0156 mm_Phi 7 to >6)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Silt, Medium_WS (0.0156 to <0.031 mm_Phi 6 to >5)	Medium Silt_Wentworth Scale (0.0156 to <0.031 mm_Phi 6 to >5)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Silt, Very Fine_WS (0.0039 to <0.0078 mm_Phi 8 to >7)	Very Fine Silt_Wentworth Scale (0.0039 to <0.0078 mm_Phi 8 to >7)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Silt_AS (0.005 to <0.075 mm)	Silt_ASTM Scale (0.005 to <0.075 mm)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Silt_WS (0.0039 to <0.0625 mm_Phi 8 to >4)	Silt_Wentworth Scale (0.0039 to <0.0625 mm_Phi 8 to >4)	0			%				Inorganics	Conventionals	GrainSize				2026-06-12
Silver	Silver	7440224		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals				2007-07-27
Simazine	Simazine	122349		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-Triazines	Herbicides	Algaecides	Endocrine Disruptors	2007-07-27
Simazine(Surrogate)	Surrogate: Simazine	122349		% recovery					Organics	Pesticides	Pest-Triazines				2016-03-02
Simazine-D10(Surrogate)	Surrogate: Simazine-D10	0		% recovery					Organics	Pesticides	Pest-Triazines	220621-39-6			2016-08-08
Simetryn	Simetryn	1014706		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Simvastatin	Simvastatin	79902639		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Sinuosity	Ratio of the curvilinear length along a stream and the Euclidean (straight line) distance between two points along the stream	0	none						Habitat						2015-08-21
Site Length	Site Length	0	m						Habitat	Debris					2014-11-04
Site Width	Site Width	0	m						Habitat	Debris					2014-11-04
Sitosterol, beta-	beta-Sitosterol	83465			ug/Kg dw				Organics						2018-07-16
SkyCode	SkyCode	0	none						FieldObservations	Habitat					2009-08-20
Slope	Slope	0	%						Habitat						2009-08-20
SOD	Sediment Oxygen Demand (SOD)	0			mg/Kg dw				Inorganics	Conventionals					2020-03-30
Sodium	Sodium	7440235		ug/L	mg/Kg dw		ug/g ww	ug/g dw	Inorganics	Conventionals	Metals				2007-07-27
Soft Plastic Piece, non-specific	Soft Plastic Piece, non-specific	0	pieces						Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Soft Sediment	Soft Sediment; indicates presence/absence of soft/small sediment at the point where depth is measured	0	none						Habitat						2009-08-20
Somatic Coliphage (E. coli CN-13)	Somatic Coliphage Plaques, Host Bacterium Strain: E. coli CN-13	0		PFU/L											2022-02-11
Soot	Soot/Black Carbon	0			%										2019-05-17
SpecificConductivity	Specific Conductivity	0		uS/cm					WaterQualityMeasurements	Conventionals	Inorganics				2013-05-28
Sports Ball	Sports Ball	0	pieces						Debris	Trash	Plastics	Household			2014-11-04
Spray Paint Can	Spray Paint Can	0	pieces						Debris	Trash	Non-Plastics	Toxic			2014-11-04
Spring Boxes Extent	Spring Boxes Extent	0	none						Habitat						2019-05-07
Spring Boxes Intensity	Spring Boxes Intensity	0	none						Habitat						2019-05-07
Spring Boxes Proximity	Spring Boxes Proximity	0	none						Habitat						2019-05-07
SQO_CSI	Sediment Quality Objectives (SQO) Chemical Score Index (CSI)	0			score				Sediment Quality Objectives	Index/Metric					2022-03-18
SQO_LOE_Cat_Chemistry	Sediment Quality Objectives Line of Evidence (SQO LOE) Chemistry Category Score. The score represents the concentration of chemicals in sediments and potential risks the benthic organisms have from the pollutants in sediment at a station in a bay/estuary.	0			score				Sediment Quality Objectives	Index/Metric					2022-03-18
SQO_LOE_Cat_Toxicity	Sediment Quality Objectives Line of Evidence (SQO LOE) Toxicity Category Score. The score represents the response of invertebrates to bay/estuary sediment samples collected at a station but exposed in a controlled laboratory.	0			score				Sediment Quality Objectives	Index/Metric					2022-03-18
SQO_SA_Cat	Sediment Quality Objectives (SQO) Station Assessment Category. Overall SQO score for the station. The score represents the impact of pollutants in sediment to the aquatic life living in the sediment in bays/estuaries.	0	none						Sediment Quality Objectives	Index/Metric					2022-03-18
StationWaterDepth	Depth of waterbody where sample was collected	0	m	m	m				Habitat						2011-04-06
StationWaterDepth_Avg	Estimated average depth of the waterbody at the time of sampling	0	cm						Habitat						2012-09-13
StationWaterDepth_Max	Estimated maximum depth of the waterbody at the time of sampling	0	cm						Habitat						2012-09-13
Stick/Branch/Driftwood	Stick/Branch/Driftwood	0	pieces						Debris	Natural	Non-Plastics	Marine Origin			2014-11-04
Stigmastanol, beta	beta-Stigmastanol	19466478			ug/Kg dw				Organics						2018-07-16
Strapping bands, Plastic	Plastic bands used to strap things in place or together	0	pieces						Debris	Trash	Plastics				2022-11-02
Straw	Straw	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
Stream Confinement	Confinement based upon the valley width in relation to average bankfull width which the riverine system can migrate without encountering a hillside, terrace or other feature	0	none						Habitat						2019-05-13
StreamBankCharacteristics_Concrete	StreamBankCharacteristics_Concrete	0	none						Habitat	Debris					2014-11-04
StreamBankCharacteristics_Earthen	StreamBankCharacteristics_Earthen	0	none						Habitat	Debris					2014-11-04
StreamBankCharacteristics_RipRap	StreamBankCharacteristics_RipRap	0	none						Habitat	Debris					2014-11-04
StreamBankCharacteristics_Sloped	StreamBankCharacteristics_Sloped	0	none						Habitat	Debris					2014-11-04
StreamBankCharacteristics_Vegetated	StreamBankCharacteristics_Vegetated	0	none						Habitat	Debris					2014-11-04
StreamBankCharacteristics_Vertical	StreamBankCharacteristics_Vertical	0	none						Habitat	Debris					2014-11-04
StreamBedCharacteristics_Concrete	StreamBedCharacteristics_Concrete	0	none						Habitat	Debris					2014-11-04
StreamBedCharacteristics_Earthen	StreamBedCharacteristics_Earthen	0	none						Habitat	Debris					2014-11-04
StreamBedCharacteristics_Rock	StreamBedCharacteristics_Rock	0	none						Habitat	Debris					2014-11-04
StreamBedCharacteristics_SubPlants	StreamBedCharacteristics_SubPlants	0	none						Habitat	Debris					2014-11-04
StreamMixing	Classification of stream mixing by stratification, well-mixed or poorly mixed	0	none						FieldObservations	Habitat					2009-08-20
StreamWidth	StreamWidth	0	m						FieldObservations	Habitat					2009-08-20
Streptococcus, Fecal	Fecal Streptococcus	0		MPN/100 mL					Microbiological	Pathogens	Conventional				2026-04-03
Strontium	Strontium	7440246		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals					2007-07-27
Strontium-87/Strontium-86 Ratio	Strontium-87/Strontium-86 Ratio	0		per mil					Isotopes						2013-05-20
Strontium-90	Strontium-90	0		pCi/L											2016-12-23
Styrene	Styrene	100425		ug/L			ug/Kg ww	ug/Kg dw	Organics	VOCs					2007-07-27
Styrofoam Pellet	Styrofoam Pellet	0	pieces						Debris	Trash	Plastics	Bags/Packaging			2014-11-04
SubreachesFished	Subreaches fished within a given waterbody	0	none						Habitat						2012-09-13
Substrate Modifier	Substrate Modifier	0	none						Habitat						2012-05-22
Substrate Size Class	Substrate Size Class	0	none						Habitat						2009-08-20
Suburban Residential Extent	Suburban Residential Extent	0	none						Habitat						2019-05-07
Suburban Residential Intensity	Suburban Residential Intensity	0	none						Habitat						2019-05-07
Suburban Residential Proximity	Suburban Residential Proximity	0	none						Habitat						2019-05-07
Sucralose	Sucralose	56038132		ug/L											2018-08-20
Sulfachloropyridazine	Sulfachloropyridazine	80320		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Sulfadiazine	Sulfadiazine	68359		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Sulfadimethoxine	Sulfadimethoxine	122112		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Sulfallate	Sulfallate (CDEC)	95067		ug/L					Organics	Pesticides	Herbicides				2016-10-25
Sulfamerazine	Sulfamerazine	127797		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Sulfamethazine	Sulfamethazine	57681		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Sulfamethazine-13C6(Surrogate)	Surrogate: Sulfamethazine-13C6	77643915		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2012-05-22
Sulfamethizole	Sulfamethizole	144821		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Sulfamethoxazole	Sulfamethoxazole	723466		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Sulfamethoxazole-13C6(Surrogate)	Surrogate: Sulfamethoxazole-13C6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Sulfanilamide	Sulfanilamide	63741		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Sulfate	Sulfate	14808798		ug/L	mg/Kg nr				Inorganics	Conventionals	Nutrients				2007-07-27
Sulfathiazole	Sulfathiazole	72140		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Sulfide, Dissolved	Dissolved Sulfide	0		mg/L	mg/Kg dw										2017-05-25
Sulfide, Total	Total Sulfide	0		ug/L	umol/g dw				WaterQualityMeasurements						2013-05-28
Sulfite as SO3	Sulfite as SO3	0		mg/L					Inorganics						2017-03-29
Sulfometuron Methyl	Sulfometuron Methyl	7422972		ug/L					Organics	Herbicides					2013-05-20
Sulfotep	Sulfotepp	3689245		ug/L	ng/g dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Sulfur	Sulfur	7704349					ug	ug	Inorganics						2013-05-20
Sum of 208 PCBs (SFEI)	Sum of 208 PCBs (SFEI)	0					ng/g ww	ng/g dw	Organics	PCBs					2010-11-04
Sum of 209 PCBs (SFEI)	Sum of 209 PCBs (SFEI)	0					ng/g ww	ng/g dw	Organics	PCBs					2010-06-22
Sum of 40 PCBs (SFEI)	Sum of 40 PCBs (SFEI)	0					ng/g ww	ng/g dw	Organics	PCBs					2010-06-22
Sum of DDTs (RWQCB3)	Sum of DDTs (RWQCB3)	0			ug/Kg dw				Organics						2016-09-23
Sum of HPAHs (Integral)	Sum of HPAHs (Integral)	0			ug/Kg dw										2019-05-17
Sum of LPAHs (Integral)	Sum of LPAHs (Integral)	0			ug/Kg dw										2019-05-17
Surface Films	Surface Films	0	none						Habitat						2009-08-20
SurfaceAreaOfMax	Estimate of the current surface area size as a fraction of the total surface area the waterbody would have at high water stage	0	%						Habitat						2012-09-13
SurfacewaterConnect	Discharge from an outfall that does or does not flow to and have hydrologic continuity with a surface receiving water and has or does not have the potential to contribute to the quality of the surface receiving water quality	0	none						Habitat						2014-04-07
Survival	Survival (%)	0				%	%	%	Toxicity						2007-07-27
Suspended Sediment Concentration	Suspended Sediment Concentration (SSC)	0		mL/L					Inorganics	Conventionals					2007-07-27
Suspended Sediment Discharge	Suspended Sediment Discharge	0		tons/day					Inorganics						2013-05-20
Swim Normally	Swim Normally (Num/Rep)	0				Num/Rep			Toxicity						2014-04-11
Syringe/Pipette	Syringe/Pipette	0	pieces						Debris	Trash	Plastics	Toxic			2014-11-04
Tampon/Applicator	Tampon/Applicator	0	pieces						Debris	Trash	Plastics				2022-11-02
Tape	Tape	0	pieces						Debris	Trash	Plastics	Household			2014-11-04
Tarp	Tarp	0	pieces						Debris	Trash	Plastics	Household			2014-11-04
TCDD, 2,3,7,8-	2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)	1746016		ug/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
TCDD, 2,3,7,8- (TEQ ND=0)	2,3,7,8-TCDD (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
TCDD, 2,3,7,8- (TEQ ND=1/2 DL)	2,3,7,8-TCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
TCDD, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)	1746016		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
TCDD-13C, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-13C (TCDD)	0		pg/L	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-06-05
TCDD-13C12, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-13C12 (TCDD-13C12)	76523405		% recovery	% recovery				Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
TCDD-13C6, 1,2,3,4-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4-TCDD-13C6	116865588		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2023-11-20
TCDD-13C6, 1,2,3,4-(Surrogate)	Surrogate: 1,2,3,4-Tetrachlorodibenzo-p-dioxin-13C6 (TCDD)	0		% recovery			% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-06-05
TCDD-37Cl, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-37Cl (TCDD)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-06-05
TCDD-37Cl14, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-37Cl14 (TCDD-37Cl14)	85508505		% recovery	% recovery				Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
TCDD-37Cl4, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-37Cl4 (TCDD-37Cl4)	85508505		% recovery	% recovery				Organics	Dioxins/Dibenzofurans	IDA				2025-10-27
TCDF, 2,3,7,8-	2,3,7,8-Tetrachlorodibenzofuran (TCDF)	51207319		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-05-28
TCDF, 2,3,7,8- (TEQ ND=0)	2,3,7,8-TCDF (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-05-28
TCDF, 2,3,7,8- (TEQ ND=1/2 DL)	2,3,7,8-TCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-05-28
TCDF, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzofuran (TCDF)	51207319		% recovery			% recovery	% recovery	Organics	PCDDs/PCDFs	DioxinsDibenzofurans				2013-06-02
TCDF-13C, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzofuran-13C (TCDF)	0		% recovery	% recovery		% recovery	% recovery	Organics	DioxinsDibenzofurans					2013-06-05
TCDF-13C12, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-Tetrachlorodibenzofuran-13C12 (TCDF-13C12)	89059461		% recovery					Organics	Dioxins/Dibenzofurans	IDA				2025-08-25
TCDF-2C, 2,3,7,8-	2,3,7,8-TCDF-2C	0		pg/L					Organics						2017-03-06
Tebuconazole	Tebuconazole (Folicur)	107534963		ug/L	ug/Kg dw				Organics	Fungicides					2016-05-20
Tebufenozide	Tebufenozide	112410238		ug/L					Organics	Pesticides	Insecticides				2017-04-04
Tebupirimfos	Tebupirimfos	96182535		ng/L	ug/Kg dw				Organics	Pesticides	Insecticides				2016-03-10
Tebupirimfos oxon	Tebupirimfos oxon	1035330369		ng/L	ug/Kg dw				Organics	Pesticides					2016-03-10
Tebuthiuron	Tebuthiuron	34014181		ug/L					Organics	Pesticides	Pest-OPs				2007-07-27
Tebuthiuron(Surrogate)	Surrogate: Tebuthiuron	0		% recovery	% recovery				Organics	Pesticides	Herbicides	Herbicides			2017-02-27
Tecnazene	Tecnazene	117180		pg/L			ng/g ww	ng/g dw	Organics	Pesticides	Fungicides				2011-07-15
Tedion	Tedion (Tetradifon)	116290		ug/L	ng/g dw		NR ww	NR dw	Organics	Pesticides	Pest-OCHs				2013-05-28
Tefluthrin	Tefluthrin	79538322		ug/L	ug/Kg ww				Pyrethroid Pesticides						2015-07-02
Television	Television	0	pieces						Debris	Trash	Non-Plastics	Large			2014-11-04
Temephos	Temephos	3383968		ug/L					Organics	PPCPs					2012-09-13
Temperature	Temperature	0		Deg C	Deg C				WaterQualityMeasurements	Conventionals					2009-08-20
Temperature, Daily Mean	Daily Mean Temperature (Calculated)	0		Deg C					WaterQualityMeasurements	Conventionals					2024-09-06
Terbacil	Terbacil	5902512		ug/L					Organics	Herbicides					2016-05-20
Terbium	Terbium	7440279		% recovery					Inorganics	Metals					2017-05-03
Terbium(Surrogate)	Surrogate: Terbium	7440279		% recovery					Inorganics	Metals					2017-08-10
Terbufos	Terbufos	13071799		ug/L	mg/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides	Nematocides	2007-07-27
Terbufos Sulfone	Terbufos Sulfone	0					ug/Kg ww	ug/Kg dw	Organics	Pesticides					2014-01-28
Terbuthylazine	Terbuthylazine	5915413		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Terbutryn	Terbutryn	886500		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides			2007-07-27
Terphenyl-d14	Terphenyl-d14	0		ug/L											2017-01-12
Terphenyl-d14(Surrogate)	Surrogate: Terphenyl-d14	1718510		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs					2016-03-02
Terpineol, alpha-	alpha-Terpineol	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	PPCPs					2014-01-28
Tert-amyl Methyl Ether	Tert-amyl Methyl Ether	994058		ug/L					Organics	VOCs					2013-05-28
Tert-butyl Alcohol	Tert-butyl Alcohol	75650		ug/L					Organics	VOCs					2025-08-25
Testosterone	Testosterone	58220		ng/L											2018-08-31
Testosterone-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Testosterone-d3	77546395		% recovery					Organics						2022-07-29
Testosterone-d3(Surrogate)	Surrogate: Testosterone-d3	77546395		% recovery											2022-05-24
Tetrabromobisphenyl A	Tetrabromobisphenyl A	0					ug/Kg ww	ug/Kg dw	Organics	FlameRetardants					2014-01-28
Tetrabromo-o-chlorotoluene	Tetrabromo-o-chlorotoluene (TBCT)	39569216			ng/g dw				Organics	FlameRetardants					2014-03-13
Tetrabromo-p-xylene	Tetrabromo-p-xylene (pTBX)	23488382			ng/g dw				Organics	FlameRetardants					2014-03-13
Tetrabutyltin as Sn	Tetrabutyltin as Sn	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Organotins					2012-03-29
Tetrachlorobenzene, 1,2,3,4-	1,2,3,4-Tetrachlorobenzene	634662			ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs					2014-01-29
Tetrachlorobenzene, 1,2,3,4-(Surrogate)	Surrogate: 1,2,3,4-Tetrachlorobenzene	0		% recovery	% recovery		% recovery	% recovery	Organics	SVOCs					2014-01-29
Tetrachlorobenzene, 1,2,3,5/1,2,4,5-	1,2,3,5-Tetrachlorobenzene/1,2,4,5-Tetrachlorobenzene	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs					2014-01-29
Tetrachlorobenzene, 1,2,4,5-	1,2,4,5-Tetrachlorobenzene	95943					ug/Kg ww	ug/Kg dw	Organics	SVOCs					2014-01-29
Tetrachlorobenzene-13C6,1,2,3,4-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4-Tetrachlorobenzene-13C6	2483735528			% recovery		% recovery	% recovery							2024-01-19
Tetrachloroethane, 1,1,1,2-	1,1,1,2-Tetrachloroethane	630206		ug/L					Organics	VOCs					2007-07-27
Tetrachloroethane, 1,1,2,2-	1,1,2,2-Tetrachloroethane	76345		ug/L					Organics	VOCs					2007-07-27
Tetrachloroethylene	Tetrachloroethylene, Tetrachloroethene	127184		ug/L					Organics	VOCs	Insecticides				2007-07-27
Tetrachloro-m-xylene	Tetrachlorometaxylene (TCMX)	877098		ug/L	ug/Kg dw				Organics	Pesticides					2011-08-09
Tetrachloro-m-xylene(Surrogate)	Surrogate: Tetrachloro-m-xylene (TCMX)	877098		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs				2016-03-02
Tetrachlorophenol	Tetrachlorophenol	0					ug/Kg ww	ug/Kg dw	Organics	SVOCs					2014-01-29
Tetrachlorophenol, 2,3,4,5-	2,3,4,5-Tetrachlorophenol	4901513		ug/L					Organics	SVOCs	Phenols	Chlorinated Phenols			2010-05-18
Tetrachlorophenol, 2,3,4,6-	2,3,4,6-Tetrachlorophenol	58902		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	Chlorinated Phenols			2010-05-18
Tetrachlorophenol, 2,3,5,6-	2,3,5,6-Tetrachlorophenol	935955		ug/L					Organics	SVOCs	Phenols	Chlorinated Phenols			2010-05-18
Tetrachlorophenyl-hexachloro-norbornene	Tetrachlorophenyl-hexachloro-norbornene (Cl4-DEC604)	34571158			ng/g dw				Organics	FlameRetardants					2015-07-16
Tetrachloroterephthalic acid	Tetrachloroterephthalic acid	2136790		ug/L											2017-01-12
Tetrachlorvinphos	Tetrachlorvinphos (Stirofos)	22248799		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Tetraconazole	Tetraconazole (1-[2-(2,4-Dichlorophenyl)-3-(1,1,2,2-tetrafluoroethoxy)propyl]- 1H-1,2,4-triazole)	112281773		ug/L	ug/Kg dw				Organics	Fungicides					2016-05-20
Tetracosane, n-	n-Tetracosane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes					2014-01-28
Tetracosane, n-(Surrogate)	Surrogate: n-Tetracosane	0		% recovery					Organics	SVOCs					2016-05-20
Tetracycline	Tetracycline	60548		ug/L					Organics	PPCPs					2012-05-22
Tetradecane, 2-phenyl-	2-Phenyl-tetradecane	0			ng/g dw				Organics	SVOCs					2016-05-20
Tetradecane, 3-phenyl-	3-Phenyl-tetradecane	0			ng/g dw				Organics	SVOCs					2016-05-20
Tetradecane, 4-phenyl-	4-Phenyl-tetradecane	0			ng/g dw				Organics	SVOCs					2016-05-20
Tetradecane, 5-phenyl-	5-Phenyl-tetradecane	0			ng/g dw				Organics	SVOCs					2016-05-20
Tetradecane, 6-phenyl-	6-Phenyl-tetradecane	0			ng/g dw				Organics	SVOCs					2016-05-20
Tetradecane, 7-phenyl-	7-Phenyl-tetradecane	0			ng/g dw				Organics	SVOCs					2016-05-20
Tetradecane, n-	n-Tetradecane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes					2014-01-28
Tetradifon	Tetradifon	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides					2008-06-27
Tetraethyl Pyrophosphate	Tetraethyl Pyrophosphate (TEPP)	107493		ug/L	mg/Kg dw				Organics	Pesticides	OrganophosphatePest.				2013-06-27
Tetraethyl pyrophosphate, TEPP	Tetraethyl pyrophosphate, TEPP	107493		ug/L	mg/Kg ww										2016-08-11
Tetramethrin	Tetramethrin	7696120		ug/L	ug/Kg ww				Organics	Pesticides	Insecticides	Pyrethroids			2009-06-22
Tetramethylnaphthalene, 1,4,6,7-	1,4,6,7-Tetramethylnaphthalene	13764186		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Semi-VOAs				2010-07-08
Tetratriacontane, n-	n-Tetratriacontane	14167590					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Tetryl	Tetryl	479458		ug/L	ug/Kg dw				Organics						2019-12-18
T-Fluvalinate	T-Fluvalinate	102851069		ug/L	ug/Kg ww				Organics	Pesticides	Insecticides	Pyrethroids			2014-01-28
Thallium	Thallium	7440280		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals					2007-07-27
Theophylline	Theophylline	58559		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Theophylline-13C1-15N2(Surrogate)	Surrogate: Theophylline-13C1-15N2	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Thiabendazole	Thiabendazole	148798		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Thiabendazole-d6(Surrogate)	Surrogate: Thiabendazole-d6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Thiacloprid	Thiacloprid	111988499		ug/L	ng/g dw				Organics	Pesticides	Insecticides				2016-03-10
Thiamethoxam	Thiamethoxam	153719234		ug/L	ng/g dw				Pesticides	Insecticides					2012-06-21
Thiamethoxam-d3(Surrogate)	Surrogate: Thiamethoxam-d3	1294048820		% recovery	% recovery										2021-02-01
Thiazopyr	Thiazopyr	117718602		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides				2016-03-10
Thiobencarb	Thiobencarb (Benthiocarb) (Bolero)	28249776		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OPs				2013-06-24
Thiobencarb(Surrogate)	Surrogate: Thiobencarb (Benthiocarb) (Bolero)	28249776		% recovery					Organics	Herbicides					2016-05-20
Thionazin	Thionazin (Thionzin)	297972		ug/L	ng/g dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs				2007-07-27
Thiram	Thiram	0		ug/L					Organics	Pesticides	Fungicides				2017-04-04
Thorium	Thorium	7440291					ug/g ww	ug/g dw	Inorganics	Metals					2009-08-05
Tidal Height	Tidal Height	0	none						Habitat	NULL					2016-05-20
Tidal State	Tidal State	0	none						FieldObservations	Habitat					2012-09-13
TidalDirection	TidalDirection	0	none						Habitat						2014-11-04
Timber Harvest Extent	Timber Harvest Extent	0	none						Habitat						2019-05-07
Timber Harvest Intensity	Timber Harvest Intensity	0	none						Habitat						2019-05-07
Timber Harvest Proximity	Timber Harvest Proximity	0	none						Habitat						2019-05-07
Time, Fishing	Time spent fishing within a given waterbody	0	mins						Habitat						2012-09-13
Time, Shock	Time spent electroshocking within a given waterbody	0	seconds						Habitat						2012-09-13
TimeToSpinTest	Time the velocity meter spins during QA/QC calibration checks	0							WaterQualityMeasurements						2012-05-22
Tin	Tin	7440315		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals					2007-07-27
Tire	Tire	0	pieces						Debris	Trash	Non-Plastics	Construction			2014-11-04
Titanium	Titanium	7440326		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals					2007-07-27
Tokuthion	Tokuthion (Prothiofos)	34643464		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Tolfenpyrad	Tolfenpyrad	129558765		ng/L					Organics	Pesticides	Insecticides				2016-03-10
Toluene	Toluene	108883		ug/L					Organics	VOCs	MTBE_BTEX				2007-07-27
Toluene-d8(Surrogate)	Surrogate: Toluene-d8	2037265		ug/L					Organics	VOCs	MTBE_BTEX				2007-07-27
Tonalide	Tonalide	0			ug/Kg dw		ng/g ww	ng/g dw	Organics	Musk					2008-06-27
Toothbrush	Toothbrush	0	pieces						Debris	Trash	Plastics	Household			2014-11-04
Torrent 01	Torrent 01 - Recently devegetated corridor two or more times the width of the low flow channel	0	none						Habitat						2013-05-17
Torrent 02	Torrent 02 - Substrate cobbles or large gravel particles are not imbricated	0	none						Habitat						2013-05-17
Torrent 03	Torrent 03 - Channel has little evidence of pool-riffle structure	0	none						Habitat						2013-05-17
Torrent 04	Torrent 04 - Stream channel is scoured down to bedrock	0	none						Habitat						2013-05-17
Torrent 05	Torrent 05 - Gravel and cobble berms above bankfull level	0	none						Habitat						2013-05-17
Torrent 06	Torrent 06 - Massive deposits downstream of reach	0	none						Habitat						2013-05-17
Torrent 07	Torrent 07 - Riparian trees have fresh bark scars	0	none						Habitat						2013-05-17
Torrent 08	Torrent 08 - Riparian trees have fallen into channel as a result of scouring near their roots	0	none						Habitat						2013-05-17
Torrent 09	Torrent 09 - Massive deposits of sediment, logs and debris within reach	0	none						Habitat						2013-05-17
Torrent 10	Torrent 10 - Newly erroded deposites show evidence that the deposites are matrix supported	0	none						Habitat						2013-05-17
Torrent 11	Torrent 11 - No evidence of torrent scouring or torrent deposits	0	none						Habitat						2013-05-17
Total Alkanes	Total Alkanes	0					ng/g ww	ng/g dw	Organics	PAHs					2013-04-16
Total Anions	Total Anions	0		mg/L					Inorganics						2016-12-21
Total Cations	Total Cations	0		mg/L					Inorganics						2016-12-21
Total Cell Count	Total Cell Count	0				cells/ml			Toxicity						2007-07-27
Total Chlordanes	Total Chlordanes	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides					2008-11-07
Total DDDs	Total DDDs	0			ug/Kg dw				Organics	Pesticides					2016-09-19
Total DDEs	Total DDEs	0			ug/Kg dw				Organics	Pesticides					2016-09-19
Total DDTs	Total DDTs	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides					2008-11-07
Total DDTs - Lipid Basis	Total DDTs - Lipid Basis	0					ug/Kg lw	ug/Kg lw	Organics	Pesticides					2008-11-07
Total Debris, >2.5 cm	Total Debris >2.5 cm	0	L						Debris	Debris	Trash	Plastics			2014-11-04
Total Debris, 2.5 cm - 5 mm	Total Debris 2.5 cm - 5 mm	0	L						Debris	Debris	Trash	Plastics			2014-11-04
Total Dichlorobiphenyls	Total Dichlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2013-05-29
Total Dioxins-Furans (TEQ ND=0)	Total Dioxins-Furans (TEQ ND=0)	0		pg/L	ug/Kg dw				Organics	DioxinsDibenzofurans					2013-06-05
Total Dioxins-Furans (TEQ ND=1/2 DL)	Total Dioxins-Furans (TEQ ND=1/2 DL)	0		pg/L					Organics	DioxinsDibenzofurans					2013-06-05
Total Di-PCB	Total Di-PCB	0		pg/L					Organics	PCBs					2014-01-22
Total Dissolved Solids	Total Dissolved Solids	0		ug/L					Inorganics	Conventionals					2012-12-11
Total Endosulfans	Total Endosulfans	0					ug/Kg ww	ug/Kg dw	Organics	Pesticides					2008-11-07
Total Endosulfans - Lipid Basis	Total Endosulfans - Lipid Basis	0					ug/Kg lw	ug/Kg lw	Organics	Pesticides					2008-11-07
Total HCHs	Total HCHs	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides					2008-11-07
Total Heptachlorobiphenyls	Total Heptachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2013-05-29
Total Hepta-Dioxins	Total Hepta-Dioxins	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans					2008-06-27
Total Hepta-Furans	Total Hepta-Furans	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans					2008-06-27
Total Hepta-PCB	Total Hepta-PCB	0		pg/L					Organics	PCBs					2014-01-22
Total Hexachlorobiphenyls	Total Hexachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
Total Hexa-Dioxins	Total Hexa-Dioxins	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans					2008-06-27
Total Hexa-Furans	Total Hexa-Furans	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans					2008-06-27
Total Hexa-PCB	Total Hexa-PCB	0		pg/L					Organics	PCBs					2014-01-22
Total Hydrogen	Total Hydrogen	0			% dw				Inorganics	Conventionals					2009-10-26
Total Inorganic Carbon	Total Inorganic Carbon (TIC)	0			%				Inorganics	Conventionals					2013-05-20
Total MirexHCBChlorpy (SFEI)	Total MirexHCBChlorpy (SFEI)	0			ug/Kg dw				Organics	Pesticides					2014-01-28
Total Monochlorobiphenyls	Total Monochlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2013-05-29
Total Mono-PCB	Total Mono-PCB	0		pg/L					Organics	PCBs					2014-01-22
Total Nonachlorobiphenyls	Total Nonachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2013-05-29
Total Nona-PCB	Total Nona-PCB	0		pg/L					Organics	PCBs					2014-01-22
Total Normal	Total Normal	0			mg/Kg dw				Toxicity						2007-07-27
Total Octachlorobiphenyls	Total Octachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2013-05-29
Total Octa-PCB	Total Octa-PCB	0		pg/L					Organics	PCBs					2014-01-22
Total Organic Carbon	Total Organic Carbon (TOC)	0		ug/L	ug/g dw				Inorganics	Conventionals					2007-07-27
Total Organic Matter	Includes all the elements (hydrogen, oxygen, nitrogen, etc) that are components of organic compounds, not just carbon.	0			% dw										2019-11-19
Total PAHs	Total PAHs	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs					2008-11-07
Total PAHs - Lipid Basis	Total PAHs - Lipid Basis	0					ug/Kg lw	ug/Kg lw	Organics	PAHs					2008-11-07
Total PBDEs	Total PBDEs	0					pg/g ww	pg/g dw	Organics	FlameRetardants					2008-06-27
Total PCBs	Total PCBs	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
Total PCBs (Aroclors)	Total PCBs (Aroclors)	0			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2008-11-07
Total PCBs (Aroclors) - Lipid Basis	Total PCBs (Aroclors) - Lipid Basis	0					ug/Kg lw	ug/Kg lw	Organics	PCBs					2008-11-07
Total Pentachlorobiphenyls	Total Pentachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2013-05-29
Total Penta-Dioxins	Total Penta-Dioxins	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans					2008-06-27
Total Penta-Furans	Total Penta-Furans	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans					2008-06-27
Total Penta-PBDE	Total Penta-PBDE	0					ng/g lw	ng/g lw	Organics	FlameRetardants					2008-06-27
Total Penta-PCB	Total Penta-PCB	0		pg/L					Organics	PCBs					2014-01-22
Total Pyrethrins	Total Pyrethrins	0		ug/L					Organics	Pesticides					2016-10-25
Total Solids	Total Solids	0		mg/L	RPD		RPD	RPD	Inorganics	Conventionals					2012-12-11
Total Suspended Solids	Total Suspended Solids	0		ug/L	ug/L				Inorganics	Conventionals					2012-12-11
Total TEQ (WHO 2005; ND=0)	Total TEQ (WHO 2005; ND=0)	0		pg/L			ng/g ww	ng/g dw	Organics	DioxinsDibenzofurans					2008-06-27
Total TEQ (WHO 2005; ND=1/2DL)	Total TEQ (WHO 2005; ND=1/2DL)	0		pg/L			ng/g ww	ng/g dw	Organics	DioxinsDibenzofurans					2008-06-27
Total Terphenyls	Total Terphenyls	0					ng/g ww	ng/g dw	Organics	PCBs					1900-01-01
Total Tetrachlorobiphenyls	Total Tetrachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2013-05-29
Total Tetra-Dioxins	Total Tetra-Dioxins	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans					2008-06-27
Total Tetra-Furans	Total Tetra-Furans	0		pg/L	ug/Kg dw		pg/g ww	pg/g dw	Organics	DioxinsDibenzofurans					2008-06-27
Total Tetra-PBDE	Total Tetra-PBDE	0					ng/g lw	ng/g lw	Organics	FlameRetardants					2008-06-27
Total Tetra-PCB	Total Tetra-PCB	0		pg/L					Organics	PCBs					2014-01-22
Total Trichlorobiphenyls	Total Trichlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs					2013-05-29
Total Tri-PBDE	Total Tri-PBDE	0					ng/g lw	ng/g lw	Organics	FlameRetardants					2008-06-27
Total Tri-PCB	Total Tri-PCB	0		pg/L					Organics	PCBs					2014-01-22
TotalPieces	Total Pieces of Trash using Trash Protocol	0	pieces						Trash						2011-05-04
Tox_Amphipod	Sediment Quality Objectives Line of Evidence (SQO LOE) short-term amphipod survival toxicity test result. The result represents the response of amphipods to bay/estuary sediment samples collected at a station but exposed in a controlled laboratory.	0			score				Sediment Quality Objectives	Index/Metric					2024-05-31
Tox_Mussel	Sediment Quality Objectives Line of Evidence (SQO LOE) sublethal mussel toxicity test result. The result represents the response of mussel embryos to bay/estuary sediment samples collected at a station but exposed in a controlled laboratory.	0			score				Sediment Quality Objectives	Index/Metric					2024-05-31
Tox_Polychaete	Sediment Quality Objectives Line of Evidence (SQO LOE) polychaete growth in sediment toxicity test result. The result represents the response of worms exposed to bay/estuary sediment samples collected at a station under controlled laboratory conditions.	0			score				Sediment Quality Objectives	Index/Metric					2024-05-31
Toxaphene	Toxaphene	8001352		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides			2007-07-27
Toxic	Toxic using Trash Protocol	0	L						Trash						2011-05-04
Toxic, Other	Toxic, Other	0	pieces						Debris	Trash	Plastics	Toxic			2014-11-04
Toy	Toy	0	pieces						Debris	Trash	Plastics	Household			2014-11-04
TPH as Diesel C10-C22	TPH as Diesel C10-C22	0		ug/L					Organics	SVOCs					2014-05-01
TPH as Diesel C10-C23	TPH as Diesel C10-C23	0		ug/L											2017-03-17
TPH as Diesel C10-C24	TPH as Diesel C10-C24	0		ug/L					Organics						2015-06-25
TPH as Diesel C10-C25	TPH as Diesel C10-C25	0		mg/L					Organics	PAHs					2016-05-20
TPH as Diesel C10-C28	TPH as Diesel C10-C28	0		ug/L	ug/Kg ww				Organics	SVOCs					2013-07-01
TPH as Diesel C11-C12	TPH as Diesel C11-C12	0		ug/L					Organics	SVOCs					2016-08-19
TPH as Diesel C12-C24	TPH as Diesel C12-C24	0		ug/L					Organics	SVOCs					2014-01-29
TPH as Diesel C12-C25	TPH as Diesel C12-C25	0		ug/L	mg/Kg dw				Organics	PAHs					2016-05-20
TPH as Diesel C13-C14	TPH as Diesel C13-C14	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Diesel C13-C22	TPH as Diesel C13-C22	0		ug/L	ug/Kg ww				Organics	SVOCs					2016-07-11
TPH as Diesel C13-C28	TPH as Diesel C13-C28	0		ug/L					Organics	SVOCs					2022-05-26
TPH as Diesel C15-C16	TPH as Diesel C15-C16	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Diesel C17-C18	TPH as Diesel C17-C18	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Diesel C19-C20	TPH as Diesel C19-C20	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Diesel C21-C22	TPH as Diesel C21-C22	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Diesel C23-C24	TPH as Diesel C23-C24	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Diesel C23-C40	TPH as Diesel C23-C40	0		ug/L					Organics	SVOCs					2016-07-11
TPH as Diesel C25-C28	TPH as Diesel C25-C28	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Diesel C29-C40	TPH as Diesel C29-C40	0		ug/L											2017-01-12
TPH as Diesel C8-C21	TPH as Diesel C8-C21	0		ug/L					Organics	SVOCs					2014-01-29
TPH as Gasoline C11-C12	TPH as Gasoline C11-C12	0			mg/Kg dw										2020-06-19
TPH as Gasoline C3-C13	TPH as Gasoline C3-C13	0		mg/L					Organics	SVOCs					2018-03-08
TPH as Gasoline C4-C12	TPH as Gasoline C4-C12	0		ug/L	ug/Kg ww				Organics	SVOCs					2016-07-11
TPH as Gasoline C4-C13	TPH as Gasoline C4-C13	0		ug/L											2020-08-07
TPH as Gasoline C4-C5	TPH as Gasoline C4-C5	0			mg/Kg dw										2020-06-19
TPH as Gasoline C5-C12	TPH as Gasoline C5-C12	0		mg/L					Organics	SVOCs					2017-10-13
TPH as Gasoline C6	TPH as Gasoline C6	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Gasoline C6-C10	TPH as Gasoline C6-C10	0		ug/L					Organics	SVOCs					2014-01-29
TPH as Gasoline C6-C12	TPH as Gasoline C6-C12	0		ug/L	ug/Kg ww				Organics	SVOCs					2016-07-11
TPH as Gasoline C7	TPH as Gasoline C7	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Gasoline C8	TPH as Gasoline C8	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Gasoline C9-C10	TPH as Gasoline C9-C10	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Heavy Fuel Oils C22-C36	TPH as Heavy Fuel Oils C22-C36	0		mg/L					Organics	SVOCs					2014-05-01
TPH as JP8 C7-C18	TPH as JP8 C7-C18 (Jet Fuel 8)	0		mg/L					Organics	PAHs					2016-05-20
TPH as Motor Oil / Diesel C13-C44	TPH as Motor Oil / Diesel C13-C44	0			mg/Kg dw										2020-06-19
TPH as Motor Oil C14-C44	TPH as Motor Oil C14-C44	0			mg/Kg dw				Organics	PAHs					2016-07-05
TPH as Motor Oil C17-C44	TPH as Motor Oil C17-C44	0		ug/L											2020-08-07
TPH as Motor Oil C18-C36	TPH as Motor Oil C18-C36	0		ug/L					Organics	SVOCs					2016-09-22
TPH as Motor Oil C18-C40	TPH as Motor Oil C18-C40	0		ug/L					Organics						2025-05-29
TPH as Motor Oil C21-C32	TPH as Motor Oil C21-C32	0		ug/L					Organics	SVOCs					2014-01-29
TPH as Motor Oil C23-C36	TPH as Motor Oil C23-C36	0		ug/L					Organics						2019-05-01
TPH as Motor Oil C23-C40	TPH as Motor Oil C23-C40	0			ug/Kg ww				Organics	SVOCs					2016-10-26
TPH as Motor Oil C23-C44	TPH as Motor Oil C23-C44	0			mg/Kg dw										2020-06-19
TPH as Motor Oil C24-C36	TPH as Motor Oil C24-C36	0		ug/L					Organics	SVOCs					2017-04-19
TPH as Motor Oil C24-C40	TPH as Motor Oil C24-C40	0		ug/L					Organics						2015-06-25
TPH as Motor Oil C25-C36	TPH as Motor Oil C25-C36	0		ug/L	mg/Kg dw				Organics	PAHs					2016-05-20
TPH as Motor Oil C28-C44	TPH as Motor Oil C28-C44	0		mg/L											2023-03-06
TPH as Motor Oil C29-C40	TPH as Motor Oil C29-C40	0		ug/L					Organics	SVOCs					2024-05-31
TPH as Oil C29-C44	TPH as Oil C29-C44	0		mg/L					Organics	SVOCs					2018-03-08
TPH as Residual C29-C32	TPH as Residual C29-C32	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Residual C33-C36	TPH as Residual C33-C36	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Residual C37-C40	TPH as Residual C37-C40	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Residual C41-C44	TPH as Residual C41-C44	0		ug/L	mg/Kg dw				Organics	SVOCs					2016-08-19
TPH as Residual C6-C44	TPH as Residual C6-C44	0		ug/L											2017-05-25
Tralomethrin	Tralomethrin	66841256		ug/L					Organics	Pesticides	Insecticides				2014-01-28
TransectsSampled	Number of transects sampled to attain sample material	0	count						Habitat						2009-10-29
Transfluthrin	Transfluthrin	118712893			ug/Kg ww				Organics	Pesticides	Pyrethroids	Insecticides			2026-05-08
Transmittance	Transmittance	0		%					Inorganics	Conventionals	WaterQualityMeasurements				2007-07-27
Transparency	Transparency	0		cm					FieldObservations						2015-06-26
Transportation Other Extent	Transportation Other Extent	0	none						Habitat						2019-05-07
Transportation Other Intensity	Transportation Other Intensity	0	none						Habitat						2019-05-07
Transportation Other Proximity	Transportation Other Proximity	0	none						Habitat						2019-05-07
Trash at >96" Drain	Trash at >96" Drain	0	none						Debris						2014-11-04
Trash at 12" Drain	Trash at 12" Drain	0	none						Debris						2014-11-04
Trash at 18" Drain	Trash at 18" Drain	0	none						Debris						2014-11-04
Trash at 24" Drain	Trash at 24" Drain	0	none						Debris						2014-11-04
Trash at 30" Drain	Trash at 30" Drain	0	none						Debris						2014-11-04
Trash at 36" Drain	Trash at 36" Drain	0	none						Debris						2014-11-04
Trash at 48" Drain	Trash at 48" Drain	0	none						Debris						2014-11-04
Trash at 60" Drain	Trash at 60" Drain	0	none						Debris						2014-11-04
Trash, Litter	Trash, Litter	0	none						Habitat						2009-08-20
Trash/Dumping Extent	Trash/Dumping Extent	0	none						Habitat						2019-05-07
Trash/Dumping Intensity	Trash/Dumping Intensity	0	none						Habitat						2019-05-07
Trash/Dumping Proximity	Trash/Dumping Proximity	0	none						Habitat						2019-05-07
Tree_Diameter	Diameter at breast height of the largest potential legacy tree visible from the location	0	m						Habitat						2012-09-05
Tree_Distance	Distance from the wetted edge to the largest potential legacy tree visible from the location	0	m						Habitat						2012-09-05
Tree_Height	Height of the largest potential legacy tree visible from the location	0	m						Habitat						2012-09-05
Tree_TaxonomicCategoryCode	Taxonomic Category Code of the largest potential legacy tree visible from the location	0	none						Habitat						2012-09-05
Trenbolone	Trenbolone	10161338		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Trenbolone Acetate	Trenbolone Acetate	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2013-05-29
Triacontane, n-	n-Triacontane	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	Alkanes					2014-01-28
Triacontane, n-(Surrogate)	Surrogate: n-Triacontane	0		% recovery					Organics	VOCs					2016-05-20
Triadimefon	Triadimefon	43121433		ug/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Triadimenol	Triadimenol	55219653		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Triallate	Triallate	2303175		ng/L	ug/Kg dw				Organics	Pesticides	Herbicides				2016-03-10
Triamterene	Triamterene	396010		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Tribromobenzene, 1,3,5-	1,3,5-Tribromobenzene (TBBZ)	626391			ng/g dw				Organics	FlameRetardants					2015-07-16
Tribromophenol, 2,4,6-	2,4,6-Tribromophenol	118796		ug/L					Organics	SVOCs					2016-05-20
Tribromophenol, 2,4,6-(Surrogate)	Surrogate: 2,4,6-Tribromophenol	118796		ug/L					Organics	VOCs	Phenols	non-Chlorinated Phenols	Brominated Phenols		2016-03-02
Tributyl Phosphate-d27(IsoDilAnalogue)	Isotope Dilution Analogue: Tributyl Phosphate-d27 (TBP-d27)	61196267		% recovery					Organics	FlameRetardants	PhosphateFlameRetardants	IDA			2026-02-10
Tributyl Phosphorotrithioate, S,S,S-	S,S,S-Tributyl Phosphorotrithioate (Def) (Butifos) (Merphos)	78488		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OPs				2013-05-28
Tributylphosphate	Tributylphosphate (TBP)	126738		ug/L	ug/Kg dw				Organics	FlameRetardants					2014-03-13
Tributylphosphate(Surrogate)	Surrogate: Tributylphosphate (Butyl Phosphate)	126738		% recovery	% recovery				Organics	Pesticides	Pest-OPs				2016-03-02
Tributyltin as Sn	Tributyltin as Sn (TBT)	688733		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Organotins	Biocide				2010-06-21
Tributyltin as Sn-d27(Surrogate)	Surrogate: Tributyltin as Sn-d27	0		% recovery	% recovery				Organics	Organotins	Biocide				2010-06-21
Trichlorfon	Trichlorfon	52686		ug/L	mg/Kg ww				Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Trichloro-1,2,2-trifluoroethane, 1,1,2-	1,1,2-Trichloro-1,2,2-trifluoroethane	79131		ug/L					Organics	VOCs					2007-12-14
Trichloro-2-pyridinyl)oxy)acetic Acid, ((3,5,6-	((3,5,6-Trichloro-2-pyridinyl)oxy)acetic Acid (Triclopyr)	55335063		ug/L					Organics	Herbicides					2013-05-20
Trichloroacetic Acid	Trichloroacetic Acid (TCAA)	76039		ug/L					Organics	Haloacetic acids (HAAs)					2025-11-05
Trichlorobenzene, 1,2,3-	1,2,3-Trichlorobenzene	87616		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs					2007-07-27
Trichlorobenzene, 1,2,3-(Surrogate)	Surrogate: 1,2,3-Trichlorobenzene	0		% recovery	% recovery		% recovery	% recovery	Organics	SVOCs					2014-01-29
Trichlorobenzene, 1,2,4-	1,2,4-Trichlorobenzene	120821		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs					2007-07-27
Trichlorobenzene, 1,3,5-	1,3,5-Trichlorobenzene	108703			ug/Kg dw		ng/g ww	ng/g dw	Organics	SVOCs					2014-01-29
Trichlorobenzene-13C6, 1,2,3-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3-Trichlorobenzene-13C6	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA				2023-10-26
Trichloroethane, 1,1,1-	1,1,1-Trichloroethane	71556		ug/L					Organics	VOCs					2007-07-27
Trichloroethane, 1,1,2-	1,1,2-Trichloroethane	79005		ug/L					Organics	VOCs					2007-07-27
Trichloroethylene	Trichloroethylene (Trichloroethene)	79016		ug/L					Organics	VOCs					2013-05-28
Trichlorofluoromethane	Trichlorofluoromethane	75694		ug/L					Organics	VOCs					2007-07-27
Trichloronate	Trichloronate	327980		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Organics	Pesticides	Pest-OPs	Insecticides			2007-07-27
Trichlorophenol, 2,3,6-	2,3,6-Trichlorophenol	0		ug/L			ug/Kg ww	ug/Kg dw	Organics	SVOCs					2014-01-29
Trichlorophenol, 2,4,5-	2,4,5-Trichlorophenol	95954		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	Chlorinated Phenols			2007-07-27
Trichlorophenol, 2,4,6-	2,4,6-Trichlorophenol	88062		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs	Phenols	Chlorinated Phenols			2007-07-27
Trichlorophenoxy)propionic Acid, 2-(2,4,5-	2-(2,4,5-Trichlorophenoxy)propionic Acid (2,4,5-TP) (Silvex) (Fenoprop)	93721		ug/L	ug/kg				Organics	Herbicides					2016-05-20
Trichlorophenoxyacetic Acid, 2,4,5-	2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T)	93765		ug/L	ug/kg				Organics	Herbicides					2013-06-03
Trichlorophenoxyacetic Acid, 2,4,5-(Surrogate)	Surrogate: 2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T)	93765		% recovery	% recovery				Organics	Herbicides					2016-03-02
Trichloropropane, 1,2,3-	1,2,3-Tricloropropane	96184		ug/L					Organics	VOCs					2007-07-27
Triclocarban	Triclocarban	101202		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Triclocarban-13C6(Surrogate)	Surrogate: Triclocarban-13C6	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Triclopyr	Triclopyr	55335063		ug/L					Organics	Pesticides					2008-11-17
Triclosan	Triclosan	3380345		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Triclosan-13C12(Surrogate)	Surrogate: Triclosan-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Triclosan-13C6(Surrogate)	Surrogate: Triclosan-13C6	0		% recovery					Organics	PPCPs					2012-05-22
Triclosan-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Triclosan-d3	1020719985		% recovery					Organics						2022-07-22
Triclosan-d3(Surrogate)	Surrogate: Triclosan-d3	0		% recovery					Organics	PPCPs					2018-08-07
Tricosane, n-	n-Tricosane	638675					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Tricresyl Phosphate	Tricresyl Phosphate (TCrP)	1330785		ng/L	ng/g dw				Organics	FlameRetardants					2014-03-13
Tricyclazole	Tricyclazole (5-methyl-1,2,4-triazolo[3,4-b]benzothiazole)	0		ug/L											2017-01-12
Tridecane, 2-phenyl-	2-Phenyl-tridecane	0			ng/g dw				Organics	VOCs					2016-05-20
Tridecane, 3-phenyl-	3-Phenyl-tridecane	0			ng/g dw				Organics	VOCs					2016-05-20
Tridecane, 4-phenyl-	4-Phenyl-tridecane	0			ng/g dw				Organics	VOCs					2016-05-20
Tridecane, 5-phenyl-	5-Phenyl-tridecane	0			ng/g dw				Organics	VOCs					2016-05-20
Tridecane, 6/7-phenyl-	6-Phenyltridecane/7-Phenyltridecane	0			ng/g dw				Organics	VOCs					2016-05-20
Tridecane, n-	n-Tetratriacontane	629505					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Tridimephon	Triadimefon	43121433		ug/L					Organics	Pesticides	Fungicides				2016-10-25
Triethyl Phosphate	Triethyl Phosphate (TEP)	78400		ng/L	ng/g dw				Organics	FlameRetardants					2015-07-16
Triethyl Phosphate-d15(IsoDilAnalogue)	Isotope Dilution Analogue: Triethyl Phosphate-d15 (TEP-d15)	135942119		% recovery					Organics	FlameRetardants	PhosphateFlameRetardants	IDA			2026-02-10
Trifloxystrobin	Trifloxystrobin	141517217		ug/L	ug/Kg dw				Organics	Fungicides					2016-05-20
Triflumizole	Triflumizole	68694111		ug/L	ug/Kg dw				Organics	Fungicides					2016-05-20
Trifluorotolunene, a,a,a-(Surrogate)	Surrogate: a,a,a-Trifluorotoluene	0		% recovery					Organics	VOCs					2016-05-20
Trifluralin	Trifluralin	1582098		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Herbicides					2007-07-27
Trifluralin-d14(Surrogate)	Surrogate: Trifluralin-d14	0		% recovery					Organics	Pesticides					2018-03-04
Trihalomethanes, Total	Total Trihalomethanes	0		ug/L					Organics	VOCs					2010-06-23
Triisobutyl Phosphate	Triisobutyl Phosphate (TIBP)	126716			ng/g dw				Organics	FlameRetardants					2015-07-16
Trimethoprim	Trimethoprim	738705		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Trimethoprim-13C3(Surrogate)	Surrogate: Trimethoprim-13C3	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Trimethylbenzene, 1,2,4-	1,2,4-Trimethylbenzene	95636		ug/L					Organics	VOCs	Herbicides				2007-07-27
Trimethylbenzene, 1,3,5-	1,3,5-Trimethylbenzene	108678		ug/L					Organics	VOCs					2007-07-27
Trimethylnaphthalene, 1,6,7-	1,6,7-Trimethylnaphthalene	0			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs					2012-05-22
Trimethylnaphthalene, 2,3,5-	2,3,5-Trimethylnaphthalene	2245387		ug/mL	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH			2007-07-27
Trimethylnaphthalene, 2,3,6-	2,3,6-Trimethylnaphthalene	829265		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs	Semi-VOAs				2010-07-08
Trimethylphenanthrene, 1,2,6-	1,2,6-Trimethylphenanthrene	0		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PAHs					2014-01-28
Trimethylphenol, 2,4,6-(Surrogate)	Surrogate: 2,4,6-Trimethylphenol	527606		% recovery					Organics	PAHs	SVOCs	Phenols	Surfactants		2010-05-18
Trinitrophenylnitramine, Methyl-2,4,6-	Methyl-2,4,6-trinitrophenylnitramine (Tetryl)	479458		ug/L	ug/Kg dw				Organics						2026-04-08
Trinitrotoluene, 2,4,6-	2,4,6-Trinitrotoluene (TNT)	118967		ug/L	ug/Kg dw				Organics						2019-12-18
Tripentyltin(Surrogate)	Surrogate: Tripentyltin	0		% recovery	ug/Kg dw				Inorganics	Metals					2015-10-19
Triphenyl Phosphate	Triphenyl Phosphate	0		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	FlameRetardants					2013-05-29
Triphenyl Phosphate(Surrogate)	Surrogate: Triphenyl Phosphate	115866		ug/L	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OPs				2016-03-02
Triphenyl Phosphate-13C18(IsoDilAnalogue)	Isotope Dilution Analogue: Triphenyl Phosphate-13C18 (TPhP-13C18) (TPP-13C18)	0		% recovery					Organics	FlameRetardants	PhosphateFlameRetardants	IDA			2026-02-10
Triphenylene	Triphenylene	0			ug/Kg dw				Organics	PAHs					2014-01-28
Tripropyl Phosphate	Tripropyl Phosphate (TPrP)	513086		ng/L	ng/g dw				Organics	FlameRetardants					2014-03-13
Tripropyl Phosphate-d21(IsoDilAnalogue)	Isotope Dilution Analogue: Tripropyl Phosphate-d21 (TPrP-d21)	1219794929		% recovery					Organics	FlameRetardants	PhosphateFlameRetardants	IDA			2026-02-10
Tripropyltin(Surrogate)	Surrogate: Tripropyltin	0			% recovery		% recovery	% recovery	Organics	Organotins					2014-01-28
Tris(1,1-dimethylethyl)phenol, 2,4,6-	2,4,6-Tris(1,1-dimethylethyl)phenol	0					ug/Kg ww	ug/Kg dw	Organics	Phenols					2010-07-14
Tris(1,3-dichloroisopropyl)phosphate	Tris(1,3-dichloroisopropyl)phosphate (TDCPP)	13674878		ng/L	ug/Kg dw				Organics	FlameRetardants					2014-03-20
Tris(1,3-Dichloroisopropyl)Phosphate-d15(IsoDilAnalogue)	Isotope Dilution Analogue: Tris(1,3-Dichloroisopropyl)Phosphate-d15 (TDCPP-d15)	1447569778		% recovery					Organics	FlameRetardants	PhosphateFlameRetardants	IDA			2026-04-16
Tris(1,3-dichloroisopropyl)phosphate-d15(Surrogate)	Surrogate: Tris(1,3-dichloroisopropyl)phosphate-D15 (TDCPP-d15)	1447569778		% recovery					Organics	FlameRetardants					2026-06-12
Tris(1-Chloro-2-Propyl) Phosphate-d18(IsoDilAnalogue)	Isotope Dilution Analogue: Tris(1-Chloro-2-Propyl) Phosphate-d18 (TCPP-d18)	1447569789		% recovery					Organics	FlameRetardants	PhosphateFlameRetardants	IDA			2026-02-10
Tris(1-chloro-2-propyl)phosphate	Tris(1-chloro-2-propyl)phosphate (TCPP, multiple isomers)	13674845		ng/L	ng/g dw				Organics	FlameRetardants					2009-11-10
Tris(2,3-dibromopropyl) phosphate	Tris(2,3-dibromopropyl) phosphate (TDBPP)	126727		ng/L	ng/g dw				Organics	FlameRetardants					2014-03-13
Tris(2-butoxyethyl)phosphate	Tris(2-butoxyethyl)phosphate (TBEP)	78513		ng/L	ug/Kg dw				Organics	FlameRetardants					2014-03-13
Tris(2-Chloroethyl) Phosphate-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Tris(2-Chloroethyl) Phosphate-d12 (TCEP-d12)	1276500470		% recovery					Organics	FlameRetardants	PhosphateFlameRetardants	IDA			2026-02-10
Tris(2-chloroethyl)phosphate	Tris(2-chloroethyl)phosphate (TCEP)	115968		ng/L	ug/Kg dw				Organics	FlameRetardants					2014-03-13
Tris(2-ethylhexyl) phosphate	Tris(2-ethylhexyl) phosphate (TEHP)	78422		ng/L	ng/g dw				Organics	FlameRetardants					2014-03-13
Tris(2-isopropylphenyl)phosphate	Tris(2-isopropylphenyl)phosphate (TiPPP)	64532952			ng/g dw				Organics	FlameRetardants					2015-07-16
Tris(3,5-dimethylphenyl)phosphate	Tris(3,5-dimethylphenyl)phosphate (T35DMPP)	25653161			ng/g dw				Organics	FlameRetardants					2015-07-16
Tris(4-Chlorophenyl)Methane	Tris(4-Chlorophenyl)Methane (TCPM, T4CPM)	27575786					ng/g ww	ng/g dw	Organics						2026-03-12
Tris-Methane	Tris-Methane	0		RPD					Organics	VOCs					2014-02-05
Tris-Methanol	Tris-Methanol	0		RPD					Organics	VOCs					2014-02-05
Trithion, Methyl	Methyl Trithion	953173		ug/L					Organics	Pesticides	Insecticides				2016-06-07
Triticonazole	Triticonazole	131983727		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10
Tritium	Tritium	15086109		pCi/L					Inorganics						2013-05-20
Tritium 2scu	Tritium 2-sigma Combined Uncertainty	0		pCi/L					Inorganics						2013-06-03
Tritriacontane, n-	n-Tritriacontane	630057					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
TrophicStatus	General classification of trophic status based on observed algae and herbaceous plant levels	0	none						Habitat						2012-09-13
TRPH	Total Recoverable Petroleum Hydrocarbons (TRPH)	0		mg/L	mg/Kg dw				Organics	PAHs					2016-05-20
Turbidity	Turbidity	0		NTU					Inorganics	Conventionals	WaterQualityMeasurements	Habitat			2009-08-20
Tylosin	Tylosin	1401690		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2012-05-22
Ultraviolet Absorption (254nm)	Ultraviolet Absorption (254nm)	0		ABS/cm					Inorganics						2016-04-26
Undecane, 2-phenyl-	2-Phenyl-undecane	0			ng/g dw				Organics	VOCs					2016-05-20
Undecane, 3-phenyl-	3-Phenyl-undecane	0			ng/g dw				Organics	VOCs					2016-05-20
Undecane, 4-phenyl-	4-Phenyl-undecane	0			ng/g dw				Organics	VOCs					2016-05-20
Undecane, 5-phenyl-	5-Phenyl-undecane	0			ng/g dw				Organics	VOCs					2016-05-20
Undecane, 6-phenyl-	6-Phenyl-undecane	0			ng/g dw				Organics	VOCs					2016-05-20
Undecane, n-	n-Undecane	1120214					ng/g ww	ng/g dw	Organics	Alkanes					2013-05-01
Undercut Distance	Undercut Distance	0	m						Habitat						2009-08-20
Unknown Macro Foam	Foam of unknown origin, not analyzed in a lab	0	pieces						Debris	Trash					2022-12-02
Unnatural Inflows Extent	Unnatural Inflows Extent	0	none						Habitat						2019-05-07
Unnatural Inflows Intensity	Unnatural Inflows Intensity	0	none						Habitat						2019-05-07
Unnatural Inflows Proximity	Unnatural Inflows Proximity	0	none						Habitat						2019-05-07
Unpaved Roads Extent	Unpaved Roads Extent	0	none						Habitat						2019-05-07
Unpaved Roads Intensity	Unpaved Roads Intensity	0	none						Habitat						2019-05-07
Unpaved Roads Proximity	Unpaved Roads Proximity	0	none						Habitat						2019-05-07
UplandSlope	Slope of bank or upland area	0	%						Habitat						2012-09-13
Uranium	Uranium	0		ug/L	mg/Kg dw		ug/g ww	ug/g dw	Inorganics	Metals					2014-01-29
Urban Commercial Extent	Urban Commercial Extent	0	none						Habitat						2019-05-07
Urban Commercial Intensity	Urban Commercial Intensity	0	none						Habitat						2019-05-07
Urban Commercial Proximity	Urban Commercial Proximity	0	none						Habitat						2019-05-07
Urban Residential Extent	Urban Residential Extent	0	none						Habitat						2019-05-07
Urban Residential Intensity	Urban Residential Intensity	0	none						Habitat						2019-05-07
Urban Residential Proximity	Urban Residential Proximity	0	none						Habitat						2019-05-07
Urban Water Quality Other Extent	Urban Water Quality Other Extent	0	none						Habitat						2019-05-07
Urban Water Quality Other Intensity	Urban Water Quality Other Intensity	0	none						Habitat						2019-05-07
Urban Water Quality Other Proximity	Urban Water Quality Other Proximity	0	none						Habitat						2019-05-07
Urea	Urea	0		ug/L					Organics	Carbamide					2011-11-02
Utensil	Utensil	0	pieces						Debris	Trash	Plastics	FoodService			2014-11-04
Valley Width	Valley Width	0	m						Habitat						2009-08-20
Valsartan	Valsartan	137862534		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Vanadium	Vanadium	7440622		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	Metals					2007-07-27
Vector Control Extent	Vector Control Extent	0	none						Habitat						2019-05-07
Vector Control Intensity	Vector Control Intensity	0	none						Habitat						2019-05-07
Vector Control Proximity	Vector Control Proximity	0	none						Habitat						2019-05-07
VectorControl_Bs	Vector Control through Bs (Bacillus sphaericus) within waterbody	0	none						Habitat						2012-09-13
VectorControl_Bti	Vector Control through Bti (Bacillus Thuringensis Israelensis) within waterbody	0	none						Habitat						2012-09-13
VectorControl_Methoprene	Vector Control through Methoprene within waterbody	0	none						Habitat						2012-09-13
VectorControl_Mosquitofish	Vector Control through Mosquitofish within waterbody	0	none						Habitat						2012-09-13
VectorControl_Oil	Vector Control through Oil within waterbody	0	none						Habitat						2012-09-13
Veg_Emergent	Percent cover of emergent vegetation within a given area	0	%						Habitat						2012-09-13
Veg_Open	Percent cover of open space within a given area	0	%						Habitat						2012-09-13
Veg_SubmergedAlgae	Percent cover of submerged algae within a given area	0	%						Habitat						2012-09-13
Veg_SubmergedOther	Percent cover of submerged other (non-algae) within a given area	0	%						Habitat						2012-09-13
Veg_SurfaceAlgae	Percent cover of surface algae within a given area	0	%						Habitat						2012-09-13
Veg_SurfaceOther	Percent cover of surface other (non-algae) within a given area	0	%						Habitat						2012-09-13
Vegetation Cover Bank	Percent of both bank surfaces upstream of sample location estimated to be covered by vegetation (plants & roots at water's edge)	0	none						FieldObservations	Habitat					2010-03-03
Vegetation Cover Instream	Percent of stream's water surface upstream of sample location estimated to be covered by aquatic vegetation	0	none						FieldObservations	Habitat					2010-03-03
Vegetation Cover Quality Metric	Metric assesses the quality of vegetation cover in the riparian and channel zones	0	score						Habitat						2019-05-13
Vegetation Cover Structure Metric	Metric assesses structural complexity of the riparian environment in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte. Grasses are excluded.	0	score						Habitat						2019-05-13
Velocity	Velocity	0		m/s					WaterQualityMeasurements						2009-08-20
Verapamil	Verapamil	52539		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Vernolate	S-propyl N,N-dipropylcarbamothioate	0		ug/L											2017-01-12
Versalide	Versalide	0					ng/g ww	ng/g dw	Organics	Musk					2008-06-27
Vinclozolin	Vinclozolin	50471448		ug/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-10-25
Vineyards Extent	Vineyards Extent	0	none						Habitat						2019-05-07
Vineyards Intensity	Vineyards Intensity	0	none						Habitat						2019-05-07
Vineyards Proximity	Vineyards Proximity	0	none						Habitat						2019-05-07
Vinyl Acetate	Vinyl Acetate	108054		ug/L											2016-09-06
Vinyl Chloride	Vinyl Chloride	75014		ug/L					Organics	VOCs					2007-07-27
Virginiamycin	Virginiamycin	11006761		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Volume	Volume	0		L					Habitat						2009-08-20
W1_HALL_SWAMP	Riparian human disturbance index, all types, proximity-weighted sum	0	none						Bioassessment						2021-01-28
Wadeability	Wadeability	0	none						FieldObservations	Habitat					2009-08-20
Walking Path Extent	Walking Path Extent	0	none						Habitat						2019-05-07
Walking Path Intensity	Walking Path Intensity	0	none						Habitat						2019-05-07
Walking Path Proximity	Walking Path Proximity	0	none						Habitat						2019-05-07
Warfarin	Warfarin	81812		ng/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PPCPs					2010-04-26
Warfarin-d5(Surrogate)	Surrogate: Warfarin-d5	0		% recovery	% recovery		% recovery	% recovery	Organics	PPCPs					2010-04-26
Waste, Food	Waste, Food	0	pieces						Debris	Natural	Non-Plastics	Biodegradable	Marine Origin		2014-11-04
Waste, Pet	Waste, Pet	0	pieces						Debris	Natural	Non-Plastics	Toxic			2014-11-04
Waste, Yard	Waste, Yard	0	pieces						Debris	Natural	Non-Plastics	Biodegradable	Marine Origin		2014-11-04
Water Control Actions Other Extent	Water Control Actions Other Extent	0	none						Habitat						2019-05-07
Water Control Actions Other Intensity	Water Control Actions Other Intensity	0	none						Habitat						2019-05-07
Water Control Actions Other Proximity	Water Control Actions Other Proximity	0	none						Habitat						2019-05-07
Water Control Features Other Extent	Water Control Features Other Extent	0	none						Habitat						2019-05-07
Water Control Features Other Intensity	Water Control Features Other Intensity	0	none						Habitat						2019-05-07
Water Control Features Other Proximity	Water Control Features Other Proximity	0	none						Habitat						2019-05-07
Water level below Reference Point	Distance from reference point to water surface	0	m						Habitat						2015-01-26
Water Level Fluctuations	Water Level Fluctuations	0	none						Habitat						2009-08-20
Water Withdrawal	Water Withdrawal	0	none						Habitat						2009-08-20
Waterbody Appeal	Waterbody Appeal	0	none						Habitat						2009-08-20
Waterbody Disturbance	Waterbody Disturbance	0	none						Habitat						2009-08-20
WaterbodyOrigin	Origin of the waterbody	0	none						Habitat						2012-09-13
WaterClarity	WaterClarity	0		none					FieldObservations	Habitat					2009-08-20
Wave Height	Wave Height	0	ft						Habitat	NULL					2016-05-20
WaveAction	Wind Movement of Water on Surface	0	none						FieldObservations	Habitat					2022-02-25
Weight	Weight	0	pounds		g ww	mg/ind			Toxicity						2011-12-13
Weirs Extent	Weirs Extent	0	none						Habitat						2019-05-07
Weirs Intensity	Weirs Intensity	0	none						Habitat						2019-05-07
Weirs Proximity	Weirs Proximity	0	none						Habitat						2019-05-07
WetlandClass	Class or type of wetland	0	none						Habitat						2012-09-13
WetlandFunction_FloodControl	Function of the wetland for flood control use	0	none						Habitat						2012-09-13
WetlandFunction_HumanUse	Function of the wetland for human use	0	none						Habitat						2012-09-13
WetlandFunction_Stormwater	Function of the wetland for stormwater use	0	none						Habitat						2012-09-13
WetlandFunction_Wildlife	Function of the wetland for wildlife use	0	none						Habitat						2012-09-13
Wetted habitat	Wetted habitat (standing or flowing surface water)	0	%						Habitat						2019-05-07
Wetted Width	Wetted Width	0	m						Habitat						2009-08-20
Width	Width	0	m						Habitat						2009-08-20
WindDirection	WindDirection	0	none						FieldObservations	Habitat					2009-08-20
WindIntensity	Intensity of wind at the time of sampling	0	none						Habitat						2012-09-13
WindSpeed	WindSpeed	0	none						FieldObservations	Habitat					2009-08-20
Wire	Wire	0	pieces						Debris	Trash	Non-Plastics	Metals			2014-11-04
Wood Debris	Wood Debris	0	pieces						Debris	Natural	Non-Plastics	Construction	Marine Origin		2014-11-04
Wrapper, Food	Wrapper, Food	0	pieces						Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Wrapper, Other	Wrapper, Other	0	pieces						Debris	Trash	Plastics	Bags/Packaging			2014-11-04
Wrapper, Plastic Straw	Wrapper, Plastic Straw	0	pieces						Debris	Trash	Plastics	Bags/Packaging			2014-11-04
XBKF_W	Mean bankfull width of reach	0	m						Bioassessment						2021-01-28
XCDENMID	Mean percent mid-channel canopy density	0	%						Bioassessment						2021-01-28
XCMG	Riparian cover as sum of three layers physical-habitat metric	0	%						Bioassessment						2021-01-28
XCMGW	Mean riparian woody cover as sum of three layers	0	none						Bioassessment						2021-01-28
XFC_NAT_SWAMP	Mean sum of natural instream cover types	0	none						Bioassessment						2021-01-28
XSLOPE	Mean slope (water surface gradient) of reach	0	%						Bioassessment						2021-01-28
Xylene, m/p-	m-Xylene/p-Xylene	179601231		ug/L					Organics	VOCs	MTBE_BTEX	Xylenes			2013-04-10
Xylene, o-	o-Xylene	95476		ug/L					Organics	VOCs	MTBE_BTEX	Xylenes			2007-07-27
Xylenes, Total	Total Xylenes	1330207		ug/L					Organics	VOCs	MTBE_BTEX	Xylenes			2013-05-28
Young/female	Young/female (#)	0				Num/Rep			Toxicity						2007-07-27
Ytterbium	Ytterbium	7440644		ug/L					Inorganics						2013-05-20
Yttrium	Yttrium	7440655		ug/L			ug/g ww	ug/g dw	Inorganics	Metals					2014-01-29
Zinc	Zinc	7440666		ug/L	umol/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals				2007-07-27
Ziram	Ziram	137304		ug/L					Organics	Pesticides	Fungicides				2008-03-17
Zoxamide	Zoxamide	156052685		ng/L	ug/Kg dw				Organics	Pesticides	Fungicides				2016-03-10

CEDEN Data Checker Lookup Lists

CEDEN LookUp List: AnalytewithUnitperMatrix